Next Issue
Volume 18, February
Previous Issue
Volume 17, December
 
 

Mar. Drugs, Volume 18, Issue 1 (January 2020) – 69 articles

Cover Story (view full-size image): Natural antimicrobial peptides are considered as potential lead molecules for developing new antibiotic drugs-addressing the emerging problem of antibiotic resistance. In this study, two novel peptides, named turgencin A and turgencin B, were isolated and characterized from the Arctic colonial ascidian Synoicum turgens. The peptides are post-translationally modified, containing methionines with different degrees of oxidation, amidated C-terminus, and six cysteines with an unusual disulfide connectivity of Cys1-Cys6, Cys2-Cys5, and Cys3-Cys4. Turgencin A, with one oxidized methionine, display antimicrobial activity against both Gram-negative and Gram-positive bacteria with minimum inhibitory concentrations as low as 0.4 µM against selected bacterial strains. View this paper.
  • Issues are regarded as officially published after their release is announced to the table of contents alert mailing list.
  • You may sign up for e-mail alerts to receive table of contents of newly released issues.
  • PDF is the official format for papers published in both, html and pdf forms. To view the papers in pdf format, click on the "PDF Full-text" link, and use the free Adobe Reader to open them.
Order results
Result details
Section
Select all
Export citation of selected articles as:
15 pages, 4680 KB  
Article
Chitooligosaccharides Modulate Glucose-Lipid Metabolism by Suppressing SMYD3 Pathways and Regulating Gut Microflora
by Qiutong Wang, Yajie Jiang, Xuegang Luo, Chang Wang, Nan Wang, Hongpeng He, Tongcun Zhang and Liehuan Chen
Mar. Drugs 2020, 18(1), 69; https://doi.org/10.3390/md18010069 - 20 Jan 2020
Cited by 38 | Viewed by 5739
Abstract
Chitooligosaccharides (COS) have a variety of biological activities due to their positively charged amino groups. Studies have shown that COS have antidiabetic effects, but their molecular mechanism has not been fully elucidated. The present study confirmed that COS can reduce hyperglycemia and hyperlipidemia, [...] Read more.
Chitooligosaccharides (COS) have a variety of biological activities due to their positively charged amino groups. Studies have shown that COS have antidiabetic effects, but their molecular mechanism has not been fully elucidated. The present study confirmed that COS can reduce hyperglycemia and hyperlipidemia, prevent obesity, and enhance histological changes in the livers of mice with type 2 diabetes mellitus (T2DM). Additionally, treatment with COS can modulate the composition of the gut microbiota in the colon by altering the abundance of Firmicutes, Bacteroidetes, and Proteobacteria. Furthermore, in T2DM mice, treatment with COS can upregulate the cholesterol-degrading enzymes cholesterol 7-alpha-hydroxylase (CYP7A1) and incretin glucagon-like peptide 1 (GLP-1) while specifically inhibiting the transcription and expression of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR), the key enzyme in cholesterol synthesis. Furthermore, using an oleic acid-induced hepatocyte steatosis model, we found that HMGCR can be directly transactivated by SET and MYND domain containing 3 (SMYD3), a transcriptional regulator, via 5′-CCCTCC-3′ element in the promoter. Overexpression of SMYD3 can suppress the inhibitory effect of COS on HMGCR, and COS might regulate HMGCR by inhibiting SMYD3, thereby exerting hypolipidemic functions. To the best of our knowledge, this study is the first to illustrate that COS mediate glucose and lipid metabolism disorders by regulating gut microbiota and SMYD3-mediated signaling pathways. Full article
(This article belongs to the Special Issue Marine Immunomodulators)
Show Figures

Figure 1

16 pages, 246 KB  
Editorial
Acknowledgement to Reviewers of Marine Drugs in 2019
by Marine Drugs Editorial Office
Mar. Drugs 2020, 18(1), 68; https://doi.org/10.3390/md18010068 - 20 Jan 2020
Viewed by 4401
Abstract
The editorial team greatly appreciates the reviewers who have dedicated their considerable time and expertise to the journal’s rigorous editorial process over the past 12 months, regardless of whether the papers are finally published or not [...] Full article
7 pages, 858 KB  
Article
Altertoxins with Quorum Sensing Inhibitory Activities from The Marine-Derived Fungus Cladosporium sp. KFD33
by Fei Zhang, Liman Zhou, Fandong Kong, Qingyun Ma, Qingyi Xie, Jiuhui Li, Haofu Dai, Lei Guo and Youxing Zhao
Mar. Drugs 2020, 18(1), 67; https://doi.org/10.3390/md18010067 - 19 Jan 2020
Cited by 32 | Viewed by 4403
Abstract
Five new perylenequinone derivatives, altertoxins VIII–XII (15), as well as one known compound cladosporol I (6), were isolated from the fermentation broth of the marine-derived fungus Cladosporium sp. KFD33 from a blood cockle from Haikou Bay, China. [...] Read more.
Five new perylenequinone derivatives, altertoxins VIII–XII (15), as well as one known compound cladosporol I (6), were isolated from the fermentation broth of the marine-derived fungus Cladosporium sp. KFD33 from a blood cockle from Haikou Bay, China. Their structures were determined based on spectroscopic methods and ECD spectra analysis along with quantum ECD calculations. Compounds 16 exhibited quorum sensing inhibitory activities against Chromobacterium violaceum CV026 with MIC values of 30, 30, 20, 30, 20 and 30 μg/well, respectively. Full article
Show Figures

