We prepared cocrystals of DL-2-Hydroxy-2-phenylacetic acid (D, L-H₂ma) with the pyridinecarboxamide isomers, picolinamide (pic) and isonicotinamide (inam). They were characterized by elemental analysis, single crystal and powder X-ray, IR spectroscopy and ¹H and ¹³C NMR. The crystal and molecular structures of (pic)-(D-H₂ma) (1), (nam)-(L-H₂ma) (2) and (inam)-(L-H₂ma) (3) were studied. The crystal packing is stabilized primarily by hydrogen bonding and in some cases through π-π stacking interactions. The analysis of crystal structures reveals the existence of the characteristic heterosynthons with the binding motif $R_2^2$(8) (primary amide–carboxilic acid) between pyridinecarboxamide molecules and the acid. Other synthons involve hydrogen bonds such as O-H_(carboxyl)···N_(pyridine) and O-H_(hydroxyl)···N_(pyridine) depending on the isomer. The packing of 1 and 3 is formed by tetramers, for whose formation a crystallization mechanism based on two stages is proposed, involving an amide–acid (1) or amide–amide (3) molecular recognition in the first stage and the formation of others, and interdimeric hydrogen bonding interactions in the second. The thermal stability of the cocrystals was studied by differential scanning calorimetry and thermogravimetry. Further studies were conducted to evaluate other physicochemical properties of the cocrystals in comparison to the pure coformers. Density-functional theory (DFT) calculations (including NCIplot and QTAIM analyses) were performed to further characterize and rationalize the noncovalent interactions. Full article

Background: Adverse pregnancy outcomes (APOs) are associated with periodontal disease owing to the induction of a chronic systemic inflammatory response. Hence, knowledge of periodontal status during pregnancy is important in order to reduce the risk of APOs. The aim of this study was to compare the risk of APOs in women with and without periodontal disease to ascertain whether regular scaling performed prior to pregnancy improves the risk of APOs. Method: This case-control study enrolled1,386,887 pregnant women from the National Health Insurance Research Database who gave birth to their first child between 1 January 2004 and 31 December 2014. The study population included mothers who gave birth to low birth weight (LBW) and non-LBW newborns, totaling 86,958 and 1,299,929, respectively. Scaling and periodontal emergency treatment during and before pregnancy were assessed. Univariable and multivariable logistic regression analyses were performed to identify the associations between periodontal treatment and LBW risk. Results: Compared with the comparison cohort, the pregnant women who didnot have periodontal emergency treatment or scaling treatment during pregnancy exhibited a significantly increased risk of LBW than those who had treatment. Women who underwent scaling within the2 years before pregnancy or during pregnancy had a lower risk of delivering a LBW baby (odds ratio (OR), 0.93; 95% confidence interval (CI), 0.91–0.94). In the normal group, the mothers who had periodontal emergency treatment within the2 years before pregnancy or during pregnancy had a higher risk of delivering a LBW baby (OR, 1.05; 95% CI, 1.02–1.08). In those who had scaling treatment, a lower risk of delivering a LBW baby was noted (OR, 0.95; 95% CI, 0.93–0.97). Conclusion: The risk of LBW was significantly increased in women who underwent periodontal treatment, and our findings suggested that periodontal disease is an important risk factor for preterm LBW babies in an East Asian population. Full article

Social cohesion is recognised as the glue that holds societies together and is connected to numerous positive social outcomes. Many authors have defined the term and its dimensions, leading to a wide range of different perspectives. Indeed, an array of dimensions have emerged as researchers have conceptualized social cohesion based on the theoretical assumptions of their disciplines. This wide range of disciplinary contributions has created a rich but muddled research field. In line with the growing recognition of social cohesion, there is a need to better understand social cohesion’s evolution and status within broader academic research. Thus, this study has two main objectives: (i) to analyse the nature and evolution of literature related to social cohesion and (ii) to identify the thematic areas related to social cohesion research and their connections to specific disciplines. To achieve this, a bibliometric analysis of 5027 journal articles listed in the Web of Science (WoS) was conducted. Through this, a substantial increase in research activity was noted, and the broad, multidisciplinary nature of the research is also illustrated. However, there remains room for further collaboration across disciplines as well as research exploring how different social groups and institutions contribute to social cohesion. Full article

