Table of Contents

Chitooligosaccharides (COS) have a variety of biological activities due to their positively charged amino groups. Studies have shown that COS have antidiabetic effects, but their molecular mechanism has not been fully elucidated. The present study confirmed that COS can reduce hyperglycemia and hyperlipidemia, prevent obesity, and enhance histological changes in the livers of mice with type 2 diabetes mellitus (T2DM). Additionally, treatment with COS can modulate the composition of the gut microbiota in the colon by altering the abundance of Firmicutes, Bacteroidetes, and Proteobacteria. Furthermore, in T2DM mice, treatment with COS can upregulate the cholesterol-degrading enzymes cholesterol 7-alpha-hydroxylase (CYP7A1) and incretin glucagon-like peptide 1 (GLP-1) while specifically inhibiting the transcription and expression of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR), the key enzyme in cholesterol synthesis. Furthermore, using an oleic acid-induced hepatocyte steatosis model, we found that HMGCR can be directly transactivated by SET and MYND domain containing 3 (SMYD3), a transcriptional regulator, via 5′-CCCTCC-3′ element in the promoter. Overexpression of SMYD3 can suppress the inhibitory effect of COS on HMGCR, and COS might regulate HMGCR by inhibiting SMYD3, thereby exerting hypolipidemic functions. To the best of our knowledge, this study is the first to illustrate that COS mediate glucose and lipid metabolism disorders by regulating gut microbiota and SMYD3-mediated signaling pathways. Full article

Five new perylenequinone derivatives, altertoxins VIII–XII (1–5), as well as one known compound cladosporol I (6), were isolated from the fermentation broth of the marine-derived fungus Cladosporium sp. KFD33 from a blood cockle from Haikou Bay, China. Their structures were determined based on spectroscopic methods and ECD spectra analysis along with quantum ECD calculations. Compounds 1–6 exhibited quorum sensing inhibitory activities against Chromobacterium violaceum CV026 with MIC values of 30, 30, 20, 30, 20 and 30 μg/well, respectively. Full article

Oxygenated derivatives of fatty acids, collectively called oxylipins, are a highly diverse family of lipoxygenase (LOX) products well described in planktonic diatoms. Here we report the first investigation of these molecules in four benthic diatoms, Cylindrotheca closterium, Nanofrustulum shiloi, Cocconeis scutellum, and Diploneis sp. isolated from the leaves of the seagrass Posidonia oceanica from the Gulf of Naples. Analysis by hyphenated MS techniques revealed that C. closterium, N. shiloi, and C. scutellum produce several polyunsaturated aldehydes (PUAs) and linear oxygenated fatty acids (LOFAs) related to the products of LOX pathways in planktonic species. Diploneis sp. also produced other unidentified fatty acid derivatives that are not related to LOX metabolism. The levels and composition of oxylipins in the benthic species match their negative effects on the reproductive success in the sea urchin Paracentrotus lividus. In agreement with this correlation, the most toxic species N. shiloi revealed the same LOX pathways of Skeletonema marinoi and Thalassiosira rotula, two bloom-forming planktonic diatoms that affect copepod reproduction. Overall, our data highlight for the first time a major role of oxylipins, namely LOFAs, as info-chemicals for benthic diatoms, and open new perspectives in the study of the structuring of benthic communities. Full article

Chitin and its derivative chitosan are popular constituents in wound-treatment technologies due to their nanoscale fibrous morphology and attractive biomedical properties that accelerate healing and reduce scarring. These abundant natural polymers found in arthropod exoskeletons and fungal cell walls affect almost every phase of the healing process, acting as hemostatic and antibacterial agents that also support cell proliferation and attachment. However, key differences exist in the structure, properties, processing, and associated polymers of fungal and arthropod chitin, affecting their respective application to wound treatment. High purity crustacean-derived chitin and chitosan have been widely investigated for wound-treatment applications, with research incorporating chemically modified chitosan derivatives and advanced nanocomposite dressings utilizing biocompatible additives, such as natural polysaccharides, mineral clays, and metal nanoparticles used to achieve excellent mechanical and biomedical properties. Conversely, fungi-derived chitin is covalently decorated with -glucan and has received less research interest despite its mass production potential, simple extraction process, variations in chitin and associated polymer content, and the established healing properties of fungal exopolysaccharides. This review investigates the proven biomedical properties of both fungal- and crustacean-derived chitin and chitosan, their healing mechanisms, and their potential to advance modern wound-treatment methods through further research and practical application. Full article