Figure 1

14 pages, 1613 KB  
Article
Lipoxygenase Pathways in Diatoms: Occurrence and Correlation with Grazer Toxicity in Four Benthic Species
by Nadia Ruocco, Genoveffa Nuzzo, Giuliana d’Ippolito, Emiliano Manzo, Angela Sardo, Adrianna Ianora, Giovanna Romano, Antonella Iuliano, Valerio Zupo, Maria Costantini and Angelo Fontana
Mar. Drugs 2020, 18(1), 66; https://doi.org/10.3390/md18010066 - 19 Jan 2020
Cited by 16 | Viewed by 4400
Abstract
Oxygenated derivatives of fatty acids, collectively called oxylipins, are a highly diverse family of lipoxygenase (LOX) products well described in planktonic diatoms. Here we report the first investigation of these molecules in four benthic diatoms, Cylindrotheca closterium, Nanofrustulum shiloi, Cocconeis scutellum [...] Read more.
Oxygenated derivatives of fatty acids, collectively called oxylipins, are a highly diverse family of lipoxygenase (LOX) products well described in planktonic diatoms. Here we report the first investigation of these molecules in four benthic diatoms, Cylindrotheca closterium, Nanofrustulum shiloi, Cocconeis scutellum, and Diploneis sp. isolated from the leaves of the seagrass Posidonia oceanica from the Gulf of Naples. Analysis by hyphenated MS techniques revealed that C. closterium, N. shiloi, and C. scutellum produce several polyunsaturated aldehydes (PUAs) and linear oxygenated fatty acids (LOFAs) related to the products of LOX pathways in planktonic species. Diploneis sp. also produced other unidentified fatty acid derivatives that are not related to LOX metabolism. The levels and composition of oxylipins in the benthic species match their negative effects on the reproductive success in the sea urchin Paracentrotus lividus. In agreement with this correlation, the most toxic species N. shiloi revealed the same LOX pathways of Skeletonema marinoi and Thalassiosira rotula, two bloom-forming planktonic diatoms that affect copepod reproduction. Overall, our data highlight for the first time a major role of oxylipins, namely LOFAs, as info-chemicals for benthic diatoms, and open new perspectives in the study of the structuring of benthic communities. Full article
Show Figures

Figure 1

5 pages, 198 KB  
Editorial
Characterization of Bioactive Components in Edible Algae
by Leonel Pereira
Mar. Drugs 2020, 18(1), 65; https://doi.org/10.3390/md18010065 - 19 Jan 2020
Cited by 25 | Viewed by 4784
Abstract
From the origin of our planet, about 4 [...] Full article
(This article belongs to the Special Issue Characterization of Bioactive Components in Edible Algae)
23 pages, 3243 KB  
Review
Crab vs. Mushroom: A Review of Crustacean and Fungal Chitin in Wound Treatment
by Mitchell Jones, Marina Kujundzic, Sabu John and Alexander Bismarck
Mar. Drugs 2020, 18(1), 64; https://doi.org/10.3390/md18010064 - 18 Jan 2020
Cited by 175 | Viewed by 16608
Abstract
Chitin and its derivative chitosan are popular constituents in wound-treatment technologies due to their nanoscale fibrous morphology and attractive biomedical properties that accelerate healing and reduce scarring. These abundant natural polymers found in arthropod exoskeletons and fungal cell walls affect almost every phase [...] Read more.
Chitin and its derivative chitosan are popular constituents in wound-treatment technologies due to their nanoscale fibrous morphology and attractive biomedical properties that accelerate healing and reduce scarring. These abundant natural polymers found in arthropod exoskeletons and fungal cell walls affect almost every phase of the healing process, acting as hemostatic and antibacterial agents that also support cell proliferation and attachment. However, key differences exist in the structure, properties, processing, and associated polymers of fungal and arthropod chitin, affecting their respective application to wound treatment. High purity crustacean-derived chitin and chitosan have been widely investigated for wound-treatment applications, with research incorporating chemically modified chitosan derivatives and advanced nanocomposite dressings utilizing biocompatible additives, such as natural polysaccharides, mineral clays, and metal nanoparticles used to achieve excellent mechanical and biomedical properties. Conversely, fungi-derived chitin is covalently decorated with -glucan and has received less research interest despite its mass production potential, simple extraction process, variations in chitin and associated polymer content, and the established healing properties of fungal exopolysaccharides. This review investigates the proven biomedical properties of both fungal- and crustacean-derived chitin and chitosan, their healing mechanisms, and their potential to advance modern wound-treatment methods through further research and practical application. Full article
(This article belongs to the Special Issue Marine Chitin 2019)
Show Figures