The locus coeruleus (LC) is a vertebrate-specific nucleus and the primary source of norepinephrine (NE) in the brain. This nucleus has conserved properties across species: highly homogeneous cell types, a small number of cells but extensive axonal projections, and potent influence on brain states. Comparative studies on LC benefit greatly from its homogeneity in cell types and modularity in projection patterns, and thoroughly understanding the LC-NE system could shed new light on the organization principles of other more complex modulatory systems. Although studies on LC are mainly focused on mammals, many of the fundamental properties and functions of LC are readily observable in other vertebrate models and could inform mammalian studies. Here, we summarize anatomical and functional studies of LC in non-mammalian vertebrate classes, fish, amphibians, reptiles, and birds, on topics including axonal projections, gene expressions, homeostatic control, and modulation of sensorimotor transformation. Thus, this review complements mammalian studies on the role of LC in the brain. Full article

Late-onset Pompe disease (LOPD) is a rare, progressive disorder characterized by limb–girdle muscle weakness and/or respiratory insufficiency, caused by acid alpha-glucosidase (GAA) gene mutations and treated with enzyme replacement therapy. We studied isometric muscle strength in eight muscle groups bilaterally using a Biodex^® dynamometer, as well as the Medical Research Council sum score (MRC-SS), hand grip strength, 6 min walk distance (6MWD), 10 m walk test (10MWT) and timed up-and-go test (TUG) in 12 adult, ambulatory, treated LOPD patients and 12 age-/gender-matched healthy controls, every 6 months for 2 years. The mean isometric muscle strength showed a significant decline in right and left knee extensors at 12 months in controls (p < 0.014; p < 0.016), at 18 months in patients (p < 0.010; p < 0.007) and controls (only right side, p < 0.030) and at 24 months in both groups (p < 0.035). The mean 6MWD in patients significantly decreased after 24 months, from 451.9 m to 368.1 m (p < 0.003), whereas in controls, the mean 6MWD significantly increased after 6 months (p < 0.045) and 18 months (p < 0.020) (at 24 months p = 0.054). In patients and controls, the MRC-SS, hand grip test, 10MWT and TUG did not show significant changes (p > 0.05). We conclude that the 6MWD is a useful outcome measure to detect motor decline in treated LOPD patients. Full article

Anabolic androgenic steroids (AASs) are synthetic analogs of testosterone that can affect the immune system. Bodybuilders and sportsmen are at risk of abusing AASs. The aim of this study was to investigate the association between AASs use and coronavirus disease (COVID-19). This cross-sectional study included adults aged 18 years and above. Between 16 April and 23 June 2021, gym-attending participants completed an online survey. Multivariable analysis was performed using multiple logistic regression to identify factors associated with COVID-19 diagnosis and severity. Current use of AASs was reported in 7.5% of the 520 study participants. Approximately 20% of the study participants reported that they had contracted COVID-19, approximately half of whom reported moderate to severe disease. Contracting COVID-19 was reported more frequently by current users than by non-current users (35.90% vs. 18.92%, p = 0.011). Multivariable analysis revealed that contracting COVID-19 was nearly five times more likely among current users of AASs than among non-current users (OR = 4.89, 95% CI: 1.69–14.13). Current use of AASs was also associated with greater odds of moderate to severe COVID-19 disease (OR = 3.71, 95% CI: 1.04–13.21). Our findings suggest that the use of AASs could be an underlying risk factor for COVID-19 severity. Full article

In this paper, we present secondary research on recommended cybersecurity practices for social media users from the user’s point of view. Through following a structured methodological approach of the systematic literature review presented, aspects related to cyber threats, cyber awareness, and cyber behavior in internet and social media use are considered in the study. The study presented finds that there are many cyber threats existing within the social media platform, such as loss of productivity, cyber bullying, cyber stalking, identity theft, social information overload, inconsistent personal branding, personal reputation damage, data breach, malicious software, service interruptions, hacks, and unauthorized access to social media accounts. Among other findings, the study also reveals that demographic factors, for example age, gender, and education level, may not necessarily be influential factors affecting the cyber awareness of the internet users. Full article

