Advancing Open Science
for more than 25 years
MDPI is a pioneer in scholarly open access publishing
and has supported academic communities since 1996.
Article
Exploratory Study of the Frequency of Detection and Tissue Distribution of Porcine Circovirus 3 (PCV-3) in Pig Fetuses at Different Gestational Ages
by , , , , and
Pathogens 2022, 11(2), 118; https://doi.org/10.3390/pathogens11020118 (registering DOI) - 20 Jan 2022
Abstract
Porcine circovirus 3 (PCV-3) has been associated with several pig diseases. Despite the pathogenicity of this virus has not been completely clarified, reproductive disorders are consistently associated with its infection. The aim of the present work was to analyze the presence of PCV-3 [...] Read more.
Porcine circovirus 3 (PCV-3) has been associated with several pig diseases. Despite the pathogenicity of this virus has not been completely clarified, reproductive disorders are consistently associated with its infection. The aim of the present work was to analyze the presence of PCV-3 DNA in tissues from pig fetuses from different gestational timepoints. The fetuses were obtained either from farms with no reproductive problems (NRP, n = 249; all of them from the last third of gestation) or from a slaughterhouse (S, n = 51; 49 of the second-third of gestation and 2 from the third one). Tissues collected included brain, heart, lung, kidney, and/or spleen. Overall, the frequency of detection of PCV-3 was significantly higher in fetuses from the last third of the gestation (69/251, 27.5%) when compared to those from the second-third (5/49, 10.2%), although the viral loads were not significantly different. Moreover, the frequency of detection in NRP fetuses (69/249, 27.7%) was significantly higher than in S ones (5/51, 9.8%). Furthermore, PCV-3 DNA was detected in all tissue types analyzed. In conclusion, the present study demonstrates a higher frequency of PCV-3 DNA detection in fetuses from late periods of the gestation and highlights wide organ distributions of the virus in pig fetuses. Full article
(This article belongs to the Collection Emerging and Re-emerging Pathogens)
Article
Clinical Significance of BTLA, CD27, CD70, CD28 and CD80 as Diagnostic and Prognostic Markers in Ovarian Cancer
by , , , , , and
Diagnostics 2022, 12(2), 251; https://doi.org/10.3390/diagnostics12020251 (registering DOI) - 20 Jan 2022
Abstract
It is very important to find new diagnostic and prognostic biomarkers. A total of 79 patients were enrolled in the study. The study group consisted of 37 patients with epithelial ovarian cancer, and the control group consisted of 42 patients with benign ovarian [...] Read more.
It is very important to find new diagnostic and prognostic biomarkers. A total of 79 patients were enrolled in the study. The study group consisted of 37 patients with epithelial ovarian cancer, and the control group consisted of 42 patients with benign ovarian lesions. Five proteins involved in the immune response were studied: BTLA, CD27, CD70, CD28, CD80. The study material was serum and peritoneal fluid. The ROC curve was plotted, and the area under the curve was calculated to characterize the sensitivity and specificity of the studied parameters. Univariate and multivariate analyses were performed simultaneously using the Cox regression model. The cut-off level of CD27 was 120.6 pg/mL, with the sensitivity and specificity of 66 and 84% (p = 0.014). Unfavorable prognostic factors determined in serum were: CD27 (for PFS: HR 1.26, 95% CI 1.21–1.29, p = 0.047; for OS: HR 1.20, 95% CI 1.15–1.22, p = 0.014). Unfavorable prognostic factors determined in peritoneal fluid were: BTLA (for OS: HR 1.26, 95% CI 1.25–1.31, p = 0.033). We conclude that CD27 should be considered as a potential biomarker in the diagnosis of ovarian cancer. BTLA and CD27 are unfavorable prognostic factors for ovarian cancer. Full article
(This article belongs to the Special Issue Diagnosis and Management of Gynecological Cancers)
Show Figures

Figure 1

Article
Relationship between Postpartum Metabolic Status and Subclinical Endometritis in Dairy Cattle
by , , , and
Animals 2022, 12(3), 242; https://doi.org/10.3390/ani12030242 (registering DOI) - 20 Jan 2022
Abstract
The aim of this study was to verify the importance of postpartum serum levels of certain metabolic markers as risk factors for subclinical endometritis (SE). Ninety-four Holstein cows were included in the study, and examinations were carried out between 30–45 days postpartum. Rectal [...] Read more.
The aim of this study was to verify the importance of postpartum serum levels of certain metabolic markers as risk factors for subclinical endometritis (SE). Ninety-four Holstein cows were included in the study, and examinations were carried out between 30–45 days postpartum. Rectal palpation, vaginoscopy, transrectal ultrasound, endometrial cytology, and blood sample collections were performed. The percentage of polymorphonuclear neutrophils (%PMN) on the endometrium was evaluated, as well as serum levels of glucose, cholesterol, triglyceride, albumin, hepatic enzymes, urea, non-esterified fatty acids (NEFA), and β-hydroxybutyrate acid (BHBA). Samples with ≥8% PMN were classified as positive to subclinical endometritis. According to the serum levels of BHBA, cows were classified as clinical ketosis (>2.6 mmol/L), subclinical ketosis (1.2–2.6 mmol/L), and healthy (<1.2 mmol/L). Additionally, body condition score, parity, date of last labor, peripartum issues, insemination date, date of pregnancy diagnosis and milk production information were collected. Data were analyzed using a multiple regression analysis. The results showed that as serum levels of BHBA rose, also did the %PMN, so that up to 60% of cows with clinical ketosis suffered from SE. On the other hand, the %PMN fell as serum levels of urea and albumin increased. Consequently, good postpartum management practices and early detection of metabolic alterations are necessary measures to control predisposing factors and reduce the incidence of SE. Full article
(This article belongs to the Special Issue Reproductive Tract Inflammatory Disease in Postpartum Dairy Cows)
Show Figures