The undesired attachment of micro and macroorganisms on water-immersed surfaces, known as marine biofouling, results in severe prevention and maintenance costs (billions €/year) for aquaculture, shipping and other industries that rely on coastal and off-shore infrastructures. To date, there are no sustainable, cost-effective and environmentally safe solutions to address this challenging phenomenon. Therefore, we investigated the antifouling activity of napyradiomycin derivatives that were isolated from actinomycetes from ocean sediments collected off the Madeira Archipelago. Our results revealed that napyradiomycins inhibited ≥80% of the marine biofilm-forming bacteria assayed, as well as the settlement of Mytilus galloprovincialis larvae (EC₅₀ < 5 µg/ml and LC₅₀/EC₅₀ >15), without viability impairment. In silico prediction of toxicity end points are of the same order of magnitude of standard approved drugs and biocides. Altogether, napyradiomycins disclosed bioactivity against marine micro and macrofouling organisms, and non-toxic effects towards the studied species, displaying potential to be used in the development of antifouling products. Full article

The Asian coastal communities have used the brown seaweeds Fucus vesiculosus and Ascophyllum nodosum since ancient times. Recently, some in vitro and in vivo studies have demonstrated their abilities in reducing risk factors for metabolic syndrome. Here, we analyzed the protective effect of a phytocomplex extracted from these seaweeds on the deposition of fat in the liver after the administration of a high-fat diet (HFD) to rats for five weeks. The administration of F. vesiculosus and A. nodosum led to significant reductions in microvescicular steatosis and plasma biochemical and lipid parameters, such as alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), total and conjugated bilirubin, and triglycerides. Furthermore, the postprandial glycemic peak was delayed and significantly reduced (p < 0.01) by the algal extract administration. In conclusion, this extract is effective in reducing microvescicular steatosis and improving glycemic control, thereby lowering the risk of nonalcoholic fatty liver disease, obesity, and diabetes, diseases related to the consumption of fat and sugar-enriched diets. Full article

Nicotinic acetylcholine receptors (nAChRs) are membrane receptors and play a major role in tumorigenesis and cancer progression. Here, we have investigated the differential expression of nAChR subunits in human breast cancer cell lines and breast epithelial cell lines at mRNA and protein levels and the effects of the αO-conotoxin GeXIVA, antagonist of α9α10 nAChR, on human breast cancer cells. Reverse transcription polymerase chain reaction (PCR) demonstrated that all nAChR subunits, except α6, were expressed in the 20 tested cell lines. Real time quantitative PCR (QRT-PCR) suggested that the mRNA of α5, α7, α9 and β4 nAChR subunits were overexpressed in all the breast cancer cell lines compared with the normal epithelial cell line HS578BST. α9 nAChR was highly expressed in almost all the breast cancer cell lines in comparison to normal cells. The different expression is prominent (p < 0.001) as determined by flow cytometry and Western blotting, except for MDA-MB-453 and HCC1395 cell lines. αO-conotoxin GeXIVA that targeted α9α10 nAChR were able to significantly inhibit breast cancer cell proliferation in vitro and merits further investigation as potential agents for targeted therapy. Full article