Figure 1

19 pages, 1737 KB  
Article
Antifouling Napyradiomycins from Marine-Derived Actinomycetes Streptomyces aculeolatus
by Florbela Pereira, Joana R. Almeida, Marisa Paulino, Inês R. Grilo, Helena Macedo, Isabel Cunha, Rita G. Sobral, Vitor Vasconcelos and Susana P. Gaudêncio
Mar. Drugs 2020, 18(1), 63; https://doi.org/10.3390/md18010063 - 18 Jan 2020
Cited by 58 | Viewed by 7653
Abstract
The undesired attachment of micro and macroorganisms on water-immersed surfaces, known as marine biofouling, results in severe prevention and maintenance costs (billions €/year) for aquaculture, shipping and other industries that rely on coastal and off-shore infrastructures. To date, there are no sustainable, cost-effective [...] Read more.
The undesired attachment of micro and macroorganisms on water-immersed surfaces, known as marine biofouling, results in severe prevention and maintenance costs (billions €/year) for aquaculture, shipping and other industries that rely on coastal and off-shore infrastructures. To date, there are no sustainable, cost-effective and environmentally safe solutions to address this challenging phenomenon. Therefore, we investigated the antifouling activity of napyradiomycin derivatives that were isolated from actinomycetes from ocean sediments collected off the Madeira Archipelago. Our results revealed that napyradiomycins inhibited ≥80% of the marine biofilm-forming bacteria assayed, as well as the settlement of Mytilus galloprovincialis larvae (EC50 < 5 µg/ml and LC50/EC50 >15), without viability impairment. In silico prediction of toxicity end points are of the same order of magnitude of standard approved drugs and biocides. Altogether, napyradiomycins disclosed bioactivity against marine micro and macrofouling organisms, and non-toxic effects towards the studied species, displaying potential to be used in the development of antifouling products. Full article
(This article belongs to the Special Issue Selected Papers from XVI MaNaPro and XI ECMNP)
Show Figures

Figure 1

8 pages, 1939 KB  
Article
Fucus vesiculosus and Ascophyllum nodosum Ameliorate Liver Function by Reducing Diet-Induced Steatosis in Rats
by Daniela Gabbia, Miriam Saponaro, Samantha Sarcognato, Maria Guido, Nicola Ferri, Maria Carrara and Sara De Martin
Mar. Drugs 2020, 18(1), 62; https://doi.org/10.3390/md18010062 - 17 Jan 2020
Cited by 21 | Viewed by 6099
Abstract
The Asian coastal communities have used the brown seaweeds Fucus vesiculosus and Ascophyllum nodosum since ancient times. Recently, some in vitro and in vivo studies have demonstrated their abilities in reducing risk factors for metabolic syndrome. Here, we analyzed the protective effect of [...] Read more.
The Asian coastal communities have used the brown seaweeds Fucus vesiculosus and Ascophyllum nodosum since ancient times. Recently, some in vitro and in vivo studies have demonstrated their abilities in reducing risk factors for metabolic syndrome. Here, we analyzed the protective effect of a phytocomplex extracted from these seaweeds on the deposition of fat in the liver after the administration of a high-fat diet (HFD) to rats for five weeks. The administration of F. vesiculosus and A. nodosum led to significant reductions in microvescicular steatosis and plasma biochemical and lipid parameters, such as alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), total and conjugated bilirubin, and triglycerides. Furthermore, the postprandial glycemic peak was delayed and significantly reduced (p < 0.01) by the algal extract administration. In conclusion, this extract is effective in reducing microvescicular steatosis and improving glycemic control, thereby lowering the risk of nonalcoholic fatty liver disease, obesity, and diabetes, diseases related to the consumption of fat and sugar-enriched diets. Full article
(This article belongs to the Collection Marine Drugs in the Management of Metabolic Diseases)
Show Figures

Figure 1

20 pages, 3686 KB  
Article
Differential Expression of Nicotine Acetylcholine Receptors Associates with Human Breast Cancer and Mediates Antitumor Activity of αO-Conotoxin GeXIVA
by Zhihua Sun, Manqi Zhangsun, Shuai Dong, Yiqiao Liu, Jiang Qian, Dongting Zhangsun and Sulan Luo
Mar. Drugs 2020, 18(1), 61; https://doi.org/10.3390/md18010061 - 17 Jan 2020
Cited by 29 | Viewed by 5995
Abstract
Nicotinic acetylcholine receptors (nAChRs) are membrane receptors and play a major role in tumorigenesis and cancer progression. Here, we have investigated the differential expression of nAChR subunits in human breast cancer cell lines and breast epithelial cell lines at mRNA and protein levels [...] Read more.
Nicotinic acetylcholine receptors (nAChRs) are membrane receptors and play a major role in tumorigenesis and cancer progression. Here, we have investigated the differential expression of nAChR subunits in human breast cancer cell lines and breast epithelial cell lines at mRNA and protein levels and the effects of the αO-conotoxin GeXIVA, antagonist of α9α10 nAChR, on human breast cancer cells. Reverse transcription polymerase chain reaction (PCR) demonstrated that all nAChR subunits, except α6, were expressed in the 20 tested cell lines. Real time quantitative PCR (QRT-PCR) suggested that the mRNA of α5, α7, α9 and β4 nAChR subunits were overexpressed in all the breast cancer cell lines compared with the normal epithelial cell line HS578BST. α9 nAChR was highly expressed in almost all the breast cancer cell lines in comparison to normal cells. The different expression is prominent (p < 0.001) as determined by flow cytometry and Western blotting, except for MDA-MB-453 and HCC1395 cell lines. αO-conotoxin GeXIVA that targeted α9α10 nAChR were able to significantly inhibit breast cancer cell proliferation in vitro and merits further investigation as potential agents for targeted therapy. Full article
Show Figures