Figure 1

Article
Multicomponent Solids of DL-2-Hydroxy-2-phenylacetic Acid and Pyridinecarboxamides
by , , , , and
Crystals 2022, 12(2), 142; https://doi.org/10.3390/cryst12020142 (registering DOI) - 20 Jan 2022
Abstract
We prepared cocrystals of DL-2-Hydroxy-2-phenylacetic acid (D, L-H2ma) with the pyridinecarboxamide isomers, picolinamide (pic) and isonicotinamide (inam). They were characterized by elemental analysis, single crystal and powder X-ray, IR spectroscopy and 1H and [...] Read more.
We prepared cocrystals of DL-2-Hydroxy-2-phenylacetic acid (D, L-H2ma) with the pyridinecarboxamide isomers, picolinamide (pic) and isonicotinamide (inam). They were characterized by elemental analysis, single crystal and powder X-ray, IR spectroscopy and 1H and 13C NMR. The crystal and molecular structures of (pic)-(D-H2ma) (1), (nam)-(L-H2ma) (2) and (inam)-(L-H2ma) (3) were studied. The crystal packing is stabilized primarily by hydrogen bonding and in some cases through π-π stacking interactions. The analysis of crystal structures reveals the existence of the characteristic heterosynthons with the binding motif R22(8) (primary amide–carboxilic acid) between pyridinecarboxamide molecules and the acid. Other synthons involve hydrogen bonds such as O-H(carboxyl)···N(pyridine) and O-H(hydroxyl)···N(pyridine) depending on the isomer. The packing of 1 and 3 is formed by tetramers, for whose formation a crystallization mechanism based on two stages is proposed, involving an amide–acid (1) or amide–amide (3) molecular recognition in the first stage and the formation of others, and interdimeric hydrogen bonding interactions in the second. The thermal stability of the cocrystals was studied by differential scanning calorimetry and thermogravimetry. Further studies were conducted to evaluate other physicochemical properties of the cocrystals in comparison to the pure coformers. Density-functional theory (DFT) calculations (including NCIplot and QTAIM analyses) were performed to further characterize and rationalize the noncovalent interactions. Full article
(This article belongs to the Special Issue Multicomponent Pharmaceutical Solids)
Show Figures

Graphical abstract

Article
Optimization of Active Power Losses in Smart Grids Using Photovoltaic Power Plants
by , , and
Energies 2022, 15(3), 739; https://doi.org/10.3390/en15030739 (registering DOI) - 20 Jan 2022
Abstract
This article addresses the reduction of power losses in smart grids. Two optimization algorithms are used in this article. The first method is the enumerative method. The second method of the optimization calculation is based on the self-organizing migrating algorithm. In the first [...] Read more.
This article addresses the reduction of power losses in smart grids. Two optimization algorithms are used in this article. The first method is the enumerative method. The second method of the optimization calculation is based on the self-organizing migrating algorithm. In the first step, the network parameters are calculated based on the input data, and then the target function is determined. In this article, the target function is used to reduce the active power losses that occur during the operation of an electric network. More specifically, we attempt to determine the reactive power with the enumerative and SOMA algorithms to reduce the value of the active power losses. This article intends to illustrate the differences between the selected optimization algorithms. As observed, the optimization algorithm determines the computation time. Full article
Show Figures