Background: This study aims to evaluate the performance, in terms of accumulation of antioxidant compounds in fruits, of nine local and three commercial Italian tomato cultivars subjected to drought stress. The same local cultivars had been previously studied at morpho-physiological level. Methods: The present manuscript analyzes drought stress as a tool to increase the amount of secondary metabolites that can enhance fruit quality. Nutraceutical characterization of the fruits was performed by analyzing the content of antioxidants, phenols, flavonoids, lycopene, ascorbic acid (vitamin C), rutin, caffeic acid, and naringenin. At the same time, plant sensitivity to stress during the reproductive phase was monitored in terms of flower abscission, fruit drop, and seed germination. Results: Perina turns out to be the tomato cultivar with the best nutraceutical properties in the absence of stress while the Quarantino cultivar is so for flavonoid content (control plants) and lycopene and vitamin C content (stressed plants). Perina and Quarantino are the cultivars with the best response to drought and Perina has the highest concentrations of bioactives. Quarantino responds most effectively to stress in the reproductive phase. Conclusions: data confirm that drought stress increases bioactive production in some local cultivars of tomato, which produce higher quality fruits. Full article

Since Noninvasive Follicular Thyroid Neoplasm with Papillary-like Nuclear Features (NIFTP) was introduced as a new thyroid tumour entity, many studies, and meta-analyses on diagnosing NIFTP have been published. NIFTP-revised histopathological criteria emerged in 2018. NIFTP is defined as a histological entity and its diagnosis requires a careful histological examination. Its molecular profile is similar to follicular-like tumours. Ultrasound features are unable to differentiate NIFTP. NIFTP is not a cytological diagnosis, but it influences the risk of malignancy in several categories of The Bethesda System for Reporting Thyroid Cytopathology terminology. Full article

Retrograde intrarenal surgery (RIRS) is an innovative and effective method of kidney stones treatment, as it had great influence on the development of endoscopy in urology. The increasing prevalence of urolithiasis together with the rapid development of endourology leads to a rise in the number of procedures related to the disease. Flexible ureteroscopy is constantly being improved, especially regarding the effectiveness and safety of the procedure. The purpose of this study is to evaluate intraoperative and early post-operative complications of RIRS in the treatment of kidney stones. A retrospective analysis of medical records was performed. A series was comprised of 207 consecutive operations performed from 2017 to 2020. Complications occurred in 19.3% (n = 40) of patients. Occurrence according to the Clavien-Dindo scale was: 11.1% for grade I, 5.8% for grade II and 2.4% for grade IV. Infectious complications included SIRS (5.3%, n = 11) and sepsis (2.4%, n = 5). Statistical analysis revealed a correlation between acute post-operative infections and positive midstream urine culture, history of chronic or recurrent urinary tract infections, and increased body mass index (BMI). Furthermore, a significant correlation was observed between pain requiring the use of opioids with BMI over 25. Consequently, history of urinary tract infections, positive pre-operative urine culture, and increased BMI are considered risk factors and require appropriate management. Full article

Benzophenone-3 (BP3) is an organic UV filter whose presence in the aquatic environment has been linked to detrimental developmental impacts in aquatic organisms such as coral and fish. The genus Rhodococcus has been extensively studied and is known for possessing large genomes housing genes for biodegradation of a wide range of compounds, including aromatic carbons. Here, we present the genome sequence of Rhodococcus sp. USK10, which was isolated from Chinese riverbank sediment and is capable of utilising BP3 as the sole carbon source, resulting in full BP3 mineralisation. The genome consisted of 9,870,030 bp in 3 replicons, a G+C content of 67.2%, and 9722 coding DNA sequences (CDSs). Annotation of the genome revealed that 179 of these CDSs are involved in the metabolism of aromatic carbons. The complete genome of Rhodococcus sp. USK10 is the first complete, annotated genome sequence of a Benzophenone-3-degrading bacterium. Through radiolabelling, it is also the first bacterium proven to mineralise Benzophenone-3. Due to the widespread environmental prevalence of Benzophenone-3, coupled with its adverse impact on aquatic organisms, this characterisation provides an integral first step in better understanding the environmentally relevant degradation pathway of the commonly used UV filter. Given USK10′s ability to completely mineralise Benzophenone-3, it could prove to be a suitable candidate for bioremediation application. Full article