Figure 1

12 pages, 1541 KB  
Article
Novel Reporter System Monitoring IL-18 Specific Signaling Can Be Applied to High-Throughput Screening
by Riho Kurata, Kenji Shimizu, Xiaofeng Cui, Masamitsu Harada, Takayuki Isagawa, Hiroaki Semba, Jun Ishihara, Koji Yamada, Jun Nagai, Yasuhiro Yoshida, Norihiko Takeda, Koji Maemura and Tomo Yonezawa
Mar. Drugs 2020, 18(1), 60; https://doi.org/10.3390/md18010060 - 17 Jan 2020
Cited by 1 | Viewed by 5403
Abstract
Very recently, the immunotherapies against cancer, autoimmune diseases, and infection have been feasible and promising. Thus, we have examined the possibility whether or not human gamma delta T cells can be applied for the novel immunotherapies. We previously established the cells stably maintaining [...] Read more.
Very recently, the immunotherapies against cancer, autoimmune diseases, and infection have been feasible and promising. Thus, we have examined the possibility whether or not human gamma delta T cells can be applied for the novel immunotherapies. We previously established the cells stably maintaining NFkB-driven human secreted embryonic alkaline phosphatase (SEAP) expression. The cells can be used to determine the transcription activity of NFkB with high-standard dynamic range and accuracy. Because IL-18 is a kind of cytokines that enhances cytotoxicity and activity of human gamma delta T cells through NFkB activation, we have focused on the activity and signaling of IL-18. In this study, we modified the previous reporter cell that can determine the transcription activity of NFkB to express two subunits consisted of human IL-18 receptor. The modified cells secreted SEAP in response to treatment with human recombinant IL-18 in a concentration-dependent manner. We also observed the concentration-dependently enhancement of NFkB activity in the cells treated with mouse recombinant IL-18 although the affinity was lower compared to human recombinant IL-18. We also previously established the cells stably expressing and secreting human recombinant IL-18 and then validated whether or not the conditioned medium from the cells activate NFkB transcription activity using this assay. Our university has kept collecting many extracts from over 18,000 marine bacteria in our local sea around Omura bay—fungi, plants for Chinese herbal medicine, and so on—and also have kept gathering synthetic compounds from many Japanese chemists as drug libraries. Finally, in order to identify drugs mimicking IL-18 biological activity or possessing inhibitory effects on IL-18-induced NFkB, we demonstrated drug screening using number of extracts derived from marine bacteria and synthetic compounds. Full article
(This article belongs to the Special Issue High-Throughput Screening of Marine Resources)
Show Figures

Graphical abstract

24 pages, 3798 KB  
Review
Marine Natural Products from the Yucatan Peninsula
by Dawrin Pech-Puch, Mar Pérez-Povedano, Oscar A. Lenis-Rojas, Jaime Rodríguez and Carlos Jiménez
Mar. Drugs 2020, 18(1), 59; https://doi.org/10.3390/md18010059 - 16 Jan 2020
Cited by 11 | Viewed by 7454
Abstract
Mexico is one of the three areas of the world with the greatest terrestrial and cultural biological diversity. The diversity of Mexican medicinal flora has been studied for a long time and several bioactive compounds have been isolated. The investigation of marine resources, [...] Read more.
Mexico is one of the three areas of the world with the greatest terrestrial and cultural biological diversity. The diversity of Mexican medicinal flora has been studied for a long time and several bioactive compounds have been isolated. The investigation of marine resources, and particularly the potential of Mexican marine resources, has not been intensively investigated, even though the Yucatan Peninsula occupies 17.4% of the total of the Mexican coast, with great biological diversity in its coasts and the ocean. There are very few studies on the chemistry of natural products from marine organisms that were collected along the coasts of the Yucatan Peninsula and most of them are limited to the evaluation of the biological activity of their organic extracts. The investigations carried out on marine species from the Yucatan Peninsula resulted in the identification of a wide structural variety of natural products that include polyketides, terpenoids, nitrogen compounds, and biopolymers with cytotoxic, antibacterial, antifouling, and neurotoxic activities. This review describes the literature of bioprospecting and the exploration of the natural product diversity of marine organisms from the coasts of the Yucatan Peninsula up to mid-2019. Full article
Show Figures

Graphical abstract

13 pages, 1918 KB  
Article
Shellmycin A–D, Novel Bioactive Tetrahydroanthra-γ-Pyrone Antibiotics from Marine Streptomyces sp. Shell-016
by Yong Han, Yan Wang, Yuehan Yang and Haotong Chen
Mar. Drugs 2020, 18(1), 58; https://doi.org/10.3390/md18010058 - 16 Jan 2020
Cited by 18 | Viewed by 5822
Abstract
Four novel bioactive tetrahydroanthra-γ-pyrone compounds, shellmycin A–D (14), were isolated from the marine Streptomyces sp. shell-016 derived from a shell sediment sample collected from Binzhou Shell Dike Island and Wetland National Nature Reserve, China. The structures of these four [...] Read more.
Four novel bioactive tetrahydroanthra-γ-pyrone compounds, shellmycin A–D (14), were isolated from the marine Streptomyces sp. shell-016 derived from a shell sediment sample collected from Binzhou Shell Dike Island and Wetland National Nature Reserve, China. The structures of these four compounds were established by interpretation of 1D and 2D NMR and HR-MS data, in which the absolute configuration of 1 was confirmed by single crystal X-ray diffraction, and compound 3 and 4 are a pair of stereoisomers. Compound 14 exhibited cytotoxic activity against five cancer cell lines with the IC50 value from 0.69 μM to 26.3 μM. Based on their structure–activity relationship, the putative biosynthetic pathways of these four compounds were also discussed. Full article
(This article belongs to the Special Issue Products from Marine Actinomycetes)
Show Figures