Figure 1

Brief Report
Attentive Processes and Blood Lactate in the Sambo
by , , , , , , and
Int. J. Environ. Res. Public Health 2022, 19(3), 1113; https://doi.org/10.3390/ijerph19031113 (registering DOI) - 20 Jan 2022
Abstract
Background: Sambo is a martial art and combat sport that originated in the Soviet Union. There are two main stiles, Sport Sambo and Combat Sambo which resembles modern mixed martial arts. Very little literature is available about physiological aspects of Sambo and, in [...] Read more.
Background: Sambo is a martial art and combat sport that originated in the Soviet Union. There are two main stiles, Sport Sambo and Combat Sambo which resembles modern mixed martial arts. Very little literature is available about physiological aspects of Sambo and, in particular, on the possible effects on cognitive domains. The purpose of the present research was to determine if there is a correlation between a blood lactate increase and the intensity and/or selectivity of attentions. Methods: Sixteen male athletes practicing Sambo for at least 5 years participated voluntarily in the study. Each athlete had to sustain, with an interval of one week, both a Sport Sambo match and a Combat Sambo match, each lasting 5 min. Blood lactate levels as well as attentive capacities were evaluated at three different times: at rest, i.e., 5 min before the start of the session (pre), at end of the session and 15 min after its conclusion. Reaction time protocol was used to evaluate the intensity of attention, whereas divided attention was assessed for analyzing the selectivity of attention together with errors and omissions. Results: Concerning Sport Sambo, blood lactate was 1.66 mmol/L (±0.55 SD) before the session, reached a mean value of 3.40 mmol/L (±0.45 SD) at the end of the session (end) and returned to values similar to initial ones (a mean value of 1.98 mmol/L (±0.37 SD) after 15 min (15-end). None of the attentive parameters examined, showed statistically significant differences. Conversely, for Combat Sambo, it was found a significant increase in blood lactate levels that went from 1.66 mmol/L (±0.55 SD) before the session (pre), to 4.76 mmol/L (±0.60 SD) at the end (end) and then back to values similar to those observed before the session 15 min after its conclusion (15-end), i.e., 1.97 mmol/L (±0.37 SD); however, after a Combat Sambo session increases in blood lactate were associated with significant worsening of attentional mechanisms. Conclusions: In conclusion, in all the participants, the worsening of attentional mechanisms was observed only after the Combat Sambo session in which blood lactate values exceeded 4 mmol/L. This figure, also known as the Onset of Blood Lactate Accumulation (OBLA), is commonly used to determine the anaerobic threshold. Full article
(This article belongs to the Special Issue The Development of Expertise and Excellence in Sport Psychology)
Show Figures

Figure 1

Article
Impact of Scaling and Periodontal Treatment during Pregnancy on the Risk of Adverse Birth Outcomes
by , , , , , and
J. Pers. Med. 2022, 12(2), 137; https://doi.org/10.3390/jpm12020137 (registering DOI) - 20 Jan 2022
Abstract
Background: Adverse pregnancy outcomes (APOs) are associated with periodontal disease owing to the induction of a chronic systemic inflammatory response. Hence, knowledge of periodontal status during pregnancy is important in order to reduce the risk of APOs. The aim of this study was [...] Read more.
Background: Adverse pregnancy outcomes (APOs) are associated with periodontal disease owing to the induction of a chronic systemic inflammatory response. Hence, knowledge of periodontal status during pregnancy is important in order to reduce the risk of APOs. The aim of this study was to compare the risk of APOs in women with and without periodontal disease to ascertain whether regular scaling performed prior to pregnancy improves the risk of APOs. Method: This case-control study enrolled1,386,887 pregnant women from the National Health Insurance Research Database who gave birth to their first child between 1 January 2004 and 31 December 2014. The study population included mothers who gave birth to low birth weight (LBW) and non-LBW newborns, totaling 86,958 and 1,299,929, respectively. Scaling and periodontal emergency treatment during and before pregnancy were assessed. Univariable and multivariable logistic regression analyses were performed to identify the associations between periodontal treatment and LBW risk. Results: Compared with the comparison cohort, the pregnant women who didnot have periodontal emergency treatment or scaling treatment during pregnancy exhibited a significantly increased risk of LBW than those who had treatment. Women who underwent scaling within the2 years before pregnancy or during pregnancy had a lower risk of delivering a LBW baby (odds ratio (OR), 0.93; 95% confidence interval (CI), 0.91–0.94). In the normal group, the mothers who had periodontal emergency treatment within the2 years before pregnancy or during pregnancy had a higher risk of delivering a LBW baby (OR, 1.05; 95% CI, 1.02–1.08). In those who had scaling treatment, a lower risk of delivering a LBW baby was noted (OR, 0.95; 95% CI, 0.93–0.97). Conclusion: The risk of LBW was significantly increased in women who underwent periodontal treatment, and our findings suggested that periodontal disease is an important risk factor for preterm LBW babies in an East Asian population. Full article
Show Figures

Figure 1

Article
A Bibliometric Analysis of Research on Social Cohesion from 1994–2020
by
Publications 2022, 10(1), 5; https://doi.org/10.3390/publications10010005 (registering DOI) - 20 Jan 2022
Abstract
Social cohesion is recognised as the glue that holds societies together and is connected to numerous positive social outcomes. Many authors have defined the term and its dimensions, leading to a wide range of different perspectives. Indeed, an array of dimensions have emerged [...] Read more.
Social cohesion is recognised as the glue that holds societies together and is connected to numerous positive social outcomes. Many authors have defined the term and its dimensions, leading to a wide range of different perspectives. Indeed, an array of dimensions have emerged as researchers have conceptualized social cohesion based on the theoretical assumptions of their disciplines. This wide range of disciplinary contributions has created a rich but muddled research field. In line with the growing recognition of social cohesion, there is a need to better understand social cohesion’s evolution and status within broader academic research. Thus, this study has two main objectives: (i) to analyse the nature and evolution of literature related to social cohesion and (ii) to identify the thematic areas related to social cohesion research and their connections to specific disciplines. To achieve this, a bibliometric analysis of 5027 journal articles listed in the Web of Science (WoS) was conducted. Through this, a substantial increase in research activity was noted, and the broad, multidisciplinary nature of the research is also illustrated. However, there remains room for further collaboration across disciplines as well as research exploring how different social groups and institutions contribute to social cohesion. Full article
Show Figures