Very recently, the immunotherapies against cancer, autoimmune diseases, and infection have been feasible and promising. Thus, we have examined the possibility whether or not human gamma delta T cells can be applied for the novel immunotherapies. We previously established the cells stably maintaining NFkB-driven human secreted embryonic alkaline phosphatase (SEAP) expression. The cells can be used to determine the transcription activity of NFkB with high-standard dynamic range and accuracy. Because IL-18 is a kind of cytokines that enhances cytotoxicity and activity of human gamma delta T cells through NFkB activation, we have focused on the activity and signaling of IL-18. In this study, we modified the previous reporter cell that can determine the transcription activity of NFkB to express two subunits consisted of human IL-18 receptor. The modified cells secreted SEAP in response to treatment with human recombinant IL-18 in a concentration-dependent manner. We also observed the concentration-dependently enhancement of NFkB activity in the cells treated with mouse recombinant IL-18 although the affinity was lower compared to human recombinant IL-18. We also previously established the cells stably expressing and secreting human recombinant IL-18 and then validated whether or not the conditioned medium from the cells activate NFkB transcription activity using this assay. Our university has kept collecting many extracts from over 18,000 marine bacteria in our local sea around Omura bay—fungi, plants for Chinese herbal medicine, and so on—and also have kept gathering synthetic compounds from many Japanese chemists as drug libraries. Finally, in order to identify drugs mimicking IL-18 biological activity or possessing inhibitory effects on IL-18-induced NFkB, we demonstrated drug screening using number of extracts derived from marine bacteria and synthetic compounds. Full article

Mexico is one of the three areas of the world with the greatest terrestrial and cultural biological diversity. The diversity of Mexican medicinal flora has been studied for a long time and several bioactive compounds have been isolated. The investigation of marine resources, and particularly the potential of Mexican marine resources, has not been intensively investigated, even though the Yucatan Peninsula occupies 17.4% of the total of the Mexican coast, with great biological diversity in its coasts and the ocean. There are very few studies on the chemistry of natural products from marine organisms that were collected along the coasts of the Yucatan Peninsula and most of them are limited to the evaluation of the biological activity of their organic extracts. The investigations carried out on marine species from the Yucatan Peninsula resulted in the identification of a wide structural variety of natural products that include polyketides, terpenoids, nitrogen compounds, and biopolymers with cytotoxic, antibacterial, antifouling, and neurotoxic activities. This review describes the literature of bioprospecting and the exploration of the natural product diversity of marine organisms from the coasts of the Yucatan Peninsula up to mid-2019. Full article

Four novel bioactive tetrahydroanthra-γ-pyrone compounds, shellmycin A–D (1–4), were isolated from the marine Streptomyces sp. shell-016 derived from a shell sediment sample collected from Binzhou Shell Dike Island and Wetland National Nature Reserve, China. The structures of these four compounds were established by interpretation of 1D and 2D NMR and HR-MS data, in which the absolute configuration of 1 was confirmed by single crystal X-ray diffraction, and compound 3 and 4 are a pair of stereoisomers. Compound 1–4 exhibited cytotoxic activity against five cancer cell lines with the IC₅₀ value from 0.69 μM to 26.3 μM. Based on their structure–activity relationship, the putative biosynthetic pathways of these four compounds were also discussed. Full article

Treatment of acute myeloid leukemia (AML) remains inefficient due to drug resistance and relapse, particularly in patients with FMS-like tyrosine kinase 3 (FLT3)-internal tandem duplication (ITD). Marine-derived natural products have recently been used for drug development against AML. We show in this study that petromurin C, which was isolated from the culture extract of the marine-derived fungus Aspergillus candidus KUFA0062, isolated from the marine sponge Epipolasis sp., induces early autophagy followed by apoptotic cell death via activation of the intrinsic cell death pathway concomitant with mitochondrial stress and downregulation of Mcl-1 in FLT3-ITD mutated MV4-11 cells. Moreover, petromurin C synergized with the clinically-used FLT3 inhibitor gilteritinib at sub-toxic concentrations. Altogether, our results provide preliminary indications that petromurin C provides anti-leukemic effects alone or in combination with gilteritinib. Full article