Graphical abstract

23 pages, 4088 KB  
Article
Petromurin C Induces Protective Autophagy and Apoptosis in FLT3-ITD-Positive AML: Synergy with Gilteritinib
by You Na Ha, Sungmi Song, Barbora Orlikova-Boyer, Claudia Cerella, Christo Christov, Anake Kijjoa and Marc Diederich
Mar. Drugs 2020, 18(1), 57; https://doi.org/10.3390/md18010057 - 16 Jan 2020
Cited by 12 | Viewed by 6090
Abstract
Treatment of acute myeloid leukemia (AML) remains inefficient due to drug resistance and relapse, particularly in patients with FMS-like tyrosine kinase 3 (FLT3)-internal tandem duplication (ITD). Marine-derived natural products have recently been used for drug development against AML. We show in this study [...] Read more.
Treatment of acute myeloid leukemia (AML) remains inefficient due to drug resistance and relapse, particularly in patients with FMS-like tyrosine kinase 3 (FLT3)-internal tandem duplication (ITD). Marine-derived natural products have recently been used for drug development against AML. We show in this study that petromurin C, which was isolated from the culture extract of the marine-derived fungus Aspergillus candidus KUFA0062, isolated from the marine sponge Epipolasis sp., induces early autophagy followed by apoptotic cell death via activation of the intrinsic cell death pathway concomitant with mitochondrial stress and downregulation of Mcl-1 in FLT3-ITD mutated MV4-11 cells. Moreover, petromurin C synergized with the clinically-used FLT3 inhibitor gilteritinib at sub-toxic concentrations. Altogether, our results provide preliminary indications that petromurin C provides anti-leukemic effects alone or in combination with gilteritinib. Full article
Show Figures

Graphical abstract

15 pages, 10165 KB  
Article
Octominin: A Novel Synthetic Anticandidal Peptide Derived from Defense Protein of Octopus minor
by Chamilani Nikapitiya, S.H.S. Dananjaya, H.P.S.U. Chandrarathna, Mahanama De Zoysa and Ilson Whang
Mar. Drugs 2020, 18(1), 56; https://doi.org/10.3390/md18010056 - 15 Jan 2020
Cited by 46 | Viewed by 6194
Abstract
The rapid emergence of multidrug-resistant pathogens makes an urgent need for discovering novel antimicrobial agents as alternatives to conventional antibiotics. Towards this end, we designed and synthesized a synthetic peptide of 23 amino acids (AAs) (1GWLIRGAIHAGKAIHGLIHRRRH23) from a defense [...] Read more.
The rapid emergence of multidrug-resistant pathogens makes an urgent need for discovering novel antimicrobial agents as alternatives to conventional antibiotics. Towards this end, we designed and synthesized a synthetic peptide of 23 amino acids (AAs) (1GWLIRGAIHAGKAIHGLIHRRRH23) from a defense protein 3 cDNA sequence of Octopus minor. The sequence of the peptide, which was named Octominin, had characteristic features of known antimicrobial peptides (AMPs) such as a positive charge (+5), high hydrophobic residue ratio (43%), and 1.86 kcal/mol of Boman index. Octominin was predicted to have an alpha-helix secondary structure. The synthesized Octominin was 2625.2 Da with 92.5% purity. The peptide showed a minimum inhibitory concentration (MIC) and minimum fungicidal concentration (MFC) of 50 and 200 μg/mL, respectively, against Candida albicans. Field emission scanning electron microscopy observation confirmed that Octominin caused ultrastructural cell wall deformities in C. albicans. In addition, propidium iodide penetrated the Octominin-treated C. albicans cells, further demonstrating loss of cell membrane integrity that caused cell death at both MIC and MFC. Octominin treatment increased the production of intracellular reactive oxygen species and decreased cell viability in a concentration dependent manner. Cytotoxicity assays revealed no significant influence of Octominin on the viability of human embryonic kidney 293T cell line, with over 95% live cells in the Octominin-treated group observed up to 100 µg/mL. Moreover, we confirmed the antifungal action of Octominin in vivo using a zebrafish experimental infection model. Overall, our results demonstrate the Octominin is a lead compound for further studies, which exerts its effects by inducing cell wall damage, causing loss of cell membrane integrity, and elevating oxidative stress. Full article
(This article belongs to the Special Issue Synthetic and Biosynthetic Approaches to Marine Natural Products)
Show Figures