Figure 1

Review
Locus Coeruleus in Non-Mammalian Vertebrates
by , and
Brain Sci. 2022, 12(2), 134; https://doi.org/10.3390/brainsci12020134 (registering DOI) - 20 Jan 2022
Abstract
The locus coeruleus (LC) is a vertebrate-specific nucleus and the primary source of norepinephrine (NE) in the brain. This nucleus has conserved properties across species: highly homogeneous cell types, a small number of cells but extensive axonal projections, and potent influence on brain [...] Read more.
The locus coeruleus (LC) is a vertebrate-specific nucleus and the primary source of norepinephrine (NE) in the brain. This nucleus has conserved properties across species: highly homogeneous cell types, a small number of cells but extensive axonal projections, and potent influence on brain states. Comparative studies on LC benefit greatly from its homogeneity in cell types and modularity in projection patterns, and thoroughly understanding the LC-NE system could shed new light on the organization principles of other more complex modulatory systems. Although studies on LC are mainly focused on mammals, many of the fundamental properties and functions of LC are readily observable in other vertebrate models and could inform mammalian studies. Here, we summarize anatomical and functional studies of LC in non-mammalian vertebrate classes, fish, amphibians, reptiles, and birds, on topics including axonal projections, gene expressions, homeostatic control, and modulation of sensorimotor transformation. Thus, this review complements mammalian studies on the role of LC in the brain. Full article
Show Figures

Figure 1

Editorial
Understanding School Success of Migrant Students: An International Perspective
by and
Educ. Sci. 2022, 12(2), 69; https://doi.org/10.3390/educsci12020069 (registering DOI) - 20 Jan 2022
Abstract
Despite existing educational inequalities, the literature provides hardly any empirically validated insights into the school success pathways of migrants [...] Full article
Article
Six-Minute Walk Distance Is a Useful Outcome Measure to Detect Motor Decline in Treated Late-Onset Pompe Disease Patients
by , , , and
Cells 2022, 11(3), 334; https://doi.org/10.3390/cells11030334 (registering DOI) - 20 Jan 2022
Abstract
Late-onset Pompe disease (LOPD) is a rare, progressive disorder characterized by limb–girdle muscle weakness and/or respiratory insufficiency, caused by acid alpha-glucosidase (GAA) gene mutations and treated with enzyme replacement therapy. We studied isometric muscle strength in eight muscle groups bilaterally using [...] Read more.
Late-onset Pompe disease (LOPD) is a rare, progressive disorder characterized by limb–girdle muscle weakness and/or respiratory insufficiency, caused by acid alpha-glucosidase (GAA) gene mutations and treated with enzyme replacement therapy. We studied isometric muscle strength in eight muscle groups bilaterally using a Biodex® dynamometer, as well as the Medical Research Council sum score (MRC-SS), hand grip strength, 6 min walk distance (6MWD), 10 m walk test (10MWT) and timed up-and-go test (TUG) in 12 adult, ambulatory, treated LOPD patients and 12 age-/gender-matched healthy controls, every 6 months for 2 years. The mean isometric muscle strength showed a significant decline in right and left knee extensors at 12 months in controls (p < 0.014; p < 0.016), at 18 months in patients (p < 0.010; p < 0.007) and controls (only right side, p < 0.030) and at 24 months in both groups (p < 0.035). The mean 6MWD in patients significantly decreased after 24 months, from 451.9 m to 368.1 m (p < 0.003), whereas in controls, the mean 6MWD significantly increased after 6 months (p < 0.045) and 18 months (p < 0.020) (at 24 months p = 0.054). In patients and controls, the MRC-SS, hand grip test, 10MWT and TUG did not show significant changes (p > 0.05). We conclude that the 6MWD is a useful outcome measure to detect motor decline in treated LOPD patients. Full article
Show Figures

Figure 1

Article
Potential Association between the Use of Anabolic Steroids and COVID-19 Infection
by , , , , and
Healthcare 2022, 10(2), 196; https://doi.org/10.3390/healthcare10020196 (registering DOI) - 20 Jan 2022
Abstract
Anabolic androgenic steroids (AASs) are synthetic analogs of testosterone that can affect the immune system. Bodybuilders and sportsmen are at risk of abusing AASs. The aim of this study was to investigate the association between AASs use and coronavirus disease (COVID-19). This cross-sectional [...] Read more.
Anabolic androgenic steroids (AASs) are synthetic analogs of testosterone that can affect the immune system. Bodybuilders and sportsmen are at risk of abusing AASs. The aim of this study was to investigate the association between AASs use and coronavirus disease (COVID-19). This cross-sectional study included adults aged 18 years and above. Between 16 April and 23 June 2021, gym-attending participants completed an online survey. Multivariable analysis was performed using multiple logistic regression to identify factors associated with COVID-19 diagnosis and severity. Current use of AASs was reported in 7.5% of the 520 study participants. Approximately 20% of the study participants reported that they had contracted COVID-19, approximately half of whom reported moderate to severe disease. Contracting COVID-19 was reported more frequently by current users than by non-current users (35.90% vs. 18.92%, p = 0.011). Multivariable analysis revealed that contracting COVID-19 was nearly five times more likely among current users of AASs than among non-current users (OR = 4.89, 95% CI: 1.69–14.13). Current use of AASs was also associated with greater odds of moderate to severe COVID-19 disease (OR = 3.71, 95% CI: 1.04–13.21). Our findings suggest that the use of AASs could be an underlying risk factor for COVID-19 severity. Full article
Show Figures