The rapid emergence of multidrug-resistant pathogens makes an urgent need for discovering novel antimicrobial agents as alternatives to conventional antibiotics. Towards this end, we designed and synthesized a synthetic peptide of 23 amino acids (AAs) (¹GWLIRGAIHAGKAIHGLIHRRRH²³) from a defense protein 3 cDNA sequence of Octopus minor. The sequence of the peptide, which was named Octominin, had characteristic features of known antimicrobial peptides (AMPs) such as a positive charge (+5), high hydrophobic residue ratio (43%), and 1.86 kcal/mol of Boman index. Octominin was predicted to have an alpha-helix secondary structure. The synthesized Octominin was 2625.2 Da with 92.5% purity. The peptide showed a minimum inhibitory concentration (MIC) and minimum fungicidal concentration (MFC) of 50 and 200 μg/mL, respectively, against Candida albicans. Field emission scanning electron microscopy observation confirmed that Octominin caused ultrastructural cell wall deformities in C. albicans. In addition, propidium iodide penetrated the Octominin-treated C. albicans cells, further demonstrating loss of cell membrane integrity that caused cell death at both MIC and MFC. Octominin treatment increased the production of intracellular reactive oxygen species and decreased cell viability in a concentration dependent manner. Cytotoxicity assays revealed no significant influence of Octominin on the viability of human embryonic kidney 293T cell line, with over 95% live cells in the Octominin-treated group observed up to 100 µg/mL. Moreover, we confirmed the antifungal action of Octominin in vivo using a zebrafish experimental infection model. Overall, our results demonstrate the Octominin is a lead compound for further studies, which exerts its effects by inducing cell wall damage, causing loss of cell membrane integrity, and elevating oxidative stress. Full article

Polyelectrolyte nanocomposites rarely reach a stable state and aggregation often occurs. Here, we report the synthesis of nanocomposites for the oral delivery of insulin composed of alginate, dextran sulfate, poly-(ethylene glycol) 4000, poloxamer 188, chitosan, and bovine serum albumin. The nanocomposites were obtained by Ca²⁺-induced gelation of alginate followed by an electrostatic-interaction process among the polyelectrolytes. Chitosan seemed to be essential for the final size of the nanocomposites and there was an optimal content that led to the synthesis of nanocomposites of 400–600 nm hydrodynamic size. The enhanced stability of the synthesized nanocomposites was assessed with LUMiSizer after synthesis. Nanocomposite stability over time and under variations of ionic strength and pH were assessed with dynamic light scattering. The rounded shapes of nanocomposites were confirmed by scanning electron microscopy. After loading with insulin, analysis by HPLC revealed complete drug release under physiologically simulated conditions. Full article

Nitrogen heterocycles have drawn considerable attention due to of their significant biological activities. The marine fungi residing in extreme environments are among the richest sources of these basic nitrogen-containing secondary metabolites. As one of the most well-known universal groups of filamentous fungi, marine-derived Aspergillus species produce a large number of structurally unique heterocyclic alkaloids. This review attempts to provide a comprehensive summary of the structural diversity and biological activities of heterocyclic alkaloids that are produced by marine-derived Aspergillus species. Herein, a total of 130 such structures that were reported from the beginning of 2014 through the end of 2018 are included, and 75 references are cited in this review, which will benefit future drug development and innovation. Full article

Transient brain ischemia triggers selective neuronal death/loss, especially in vulnerable regions of the brain including the hippocampus. Laminarin, a polysaccharide originating from brown seaweed, has various pharmaceutical properties including an antioxidant function. To the best of our knowledge, few studies have been conducted on the protective effects of laminarin against ischemic injury induced by ischemic insults. In this study, we histopathologically investigated the neuroprotective effects of laminarin in the Cornu Ammonis 1 (CA1) field of the hippocampus, which is very vulnerable to ischemia-reperfusion injury, following transient forebrain ischemia (TFI) for five minutes in gerbils. The neuroprotective effect was examined by cresyl violet staining, Fluoro-Jade B histofluorescence staining and immunohistochemistry for neuronal-specific nuclear protein. Additionally, to study gliosis (glial changes), we performed immunohistochemistry for glial fibrillary acidic protein to examine astrocytes, and ionized calcium-binding adaptor molecule 1 to examine microglia. Furthermore, we examined alterations in pro-inflammatory M1 microglia by using double immunofluorescence. Pretreatment with 10 mg/kg laminarin failed to protect neurons in the hippocampal CA1 field and did not attenuate reactive gliosis in the field following TFI. In contrast, pretreatment with 50 or 100 mg/kg laminarin protected neurons, attenuated reactive gliosis and reduced pro-inflammatory M1 microglia in the CA1 field following TFI. Based on these results, we firmly propose that 50 mg/kg laminarin can be strategically applied to develop a preventative against injuries following cerebral ischemic insults. Full article