Figure 1

18 pages, 2962 KB  
Article
Complex Polysaccharide-Based Nanocomposites for Oral Insulin Delivery
by Mar Collado-González, Maria Cristina Ferreri, Alessandra R. Freitas, Ana Cláudia Santos, Nuno R. Ferreira, Guzmán Carissimi, Joana A. D. Sequeira, F. Guillermo Díaz Baños, Gloria Villora, Francisco Veiga and Antonio Ribeiro
Mar. Drugs 2020, 18(1), 55; https://doi.org/10.3390/md18010055 - 15 Jan 2020
Cited by 29 | Viewed by 5585
Abstract
Polyelectrolyte nanocomposites rarely reach a stable state and aggregation often occurs. Here, we report the synthesis of nanocomposites for the oral delivery of insulin composed of alginate, dextran sulfate, poly-(ethylene glycol) 4000, poloxamer 188, chitosan, and bovine serum albumin. The nanocomposites were obtained [...] Read more.
Polyelectrolyte nanocomposites rarely reach a stable state and aggregation often occurs. Here, we report the synthesis of nanocomposites for the oral delivery of insulin composed of alginate, dextran sulfate, poly-(ethylene glycol) 4000, poloxamer 188, chitosan, and bovine serum albumin. The nanocomposites were obtained by Ca2+-induced gelation of alginate followed by an electrostatic-interaction process among the polyelectrolytes. Chitosan seemed to be essential for the final size of the nanocomposites and there was an optimal content that led to the synthesis of nanocomposites of 400–600 nm hydrodynamic size. The enhanced stability of the synthesized nanocomposites was assessed with LUMiSizer after synthesis. Nanocomposite stability over time and under variations of ionic strength and pH were assessed with dynamic light scattering. The rounded shapes of nanocomposites were confirmed by scanning electron microscopy. After loading with insulin, analysis by HPLC revealed complete drug release under physiologically simulated conditions. Full article
(This article belongs to the Special Issue Marine Biopolymers and Drug Delivery)
Show Figures

Figure 1

22 pages, 9065 KB  
Review
Recent Discovery of Heterocyclic Alkaloids from Marine-Derived Aspergillus Species
by Kuo Xu, Xiao-Long Yuan, Chen Li and and Xiao-Dong Li
Mar. Drugs 2020, 18(1), 54; https://doi.org/10.3390/md18010054 - 14 Jan 2020
Cited by 40 | Viewed by 8375
Abstract
Nitrogen heterocycles have drawn considerable attention due to of their significant biological activities. The marine fungi residing in extreme environments are among the richest sources of these basic nitrogen-containing secondary metabolites. As one of the most well-known universal groups of filamentous fungi, marine-derived [...] Read more.
Nitrogen heterocycles have drawn considerable attention due to of their significant biological activities. The marine fungi residing in extreme environments are among the richest sources of these basic nitrogen-containing secondary metabolites. As one of the most well-known universal groups of filamentous fungi, marine-derived Aspergillus species produce a large number of structurally unique heterocyclic alkaloids. This review attempts to provide a comprehensive summary of the structural diversity and biological activities of heterocyclic alkaloids that are produced by marine-derived Aspergillus species. Herein, a total of 130 such structures that were reported from the beginning of 2014 through the end of 2018 are included, and 75 references are cited in this review, which will benefit future drug development and innovation. Full article
(This article belongs to the Special Issue Advances in Marine Alkaloids)
Show Figures

Figure 1

3 pages, 342 KB  
Editorial
Marine Drugs Acting as Autophagy Modulators
by Sergey A. Dyshlovoy and Friedemann Honecker
Mar. Drugs 2020, 18(1), 53; https://doi.org/10.3390/md18010053 - 14 Jan 2020
Cited by 3 | Viewed by 3797
Abstract
Autophagy (Ancient Greek αὐτόφαγος [autóphagos]—“self-devouring”) is defined as a regulated mechanism of the degradation of unnecessary or dysfunctional cellular components [...] Full article
(This article belongs to the Special Issue Marine Drugs Acting as Autophagy Modulators)
16 pages, 7952 KB  
Article
Pre-Treatment with Laminarin Protects Hippocampal CA1 Pyramidal Neurons and Attenuates Reactive Gliosis Following Transient Forebrain Ischemia in Gerbils
by Tae-Kyeong Lee, Ji Hyeon Ahn, Cheol Woo Park, Bora Kim, Young Eun Park, Jae-Chul Lee, Joon Ha Park, Go Eun Yang, Myoung Cheol Shin, Jun Hwi Cho, Il-Jun Kang and Moo-Ho Won
Mar. Drugs 2020, 18(1), 52; https://doi.org/10.3390/md18010052 - 12 Jan 2020
Cited by 29 | Viewed by 4905
Abstract
Transient brain ischemia triggers selective neuronal death/loss, especially in vulnerable regions of the brain including the hippocampus. Laminarin, a polysaccharide originating from brown seaweed, has various pharmaceutical properties including an antioxidant function. To the best of our knowledge, few studies have been conducted [...] Read more.
Transient brain ischemia triggers selective neuronal death/loss, especially in vulnerable regions of the brain including the hippocampus. Laminarin, a polysaccharide originating from brown seaweed, has various pharmaceutical properties including an antioxidant function. To the best of our knowledge, few studies have been conducted on the protective effects of laminarin against ischemic injury induced by ischemic insults. In this study, we histopathologically investigated the neuroprotective effects of laminarin in the Cornu Ammonis 1 (CA1) field of the hippocampus, which is very vulnerable to ischemia-reperfusion injury, following transient forebrain ischemia (TFI) for five minutes in gerbils. The neuroprotective effect was examined by cresyl violet staining, Fluoro-Jade B histofluorescence staining and immunohistochemistry for neuronal-specific nuclear protein. Additionally, to study gliosis (glial changes), we performed immunohistochemistry for glial fibrillary acidic protein to examine astrocytes, and ionized calcium-binding adaptor molecule 1 to examine microglia. Furthermore, we examined alterations in pro-inflammatory M1 microglia by using double immunofluorescence. Pretreatment with 10 mg/kg laminarin failed to protect neurons in the hippocampal CA1 field and did not attenuate reactive gliosis in the field following TFI. In contrast, pretreatment with 50 or 100 mg/kg laminarin protected neurons, attenuated reactive gliosis and reduced pro-inflammatory M1 microglia in the CA1 field following TFI. Based on these results, we firmly propose that 50 mg/kg laminarin can be strategically applied to develop a preventative against injuries following cerebral ischemic insults. Full article
(This article belongs to the Collection Marine Polysaccharides)
Show Figures