Figure 1

Review
Cybersecurity Practices for Social Media Users: A Systematic Literature Review
by , and
J. Cybersecur. Priv. 2022, 2(1), 1-18; https://doi.org/10.3390/jcp2010001 (registering DOI) - 20 Jan 2022
Abstract
In this paper, we present secondary research on recommended cybersecurity practices for social media users from the user’s point of view. Through following a structured methodological approach of the systematic literature review presented, aspects related to cyber threats, cyber awareness, and cyber behavior [...] Read more.
In this paper, we present secondary research on recommended cybersecurity practices for social media users from the user’s point of view. Through following a structured methodological approach of the systematic literature review presented, aspects related to cyber threats, cyber awareness, and cyber behavior in internet and social media use are considered in the study. The study presented finds that there are many cyber threats existing within the social media platform, such as loss of productivity, cyber bullying, cyber stalking, identity theft, social information overload, inconsistent personal branding, personal reputation damage, data breach, malicious software, service interruptions, hacks, and unauthorized access to social media accounts. Among other findings, the study also reveals that demographic factors, for example age, gender, and education level, may not necessarily be influential factors affecting the cyber awareness of the internet users. Full article
(This article belongs to the Special Issue Cyber Situational Awareness Techniques and Human Factors)
Show Figures

Figure 1

Article
Italian Tomato Cultivars under Drought Stress Show Different Content of Bioactives in Pulp and Peel of Fruits
by , , , and
Foods 2022, 11(3), 270; https://doi.org/10.3390/foods11030270 (registering DOI) - 20 Jan 2022
Abstract
Background: This study aims to evaluate the performance, in terms of accumulation of antioxidant compounds in fruits, of nine local and three commercial Italian tomato cultivars subjected to drought stress. The same local cultivars had been previously studied at morpho-physiological level. Methods: The [...] Read more.
Background: This study aims to evaluate the performance, in terms of accumulation of antioxidant compounds in fruits, of nine local and three commercial Italian tomato cultivars subjected to drought stress. The same local cultivars had been previously studied at morpho-physiological level. Methods: The present manuscript analyzes drought stress as a tool to increase the amount of secondary metabolites that can enhance fruit quality. Nutraceutical characterization of the fruits was performed by analyzing the content of antioxidants, phenols, flavonoids, lycopene, ascorbic acid (vitamin C), rutin, caffeic acid, and naringenin. At the same time, plant sensitivity to stress during the reproductive phase was monitored in terms of flower abscission, fruit drop, and seed germination. Results: Perina turns out to be the tomato cultivar with the best nutraceutical properties in the absence of stress while the Quarantino cultivar is so for flavonoid content (control plants) and lycopene and vitamin C content (stressed plants). Perina and Quarantino are the cultivars with the best response to drought and Perina has the highest concentrations of bioactives. Quarantino responds most effectively to stress in the reproductive phase. Conclusions: data confirm that drought stress increases bioactive production in some local cultivars of tomato, which produce higher quality fruits. Full article
(This article belongs to the Section Plant Foods)
Show Figures

Graphical abstract

Review
Noninvasive Follicular Thyroid Neoplasm with Papillary-like Nuclear Features (NIFTP): Tumour Entity with a Short History. A Review on Challenges in Our Microscopes, Molecular and Ultrasonographic Profile
by , , , and
Diagnostics 2022, 12(2), 250; https://doi.org/10.3390/diagnostics12020250 (registering DOI) - 20 Jan 2022
Abstract
Since Noninvasive Follicular Thyroid Neoplasm with Papillary-like Nuclear Features (NIFTP) was introduced as a new thyroid tumour entity, many studies, and meta-analyses on diagnosing NIFTP have been published. NIFTP-revised histopathological criteria emerged in 2018. NIFTP is defined as a histological entity and its [...] Read more.
Since Noninvasive Follicular Thyroid Neoplasm with Papillary-like Nuclear Features (NIFTP) was introduced as a new thyroid tumour entity, many studies, and meta-analyses on diagnosing NIFTP have been published. NIFTP-revised histopathological criteria emerged in 2018. NIFTP is defined as a histological entity and its diagnosis requires a careful histological examination. Its molecular profile is similar to follicular-like tumours. Ultrasound features are unable to differentiate NIFTP. NIFTP is not a cytological diagnosis, but it influences the risk of malignancy in several categories of The Bethesda System for Reporting Thyroid Cytopathology terminology. Full article
(This article belongs to the Special Issue Cyto-Histopathological Correlations in Pathology Diagnostics)
Show Figures