This study reports the isolation of two novel cysteine-rich antibacterial peptides, turgencin A and turgencin B, along with their oxidized derivatives, from the Arctic marine colonial ascidian Synoicum turgens. The peptides are post-translationally modified, containing six cysteines with an unusual disulfide connectivity of Cys¹-Cys⁶, Cys²-Cys⁵, and Cys³-Cys⁴ and an amidated C-terminus. Furthermore, the peptides contain methionine residues resulting in the isolation of peptides with different degrees of oxidation. The most potent peptide, turgencin A_Mox1 with one oxidized methionine, displayed antimicrobial activity against both Gram-negative and Gram-positive bacteria with a minimum inhibitory concentration (MIC) as low as 0.4 µM against selected bacterial strains. In addition, the peptide inhibited the growth of the melanoma cancer cell line A2058 (IC₅₀ = 1.4 µM) and the human fibroblast cell line MRC-5 (IC₅₀ = 4.8 µM). The results from this study show that natural peptides isolated from marine tunicates have the potential to be promising drug leads. Full article

Gigartina pistillata is a red seaweed common in Figueira da Foz, Portugal. Here, the antitumour potential of G. pistillata carrageenan, with a known variable of the life cycle, the female gametophyte (FG) and tetrasporophyte (T) was evaluated against colorectal cancer stem cell (CSC) -enriched tumourspheres. FTIR-ATR analysis of G. pistillata carrageenan extracts indicated differences between life cycle phases, being FG a κ/ι hybrid carrageenan and T a ʎ/ξ hybrid. Both carrageenan extracts presented IC₅₀ values inferior to 1 μg/mL in HT29-derived CSC-enriched tumourspheres, as well as reduced tumoursphere area. The two extracts were also effective at reducing cellular viability in SW620- and SW480-derived tumourspheres. These results indicate that carrageenans extracted from two G. pistillata life cycle phases have antitumour potential against colorectal cancer stem-like cells, specially the T carrageenan. Full article

ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies. Full article

Many marine microorganisms synthesize exopolysaccharides (EPSs), and some of these EPSs have been reported to have potential in different fields. However, the pharmaceutical potentials of marine EPSs are rarely reported. The EPS secreted by the Artic marine bacterium Polaribacter sp. SM1127 has good antioxidant activity, outstanding moisture-retention ability, and considerable protective property on human dermal fibroblasts (HDFs) at low temperature. Here, the effects of SM1127 EPS on skin wound healing and frostbite injury prevention were studied. Scratch wound assay showed that SM1127 EPS could stimulate the migration of HDFs. In the full-thickness cutaneous wound experiment of Sprague–Dawley (SD) rats, SM1127 EPS increased the wound healing rate and stimulated tissue repair detected by macroscopic observation and histologic examination, showing the ability of SM1127 EPS to promote skin wound healing. In the skin frostbite experiment of SD rats, pretreatment of rat skin with SM1127 EPS increased the rate of frostbite wound healing and promoted the repair of the injured skin significantly, indicating the good effect of SM1127 EPS on frostbite injury prevention. These results suggest the promising potential of SM1127 EPS in the pharmaceutical area to promote skin wound healing and prevent frostbite injury. Full article