Graphical abstract

20 pages, 3219 KB  
Article
Isolation and Characterization of Antimicrobial Peptides with Unusual Disulfide Connectivity from the Colonial Ascidian Synoicum turgens
by Ida K. Ø. Hansen, Johan Isaksson, Aaron G. Poth, Kine Ø. Hansen, Aaron J. C. Andersen, Céline S. M. Richard, Hans-Matti Blencke, Klara Stensvåg, David J. Craik and Tor Haug
Mar. Drugs 2020, 18(1), 51; https://doi.org/10.3390/md18010051 - 12 Jan 2020
Cited by 39 | Viewed by 7498
Abstract
This study reports the isolation of two novel cysteine-rich antibacterial peptides, turgencin A and turgencin B, along with their oxidized derivatives, from the Arctic marine colonial ascidian Synoicum turgens. The peptides are post-translationally modified, containing six cysteines with an unusual disulfide connectivity [...] Read more.
This study reports the isolation of two novel cysteine-rich antibacterial peptides, turgencin A and turgencin B, along with their oxidized derivatives, from the Arctic marine colonial ascidian Synoicum turgens. The peptides are post-translationally modified, containing six cysteines with an unusual disulfide connectivity of Cys1-Cys6, Cys2-Cys5, and Cys3-Cys4 and an amidated C-terminus. Furthermore, the peptides contain methionine residues resulting in the isolation of peptides with different degrees of oxidation. The most potent peptide, turgencin AMox1 with one oxidized methionine, displayed antimicrobial activity against both Gram-negative and Gram-positive bacteria with a minimum inhibitory concentration (MIC) as low as 0.4 µM against selected bacterial strains. In addition, the peptide inhibited the growth of the melanoma cancer cell line A2058 (IC50 = 1.4 µM) and the human fibroblast cell line MRC-5 (IC50 = 4.8 µM). The results from this study show that natural peptides isolated from marine tunicates have the potential to be promising drug leads. Full article
(This article belongs to the Collection Bioactive Compounds from Marine Invertebrates)
Show Figures

Graphical abstract

13 pages, 2234 KB  
Article
Antitumour Potential of Gigartina pistillata Carrageenans against Colorectal Cancer Stem Cell-Enriched Tumourspheres
by João Cotas, Vanda Marques, Marta B. Afonso, Cecília M. P. Rodrigues and Leonel Pereira
Mar. Drugs 2020, 18(1), 50; https://doi.org/10.3390/md18010050 - 12 Jan 2020
Cited by 65 | Viewed by 6444
Abstract
Gigartina pistillata is a red seaweed common in Figueira da Foz, Portugal. Here, the antitumour potential of G. pistillata carrageenan, with a known variable of the life cycle, the female gametophyte (FG) and tetrasporophyte (T) was evaluated against colorectal cancer stem cell (CSC) [...] Read more.
Gigartina pistillata is a red seaweed common in Figueira da Foz, Portugal. Here, the antitumour potential of G. pistillata carrageenan, with a known variable of the life cycle, the female gametophyte (FG) and tetrasporophyte (T) was evaluated against colorectal cancer stem cell (CSC) -enriched tumourspheres. FTIR-ATR analysis of G. pistillata carrageenan extracts indicated differences between life cycle phases, being FG a κ/ι hybrid carrageenan and T a ʎ/ξ hybrid. Both carrageenan extracts presented IC50 values inferior to 1 μg/mL in HT29-derived CSC-enriched tumourspheres, as well as reduced tumoursphere area. The two extracts were also effective at reducing cellular viability in SW620- and SW480-derived tumourspheres. These results indicate that carrageenans extracted from two G. pistillata life cycle phases have antitumour potential against colorectal cancer stem-like cells, specially the T carrageenan. Full article
(This article belongs to the Special Issue Characterization of Bioactive Components in Edible Algae)
Show Figures

Figure 1

12 pages, 4194 KB  
Article
Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures
by Maria Marzano, Andrea Patrizia Falanga, Daniela Marasco, Nicola Borbone, Stefano D’Errico, Gennaro Piccialli, Giovanni Nicola Roviello and Giorgia Oliviero
Mar. Drugs 2020, 18(1), 49; https://doi.org/10.3390/md18010049 - 11 Jan 2020
Cited by 38 | Viewed by 5558
Abstract
ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as [...] Read more.
ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies. Full article
Show Figures