Figure 1

Article
Can We Identify Patients in Danger of Complications in Retrograde Intrarenal Surgery?—A Retrospective Risk Factors Analysis
by , , , , and
Int. J. Environ. Res. Public Health 2022, 19(3), 1114; https://doi.org/10.3390/ijerph19031114 (registering DOI) - 20 Jan 2022
Abstract
Retrograde intrarenal surgery (RIRS) is an innovative and effective method of kidney stones treatment, as it had great influence on the development of endoscopy in urology. The increasing prevalence of urolithiasis together with the rapid development of endourology leads to a rise in [...] Read more.
Retrograde intrarenal surgery (RIRS) is an innovative and effective method of kidney stones treatment, as it had great influence on the development of endoscopy in urology. The increasing prevalence of urolithiasis together with the rapid development of endourology leads to a rise in the number of procedures related to the disease. Flexible ureteroscopy is constantly being improved, especially regarding the effectiveness and safety of the procedure. The purpose of this study is to evaluate intraoperative and early post-operative complications of RIRS in the treatment of kidney stones. A retrospective analysis of medical records was performed. A series was comprised of 207 consecutive operations performed from 2017 to 2020. Complications occurred in 19.3% (n = 40) of patients. Occurrence according to the Clavien-Dindo scale was: 11.1% for grade I, 5.8% for grade II and 2.4% for grade IV. Infectious complications included SIRS (5.3%, n = 11) and sepsis (2.4%, n = 5). Statistical analysis revealed a correlation between acute post-operative infections and positive midstream urine culture, history of chronic or recurrent urinary tract infections, and increased body mass index (BMI). Furthermore, a significant correlation was observed between pain requiring the use of opioids with BMI over 25. Consequently, history of urinary tract infections, positive pre-operative urine culture, and increased BMI are considered risk factors and require appropriate management. Full article
Show Figures

Figure 1

Article
Complete Genome Sequence and Benzophenone-3 Mineralisation Potential of Rhodococcus sp. USK10, A Bacterium Isolated from Riverbank Sediment
by , , , , , , and
Appl. Microbiol. 2022, 2(1), 104-112; https://doi.org/10.3390/applmicrobiol2010006 (registering DOI) - 20 Jan 2022
Abstract
Benzophenone-3 (BP3) is an organic UV filter whose presence in the aquatic environment has been linked to detrimental developmental impacts in aquatic organisms such as coral and fish. The genus Rhodococcus has been extensively studied and is known for possessing large genomes housing [...] Read more.
Benzophenone-3 (BP3) is an organic UV filter whose presence in the aquatic environment has been linked to detrimental developmental impacts in aquatic organisms such as coral and fish. The genus Rhodococcus has been extensively studied and is known for possessing large genomes housing genes for biodegradation of a wide range of compounds, including aromatic carbons. Here, we present the genome sequence of Rhodococcus sp. USK10, which was isolated from Chinese riverbank sediment and is capable of utilising BP3 as the sole carbon source, resulting in full BP3 mineralisation. The genome consisted of 9,870,030 bp in 3 replicons, a G+C content of 67.2%, and 9722 coding DNA sequences (CDSs). Annotation of the genome revealed that 179 of these CDSs are involved in the metabolism of aromatic carbons. The complete genome of Rhodococcus sp. USK10 is the first complete, annotated genome sequence of a Benzophenone-3-degrading bacterium. Through radiolabelling, it is also the first bacterium proven to mineralise Benzophenone-3. Due to the widespread environmental prevalence of Benzophenone-3, coupled with its adverse impact on aquatic organisms, this characterisation provides an integral first step in better understanding the environmentally relevant degradation pathway of the commonly used UV filter. Given USK10′s ability to completely mineralise Benzophenone-3, it could prove to be a suitable candidate for bioremediation application. Full article
Show Figures

Figure 1

Article
Shaking Table Test of a Transfer-Purge Chamber in Nuclear Island Structure
by , , , and
Materials 2022, 15(3), 766; https://doi.org/10.3390/ma15030766 (registering DOI) - 20 Jan 2022
Abstract
The transfer-purge chamber is an operation room for nuclear fuel transport and purging in a nuclear power plant, which has a demand for structural reliability and radiation protection. The transfer-purge chamber has features such as large curvature, heavy concrete, long overhang, and irregular [...] Read more.
The transfer-purge chamber is an operation room for nuclear fuel transport and purging in a nuclear power plant, which has a demand for structural reliability and radiation protection. The transfer-purge chamber has features such as large curvature, heavy concrete, long overhang, and irregular cross-sections, and it is constructed of double steel plates reinforced concrete (SC) structure. This study performed shaking table tests for a 1:4.5 scale model of the transfer-purge chamber. Three sets of ground motions were input in the scale model in the horizontal and vertical directions to study its structural reliability and seismic performance. Acceleration response and strain response of the structure were analyzed to evaluate the dynamic characteristics of the transfer-purge chamber under the ground motion. The results show that the transfer-purge chamber has great stiffness and short periods. The periods slightly increase with the rise of intensity of seismic ground motions. Under the excitation of ground motions, the dynamic response of the transfer-purge chamber is slight. No obvious deformation or damage occurred on the transfer-purge chamber, and cracking in concrete or buckling on steel plate did not appear. The transfer-purge chamber has excellent seismic performance, and it is sufficiently safe and reliable from a structural perspective. Full article
(This article belongs to the Section Construction and Building Materials)
Show Figures