The transfer-purge chamber is an operation room for nuclear fuel transport and purging in a nuclear power plant, which has a demand for structural reliability and radiation protection. The transfer-purge chamber has features such as large curvature, heavy concrete, long overhang, and irregular cross-sections, and it is constructed of double steel plates reinforced concrete (SC) structure. This study performed shaking table tests for a 1:4.5 scale model of the transfer-purge chamber. Three sets of ground motions were input in the scale model in the horizontal and vertical directions to study its structural reliability and seismic performance. Acceleration response and strain response of the structure were analyzed to evaluate the dynamic characteristics of the transfer-purge chamber under the ground motion. The results show that the transfer-purge chamber has great stiffness and short periods. The periods slightly increase with the rise of intensity of seismic ground motions. Under the excitation of ground motions, the dynamic response of the transfer-purge chamber is slight. No obvious deformation or damage occurred on the transfer-purge chamber, and cracking in concrete or buckling on steel plate did not appear. The transfer-purge chamber has excellent seismic performance, and it is sufficiently safe and reliable from a structural perspective. Full article

This paper presents a new Fuel Cell Fuel Consumption Minimization Strategy (FCFCMS) for Hybrid Electric Vehicles (HEVs) powered by a fuel cell and an energy storage system, in order to minimize as much as possible the consumption of hydrogen while maintaining the State Of Charge (SOC) of the battery. Compared to existing Energy Management Strategies (EMSs) (such as the well-known State Machine Strategy (SMC), Fuzzy Logic Control (FLC), Frequency Decoupling and FLC (FDFLC), and the Equivalent Consumption Minimization Strategy (ECMS)), the proposed strategy increases the overall vehicle energy efficiency and, therefore, minimizes the total hydrogen consumption while respecting the constraints of each energy and power element. A model of a hybrid vehicle has been built using the TruckMaker/MATLAB software. Using the Urban Dynamometer Driving Schedule (UDDS), which includes several stops and accelerations, the performance of the proposed strategy has been compared with these different approaches (SMC, FLC, FDFLC, and ECMS) through several simulations. Full article

Background: The purpose of this study was to evaluate the association between thyroid cancer and breast cancer. Methods: Data from the Korean National Health Insurance Service-Health Screening Cohort were collected from 2002 to 2013. In study I, 3949 thyroid cancer participants were 1:4 matched with 15,796 control I participants, and hazard ratios (HRs) with 95% confidence intervals (CIs) for breast cancer were evaluated using a stratified Cox proportional hazard model. In study II, 3308 breast cancer participants were 1:4 matched with 13,232 control II participants, and HRs with 95% CIs for thyroid cancer were assessed in the same way as in study I. In the subgroup analyses, associations were analyzed according to radioactive iodine (RAI) treatment and age (<60 years old and ≥60 years old). Results: The adjusted HR for breast cancer in the thyroid cancer group was 1.64 (95% CI = 1.13–2.39, p = 0.010). The adjusted HR for thyroid cancer in the breast cancer group was 1.91 (95% CI = 1.47–2.49, p < 0.001). In the subgroup analyses, the groups that were older and not treated with RAI treatment showed consistent results in study I, and the younger and older groups showed consistent results in study II. Conclusions: Based on this cohort study, breast and thyroid cancer have a reciprocal positive association. Full article

The peste des petits ruminants (PPR) is a deadly viral disease of small ruminants, which are an important source of livelihood for hundreds of millions of poor smallholders throughout Africa, the Middle East, and Asia. PPR vaccination efforts often focus on overcoming financial, technological, and logistical constraints that limit their reach and effectiveness. This study posits that it is equally important to pay attention to the role of gender and other intersecting social and cultural factors in determining individual and groups’ ability to access PPR vaccines or successfully operate within the vaccine distribution system. We compare three study contexts in Nepal, Senegal, and Uganda. Qualitative data were collected through a total of 99 focus group discussions with men and women livestock keepers and animal health workers, 83 individual interviews, and 74 key informant interviews. Our findings show that there are not only important gender differences, but also interrelated structures of inequalities, which create additional sites of exclusion. However, these intersections are not generalizable across contexts—except for the intersection of gender and geographic remoteness, which is salient across vaccine distribution systems in the three countries—and social markers such as caste, ethnicity, and livelihood are associated with vulnerability only in specific settings. In order to address the distinct needs of livestock keepers in given settings, we argue that an intersectional analysis combined with context-dependent vaccination approaches are critical to achieving higher vaccination rates and, ultimately, PPR disease eradication by 2030. Full article