Marine algae represent a prolific source of filamentous fungi for bioprospecting. In continuation of our search for new anticancer leads from fungi derived from the brown alga Fucus vesiculosus, an endophytic Pyrenochaetopsis sp. FVE-001 was selected for an in-depth chemical analysis. The crude fungal extract inhibited several cancer cell lines in vitro, and the highest anticancer activity was tracked to its CHCl₃–soluble portion. A bioactivity-based molecular networking approach was applied to C18-SPE fractions of the CHCl₃ subextract to predict the bioactivity scores of metabolites in the fractions and to aid targeted purification of anticancer metabolites. This approach led to a rapid isolation of three new decalinoylspirotetramic acid derivatives, pyrenosetins A–C (1–3) and the known decalin tetramic acid phomasetin (4). The structures of the compounds were elucidated by extensive NMR, HR-ESIMS, FT-IR spectroscopy, [α]_D and Mosher’s ester method. Compounds 1 and 2 showed high anticancer activity against malignant melanoma cell line A-375 (IC₅₀ values 2.8 and 6.3 μM, respectively), in line with the bioactivity predictions. This is the first study focusing on secondary metabolites of a marine-derived Pyrenochaetopsis sp. and the second investigation performed on the member of the genus Pyrenochaetopsis. Full article

Respiratory exposure to marine phycotoxins is of increasing concern. Inhalation of sea spray aerosols (SSAs), during harmful Karenia brevis and Ostreopsis ovata blooms induces respiratory distress among others. The biogenics hypothesis, however, suggests that regular airborne exposure to natural products is health promoting via a downregulation of the mechanistic target of rapamycin (mTOR) pathway. Until now, little scientific evidence supported this hypothesis. The current explorative in vitro study investigated both health-affecting and potential health-promoting mechanisms of airborne phycotoxin exposure, by analyzing cell viability effects via cytotoxicity assays and effects on the mTOR pathway via western blotting. To that end, A549 and BEAS-2B lung cells were exposed to increasing concentrations (ng·L⁻¹–mg·L⁻¹) of (1) pure phycotoxins and (2) an extract of experimental aerosolized homoyessotoxin (hYTX). The lowest cell viability effect concentrations were found for the examined yessotoxins (YTXs). Contradictory to the other phycotoxins, these YTXs only induced a partial cell viability decrease at the highest test concentrations. Growth inhibition and apoptosis, both linked to mTOR pathway activity, may explain these effects, as both YTXs were shown to downregulate this pathway. This proof-of-principle study supports the biogenics hypothesis, as specific aerosolizable marine products (e.g., YTXs) can downregulate the mTOR pathway. Full article

Marine organisms are sources of several natural compounds with potential clinical use. However, only a few marine-based pharmaceuticals have been approved for use due to limited knowledge on their biological activities. Here, we identified the functional role of fucoidan extracted from Fucus vesiculosus on ovarian cancer. Fucoidan increased the death of ES-2 and OV-90 cells, through a reduction in proliferation, cell cycle arrest, releases of cytochrome c, reactive oxygen species (ROS) generation, and endoplasmic reticulum (ER) stress. Additionally, fucoidan increased the concentration of cytosolic and mitochondrial calcium in both cells. The decrease of cell proliferation was controlled by the inactivation of PI3K and MAPK signaling cascades in ES-2 and OV-90 cells. In a toxicity assay with normal zebrafish larvae, fucoidan did not induce toxicity, cardiotoxicity, development, kinesis, and apoptosis at different concentrations. However, it disrupted tumor formation and vascular development in a zebrafish xenograft model and angiogenesis transgenic (Tg, fli1-eGFP) model, respectively. Collectively, the results indicate that fucoidan may be a novel pharmaceutical for the management of human ovarian cancer. Full article

Women are still at high risk of contracting the human immunodeficiency virus (HIV) virus due to the lack of protection methods under their control, especially in sub-Saharan countries. Polyelectrolyte multilayer smart vaginal films based on chitosan derivatives (chitosan lactate, chitosan tartate, and chitosan citrate) and Eudragit^® S100 were developed for the pH-sensitive release of Tenofovir. Films were characterized through texture analysis and scanning electron microscopy (SEM). Swelling and drug release studies were carried out in simulated vaginal fluid and a mixture of simulated vaginal and seminal fluids. Ex vivo mucoadhesion was evaluated in bovine vaginal mucosa. SEM micrographs revealed the formation of multilayer films. According to texture analysis, chitosan citrate was the most flexible compared to chitosan tartrate and lactate. The swelling studies showed a moderate water uptake (<300% in all cases), leading to the sustained release of Tenofovir in simulated vaginal fluid (up to 120 h), which was accelerated in the simulated fluid mixture (4–6 h). The films had high mucoadhesion in bovine vaginal mucosa. The multilayer films formed by a mixture of chitosan citrate and Eudragit^® S100 proved to be the most promising, with zero toxicity, excellent mechanical properties, moderate swelling (<100%), high mucoadhesion capacity, and Tenofovir release of 120 h and 4 h in vaginal fluid and the simulated fluid mixture respectively. Full article