Figure 1

Article
Optimized EMS and a Comparative Study of Hybrid Hydrogen Fuel Cell/Battery Vehicles
by and
Energies 2022, 15(3), 738; https://doi.org/10.3390/en15030738 (registering DOI) - 20 Jan 2022
Abstract
This paper presents a new Fuel Cell Fuel Consumption Minimization Strategy (FCFCMS) for Hybrid Electric Vehicles (HEVs) powered by a fuel cell and an energy storage system, in order to minimize as much as possible the consumption of hydrogen while maintaining the State [...] Read more.
This paper presents a new Fuel Cell Fuel Consumption Minimization Strategy (FCFCMS) for Hybrid Electric Vehicles (HEVs) powered by a fuel cell and an energy storage system, in order to minimize as much as possible the consumption of hydrogen while maintaining the State Of Charge (SOC) of the battery. Compared to existing Energy Management Strategies (EMSs) (such as the well-known State Machine Strategy (SMC), Fuzzy Logic Control (FLC), Frequency Decoupling and FLC (FDFLC), and the Equivalent Consumption Minimization Strategy (ECMS)), the proposed strategy increases the overall vehicle energy efficiency and, therefore, minimizes the total hydrogen consumption while respecting the constraints of each energy and power element. A model of a hybrid vehicle has been built using the TruckMaker/MATLAB software. Using the Urban Dynamometer Driving Schedule (UDDS), which includes several stops and accelerations, the performance of the proposed strategy has been compared with these different approaches (SMC, FLC, FDFLC, and ECMS) through several simulations. Full article
(This article belongs to the Topic Multi-Energy Systems)
Show Figures

Figure 1

Article
Association between Thyroid Cancer and Breast Cancer: Two Longitudinal Follow-Up Studies Using a National Health Screening Cohort
by , , , and
J. Pers. Med. 2022, 12(2), 133; https://doi.org/10.3390/jpm12020133 (registering DOI) - 20 Jan 2022
Abstract
Background: The purpose of this study was to evaluate the association between thyroid cancer and breast cancer. Methods: Data from the Korean National Health Insurance Service-Health Screening Cohort were collected from 2002 to 2013. In study I, 3949 thyroid cancer participants [...] Read more.
Background: The purpose of this study was to evaluate the association between thyroid cancer and breast cancer. Methods: Data from the Korean National Health Insurance Service-Health Screening Cohort were collected from 2002 to 2013. In study I, 3949 thyroid cancer participants were 1:4 matched with 15,796 control I participants, and hazard ratios (HRs) with 95% confidence intervals (CIs) for breast cancer were evaluated using a stratified Cox proportional hazard model. In study II, 3308 breast cancer participants were 1:4 matched with 13,232 control II participants, and HRs with 95% CIs for thyroid cancer were assessed in the same way as in study I. In the subgroup analyses, associations were analyzed according to radioactive iodine (RAI) treatment and age (<60 years old and ≥60 years old). Results: The adjusted HR for breast cancer in the thyroid cancer group was 1.64 (95% CI = 1.13–2.39, p = 0.010). The adjusted HR for thyroid cancer in the breast cancer group was 1.91 (95% CI = 1.47–2.49, p < 0.001). In the subgroup analyses, the groups that were older and not treated with RAI treatment showed consistent results in study I, and the younger and older groups showed consistent results in study II. Conclusions: Based on this cohort study, breast and thyroid cancer have a reciprocal positive association. Full article
Show Figures

Figure 1

Article
Beyond the Gender of the Livestock Holder: Learnings from Intersectional Analyses of PPR Vaccine Value Chains in Nepal, Senegal, and Uganda
by , , , and
Animals 2022, 12(3), 241; https://doi.org/10.3390/ani12030241 (registering DOI) - 20 Jan 2022
Abstract
The peste des petits ruminants (PPR) is a deadly viral disease of small ruminants, which are an important source of livelihood for hundreds of millions of poor smallholders throughout Africa, the Middle East, and Asia. PPR vaccination efforts often focus on overcoming financial, [...] Read more.
The peste des petits ruminants (PPR) is a deadly viral disease of small ruminants, which are an important source of livelihood for hundreds of millions of poor smallholders throughout Africa, the Middle East, and Asia. PPR vaccination efforts often focus on overcoming financial, technological, and logistical constraints that limit their reach and effectiveness. This study posits that it is equally important to pay attention to the role of gender and other intersecting social and cultural factors in determining individual and groups’ ability to access PPR vaccines or successfully operate within the vaccine distribution system. We compare three study contexts in Nepal, Senegal, and Uganda. Qualitative data were collected through a total of 99 focus group discussions with men and women livestock keepers and animal health workers, 83 individual interviews, and 74 key informant interviews. Our findings show that there are not only important gender differences, but also interrelated structures of inequalities, which create additional sites of exclusion. However, these intersections are not generalizable across contexts—except for the intersection of gender and geographic remoteness, which is salient across vaccine distribution systems in the three countries—and social markers such as caste, ethnicity, and livelihood are associated with vulnerability only in specific settings. In order to address the distinct needs of livestock keepers in given settings, we argue that an intersectional analysis combined with context-dependent vaccination approaches are critical to achieving higher vaccination rates and, ultimately, PPR disease eradication by 2030. Full article
Show Figures