The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2′-deoxyadenosine (A^Br), 8-oxo-2′-deoxyadenosine (A^oxo) or β-L-2′-deoxyadenosine (A^L) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an A^L residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date. Full article

User-friendly devices for detecting low gliadin content in commercial foods are of extreme importance for people with gluten diseases. With this concern, the present work proposes a rapid and sensitive optical nanostructured microarrays platform for the detection of gliadin using specific anti-gliadin IgG antibodies immobilized on annealed gold nanostructures (AuNPs) obtained after the high annealing process (550 °C) of gold thin films evaporated on commercial glass coverslips. Localized Surface Plasmon Resonance (LSPR) immunosensing of gliadin in the range of 0.1 ppm to 1000 ppm is successfully achieved. In addition, the biofunctionalization protocol was used for gluten screening in five food complex products. Full article

Previous scholarly literature has documented a pronounced increase in the prevalence of prejudice-denoting terms in American news media content. Some have referred to this shift in journalistic discourse and related public opinion trends signaling increasing perceptions of prejudice severity in U.S. society as The Great Awokening. This work analyzes whether the increasing prevalence of prejudice themes in American news media outlets has been replicated in the news media ecosystem of a Spanish-speaking country. Thus, we computationally analyzed the prevalence of words denoting prejudice in five million news and opinion articles written between 1976 and 2019 and published in three of the most widely read newspapers in Spain: El País, El Mundo and ABC. We report that within the studied time period, the frequency of terms that denote specific prejudice types related to gender, ethnicity, sexuality and religious orientation has also substantially increased across the analyzed Spanish news media outlets. There are, however, some notable distinctions in the long-term usage dynamics of prejudice-denoting terms between the leading Spanish newspaper of record, El País, and its U.S. counterpart, The New York Times. Full article

Recent studies have demonstrated that phages can be co-transported with motile non-host bacteria, thereby enabling their invasion of biofilms and control of biofilm composition. Here, we developed a novel approach to isolate non-host bacteria able to co-transport phages from soil. It is based on the capability of phage-carrying non-host bacteria to move along mycelia out of soil and form colonies in plaques of their co-transported phages. The approach was tested using two model phages of differing surface hydrophobicity, i.e., hydrophobic Escherichia virus T4 (T4) and hydrophilic Pseudoalteromonas phage HS2 (HS2). The phages were mixed into soil and allowed to be transported by soil bacteria along the mycelia of Pythium ultimum. Five phage-carrying bacterial species were isolated (Viridibacillus sp., Enterobacter sp., Serratia sp., Bacillus sp., Janthinobacterium sp.). These bacteria exhibited phage adsorption efficiencies of ≈90–95% for hydrophobic T4 and 30–95% for hydrophilic HS2. The phage adsorption efficiency of Viridibacillus sp. was ≈95% for both phages and twofold higher than T4-or HS2-adsorption to their respective hosts, qualifying Viridibacillus sp. as a potential super carrier for phages. Our approach offers an effective and target-specific way to identify and isolate phage-carrying bacteria in natural and man-made environments. Full article

Carbonate sand is often encountered and utilized as construction material in offshore engineering projects. Carbonate sand particles, which are porous and angular, are found to be highly crushable under high stress conditions, whereas the mechanisms and controlling factors for the crushing of carbonate sand particles are not well developed. The crushability and particle strength of around 400 particles from three fractions (5–10 mm, 2–5 mm, and 1–2 mm) of carbonate sand from the South China Sea were investigated via grain-scale single particle crushing tests. Special emphasis was placed on the effect of external constraint conditions (i.e., coordination number) and intrinsic particle morphology characteristics on the particle strength of carbonate soil. The particle strength of carbonate sand was found to be around half of quartz sand in terms of characteristic stress. Negative correlations, which could be depicted by an exponential equation, were found between the particle size and particle strength. Due to elongated particle shape and tensile stress concentration, a higher coordination number may lower the particle strength, which contradicts what was reported for quartz sands. A series of seven fundamental particle dimensions and five particle shape descriptors was characterized, and the aspect ratio was found to be one of the more influential shape descriptors for particle strength. The results enriched the database for the analysis of highly irregular geomaterial and provided insights into controlling factors of particle strength and crushing mechanisms of the carbonate sand. Full article