Mycosporine-like amino acids (MAAs), maximally absorbed in the wavelength region of 310–360 nm, are widely distributed in algae, phytoplankton and microorganisms, as a class of possible multi-functional compounds. In this work, based on the Web of Science, Springer, Google Scholar, and China national knowledge infrastructure (CNKI), we have summarized and analyzed the studies related to MAAs in marine macroalgae over the past 30 years (1990–2019), mainly focused on MAAs distribution, contents, and types. It was confirmed that 572 species marine macroalgae contained MAAs, namely in 45 species of Chlorophytes, 41 species of Phaeophytes, and 486 species of Rhodophytes, and they respectively belonged to 28 orders. On this basis, we established an open online database to quickly retrieve MAAs in 501 species of marine macroalgae. Furthermore, research concerning MAAs in marine macroalgae were analyzed using CiteSpace. It could easily be seen that the preparation and purification of MAAs in marine macroalgae have not been intensively studied during the past 10 years, and therefore it is necessary to strengthen the research in the preparation and purification of MAA purified standards from marine macroalgae in the future. We agreed that this process is not only interesting, but important due to the potential use of MAAs as food and cosmetics, as well as within the medicine industry. Full article

Osmoregulation in phytoplankton is attributed to several highly polar low-molecular-weight metabolites. A widely accepted model considers dimethylsulfoniopropionate (DMSP) as the most important and abundant osmotically active metabolite. Using an optimized procedure for the extraction and detection of highly polar metabolites, we expand the group of phytoplankton osmolytes by identifying ectoine in several microalgae. Ectoine is known as a bacterial compatible solute, but, to the best of our knowledge, was never considered as a phytoplankton-derived product. Given the ability of microalgae to take up zwitterions, such as DMSP, we tested the hypothesis that the algal ectoine is derived from associated bacteria. We therefore analyzed methanol extracts of xenic and axenic cultures of two different species of microalgae and could detect elevated concentrations of ectoine in those that harbor associated bacteria. However, also microalgae without an associated microbiome contain ectoine in smaller amounts, pointing towards a dual origin of this metabolite in the algae from their own biosynthesis as well as from uptake. We also tested the role of ectoine in the osmoadaptation of microalgae. In the model diatoms Thalassiosira weissflogii and Phaeodactylum tricornutum, elevated amounts of ectoine were found when cultivated in seawater with salinities of 50 PSU compared to the standard culture conditions of 35 PSU. Therefore, we add ectoine to the family of osmoadaptive metabolites in phytoplankton and prove a new, potentially synergistic metabolic interplay of bacteria and algae. Full article

One of the most widely distributed soft coral species, found especially in shallow waters of the Indo-Pacific region, Red Sea, Mediterranean Sea, and also the Arctic, is genus Sacrophyton. The total number of species belonging to it was estimated to be 40. Sarcophyton species are considered to be a reservoir of bioactive natural metabolites. Secondary metabolites isolated from members belonging to this genus show great chemical diversity. They are rich in terpenoids, in particular, cembranoids diterpenes, tetratepenoids, triterpenoids, and ceramide, in addition to steroids, sesquiterpenes, and fatty acids. They showed a broad range of potent biological activities, such as antitumor, neuroprotective, antimicrobial, antiviral, antidiabetic, antifouling, and anti-inflammatory activity. This review presents all isolated secondary metabolites from species of genera Sacrophyton, as well as their reported biological activities covering a period of about two decades (1998–2019). It deals with 481 metabolites, including 323 diterpenes, 39 biscembranoids, 11 sesquiterpenes, 53 polyoxygenated sterols, and 55 miscellaneous and their pharmacological activities. Full article