Figure 1

Article
Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction
by , , , , , and
Int. J. Mol. Sci. 2022, 23(3), 1092; https://doi.org/10.3390/ijms23031092 (registering DOI) - 20 Jan 2022
Abstract
The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2′-deoxyadenosine (ABr), 8-oxo-2′-deoxyadenosine (Aoxo) or β-L-2′-deoxyadenosine (AL) [...] Read more.
The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2′-deoxyadenosine (ABr), 8-oxo-2′-deoxyadenosine (Aoxo) or β-L-2′-deoxyadenosine (AL) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date. Full article
(This article belongs to the Section Molecular Biology)
Show Figures

Figure 1

Article
Patterning Large-Scale Nanostructured Microarrays on Coverslip for Sensitive Plasmonic Detection of Aqueous Gliadin Traces
by , , , and
Chemosensors 2022, 10(2), 38; https://doi.org/10.3390/chemosensors10020038 (registering DOI) - 20 Jan 2022
Abstract
User-friendly devices for detecting low gliadin content in commercial foods are of extreme importance for people with gluten diseases. With this concern, the present work proposes a rapid and sensitive optical nanostructured microarrays platform for the detection of gliadin using specific anti-gliadin IgG [...] Read more.
User-friendly devices for detecting low gliadin content in commercial foods are of extreme importance for people with gluten diseases. With this concern, the present work proposes a rapid and sensitive optical nanostructured microarrays platform for the detection of gliadin using specific anti-gliadin IgG antibodies immobilized on annealed gold nanostructures (AuNPs) obtained after the high annealing process (550 °C) of gold thin films evaporated on commercial glass coverslips. Localized Surface Plasmon Resonance (LSPR) immunosensing of gliadin in the range of 0.1 ppm to 1000 ppm is successfully achieved. In addition, the biofunctionalization protocol was used for gluten screening in five food complex products. Full article
(This article belongs to the Special Issue Nanophotonic Biosensors: Challenges and Development)
Show Figures

Figure 1

Communication
The Prevalence of Prejudice-Denoting Terms in Spanish Newspapers
by
Soc. Sci. 2022, 11(2), 33; https://doi.org/10.3390/socsci11020033 (registering DOI) - 20 Jan 2022
Abstract
Previous scholarly literature has documented a pronounced increase in the prevalence of prejudice-denoting terms in American news media content. Some have referred to this shift in journalistic discourse and related public opinion trends signaling increasing perceptions of prejudice severity in U.S. society as [...] Read more.
Previous scholarly literature has documented a pronounced increase in the prevalence of prejudice-denoting terms in American news media content. Some have referred to this shift in journalistic discourse and related public opinion trends signaling increasing perceptions of prejudice severity in U.S. society as The Great Awokening. This work analyzes whether the increasing prevalence of prejudice themes in American news media outlets has been replicated in the news media ecosystem of a Spanish-speaking country. Thus, we computationally analyzed the prevalence of words denoting prejudice in five million news and opinion articles written between 1976 and 2019 and published in three of the most widely read newspapers in Spain: El País, El Mundo and ABC. We report that within the studied time period, the frequency of terms that denote specific prejudice types related to gender, ethnicity, sexuality and religious orientation has also substantially increased across the analyzed Spanish news media outlets. There are, however, some notable distinctions in the long-term usage dynamics of prejudice-denoting terms between the leading Spanish newspaper of record, El País, and its U.S. counterpart, The New York Times. Full article
(This article belongs to the Section Contemporary Politics and Society)
Show Figures

Figure 1

Article
Mycelia-Assisted Isolation of Non-Host Bacteria Able to Co-Transport Phages
by , , , , and
Viruses 2022, 14(2), 195; https://doi.org/10.3390/v14020195 (registering DOI) - 20 Jan 2022
Abstract
Recent studies have demonstrated that phages can be co-transported with motile non-host bacteria, thereby enabling their invasion of biofilms and control of biofilm composition. Here, we developed a novel approach to isolate non-host bacteria able to co-transport phages from soil. It is based [...] Read more.
Recent studies have demonstrated that phages can be co-transported with motile non-host bacteria, thereby enabling their invasion of biofilms and control of biofilm composition. Here, we developed a novel approach to isolate non-host bacteria able to co-transport phages from soil. It is based on the capability of phage-carrying non-host bacteria to move along mycelia out of soil and form colonies in plaques of their co-transported phages. The approach was tested using two model phages of differing surface hydrophobicity, i.e., hydrophobic Escherichia virus T4 (T4) and hydrophilic Pseudoalteromonas phage HS2 (HS2). The phages were mixed into soil and allowed to be transported by soil bacteria along the mycelia of Pythium ultimum. Five phage-carrying bacterial species were isolated (Viridibacillus sp., Enterobacter sp., Serratia sp., Bacillus sp., Janthinobacterium sp.). These bacteria exhibited phage adsorption efficiencies of ≈90–95% for hydrophobic T4 and 30–95% for hydrophilic HS2. The phage adsorption efficiency of Viridibacillus sp. was ≈95% for both phages and twofold higher than T4-or HS2-adsorption to their respective hosts, qualifying Viridibacillus sp. as a potential super carrier for phages. Our approach offers an effective and target-specific way to identify and isolate phage-carrying bacteria in natural and man-made environments. Full article
(This article belongs to the Special Issue Phage Ecology 2021)
Show Figures

Figure 1

Open Access Journals

Browse by Indexing Browse by Subject Selected Journals
Back to TopTop