(1) Background: Carbapenem-resistant Klesiella pneumoniae (CR-KP) infection rates depict an almost pre-antibiotic scenario since the pipeline for effective antibiotics against this pathogen has been almost entirely depleted. This study aims to evaluate the antibacterial effect of gold nanostars (GNS) alone or associated with some of the most widely used antibiotics for the treatment of CR-KP strains, i.e., meropenem or amikacin, on both planktonic and sessile forms. Additionally, we measured the effect of GNS on cell proliferation and biocompatibility in invertebrate in vivo models. (2) Materials and methods: GNS were made from gold seeds grown using a seeded-growth surfactant-free method assisted by silver ions and functionalized with mercapto-poly(ethylene glycol)amino by ligand exchange. The antimicrobial capacity, effect on cell proliferation, and biocompatibility of the most effective combination was evaluated in a Galleria mellonella model. (3) Results: The minimum inhibitory concentration (MIC) and minimal bactericidal concentration (MBC) were 80 and 160 µM of GNS for all strains, respectively. The minimum biofilm inhibitory concentration (MBIC) and minimum biofilm eradication concentration (MBEC) were >320 µM of GNS for both. A synergy was found between GNS and amikacin. Larvae administered GNS plus amikacin were found to tolerate the treatment well, which prevented infection. (4) Conclusions: GNS are a promising anti-CR-KP nanomaterial. Full article

Background: The multi-disciplinary tumor board (MTB) is essential to quality cancer care and currently recommended to offer the best personalized clinical approach, but little has been published regarding MTBs in neuro-oncology (nMTBs). The aim of the present paper is to describe our nMTB, to evaluate its impact on clinical management decisions, and to assess the role of neuroradiologists. Methods: The retrospective evaluation of the cases discussed at our nMTB from March 2017 to March 2020. From the electronic records, we extracted epidemiological, clinical and other specific data of nMTB. From the radiological records, we calculated data relating to the number, time for revision, and other specifications of MRI re-evaluation. Statistical analysis was performed. Results: a total of 447 discussions were analyzed, representing 342 patients. The requests for case evaluations came from radiation oncologists (58.8%) and neurosurgeons (40.5%), and were mainly addressed to the neuroradiologist (73.8%). The most frequent questions were about the treatment’s changes (64.4%). The change in patient treatment was reported in 40.5% of cases, 76.8% of these were based on the neuroradiologic assessment. A total of 1514 MRI examinations were re-evaluated, employing approximately 67 h overall. The median of the MRI exams reviewed per patient was 3 (min–max 1–12). Conclusions: Our study supported that the multidisciplinary approach to patient care can be particularly effective in managing brain tumors. A review by an expert neuroradiologist impacts patient management in the context of nMTBs, but has costs in terms of the time and effort spent preparing for it. Full article

The micro- and mini-distributed generation (MMDG) has significantly increased after the normative resolution No. 482/2012 in Brazil; the installed capacity surpassed 7 GW in 2021. In the international context, a similar event was observed, whose process generated a cross-subsidy for other consumers, in addition to other problems that affect the economic balance of concessionaires. To mitigate this issue, the National Electric Energy Agency (ANEEL) is in the process of revising current rules. Thus, this study estimates the weight of this decision, through a methodology adapted from international assessment models, based on information from the Brazilian regulatory system. In order to achieve it, this paper presents metrics to define the potential market MMDG, based on the consumption patterns of consumers. Then, through time series analysis, the MMDG demand curve is estimated under two scenarios up to 2030. Finally, the economic impact on tariff adjustments and revisions, and their effect on the electric power concessionaires are evaluated. In the distribution companies of the Enel Group alone, economic losses are estimated at USD 1.2 billion by 2030; 53% of this will be passed on to consumers’ tariffs. Thus, based on international experiences, it can be concluded that the best model is the adequate grid remuneration. Full article