Figure 1

12 pages, 2485 KB  
Article
Promotion of Wound Healing and Prevention of Frostbite Injury in Rat Skin by Exopolysaccharide from the Arctic Marine Bacterium Polaribacter sp. SM1127
by Mei-Ling Sun, Fang Zhao, Xiu-Lan Chen, Xi-Ying Zhang, Yu-Zhong Zhang, Xiao-Yan Song, Cai-Yun Sun and Jie Yang
Mar. Drugs 2020, 18(1), 48; https://doi.org/10.3390/md18010048 - 11 Jan 2020
Cited by 50 | Viewed by 7930
Abstract
Many marine microorganisms synthesize exopolysaccharides (EPSs), and some of these EPSs have been reported to have potential in different fields. However, the pharmaceutical potentials of marine EPSs are rarely reported. The EPS secreted by the Artic marine bacterium Polaribacter sp. SM1127 has good [...] Read more.
Many marine microorganisms synthesize exopolysaccharides (EPSs), and some of these EPSs have been reported to have potential in different fields. However, the pharmaceutical potentials of marine EPSs are rarely reported. The EPS secreted by the Artic marine bacterium Polaribacter sp. SM1127 has good antioxidant activity, outstanding moisture-retention ability, and considerable protective property on human dermal fibroblasts (HDFs) at low temperature. Here, the effects of SM1127 EPS on skin wound healing and frostbite injury prevention were studied. Scratch wound assay showed that SM1127 EPS could stimulate the migration of HDFs. In the full-thickness cutaneous wound experiment of Sprague–Dawley (SD) rats, SM1127 EPS increased the wound healing rate and stimulated tissue repair detected by macroscopic observation and histologic examination, showing the ability of SM1127 EPS to promote skin wound healing. In the skin frostbite experiment of SD rats, pretreatment of rat skin with SM1127 EPS increased the rate of frostbite wound healing and promoted the repair of the injured skin significantly, indicating the good effect of SM1127 EPS on frostbite injury prevention. These results suggest the promising potential of SM1127 EPS in the pharmaceutical area to promote skin wound healing and prevent frostbite injury. Full article
(This article belongs to the Special Issue Marine Polysaccharides in Pharmaceutical Applications)
Show Figures

Figure 1

16 pages, 1739 KB  
Article
Pyrenosetins A–C, New Decalinoylspirotetramic Acid Derivatives Isolated by Bioactivity-Based Molecular Networking from the Seaweed-Derived Fungus Pyrenochaetopsis sp. FVE-001
by Bicheng Fan, Pradeep Dewapriya, Fengjie Li, Martina Blümel and Deniz Tasdemir
Mar. Drugs 2020, 18(1), 47; https://doi.org/10.3390/md18010047 - 11 Jan 2020
Cited by 39 | Viewed by 11852
Abstract
Marine algae represent a prolific source of filamentous fungi for bioprospecting. In continuation of our search for new anticancer leads from fungi derived from the brown alga Fucus vesiculosus, an endophytic Pyrenochaetopsis sp. FVE-001 was selected for an in-depth chemical analysis. The [...] Read more.
Marine algae represent a prolific source of filamentous fungi for bioprospecting. In continuation of our search for new anticancer leads from fungi derived from the brown alga Fucus vesiculosus, an endophytic Pyrenochaetopsis sp. FVE-001 was selected for an in-depth chemical analysis. The crude fungal extract inhibited several cancer cell lines in vitro, and the highest anticancer activity was tracked to its CHCl3–soluble portion. A bioactivity-based molecular networking approach was applied to C18-SPE fractions of the CHCl3 subextract to predict the bioactivity scores of metabolites in the fractions and to aid targeted purification of anticancer metabolites. This approach led to a rapid isolation of three new decalinoylspirotetramic acid derivatives, pyrenosetins A–C (13) and the known decalin tetramic acid phomasetin (4). The structures of the compounds were elucidated by extensive NMR, HR-ESIMS, FT-IR spectroscopy, [α]D and Mosher’s ester method. Compounds 1 and 2 showed high anticancer activity against malignant melanoma cell line A-375 (IC50 values 2.8 and 6.3 μM, respectively), in line with the bioactivity predictions. This is the first study focusing on secondary metabolites of a marine-derived Pyrenochaetopsis sp. and the second investigation performed on the member of the genus Pyrenochaetopsis. Full article
(This article belongs to the Special Issue Metabolomic Approach to Investigate Marine Fungi for Drug Discovery)
Show Figures

Graphical abstract

13 pages, 1033 KB  
Article
Aerosolizable Marine Phycotoxins and Human Health Effects: In Vitro Support for the Biogenics Hypothesis
by Emmanuel Van Acker, Maarten De Rijcke, Jana Asselman, Ilse M. Beck, Steve Huysman, Lynn Vanhaecke, Karel A.C. De Schamphelaere and Colin R. Janssen
Mar. Drugs 2020, 18(1), 46; https://doi.org/10.3390/md18010046 - 10 Jan 2020
Cited by 19 | Viewed by 4985
Abstract
Respiratory exposure to marine phycotoxins is of increasing concern. Inhalation of sea spray aerosols (SSAs), during harmful Karenia brevis and Ostreopsis ovata blooms induces respiratory distress among others. The biogenics hypothesis, however, suggests that regular airborne exposure to natural products is health promoting [...] Read more.
Respiratory exposure to marine phycotoxins is of increasing concern. Inhalation of sea spray aerosols (SSAs), during harmful Karenia brevis and Ostreopsis ovata blooms induces respiratory distress among others. The biogenics hypothesis, however, suggests that regular airborne exposure to natural products is health promoting via a downregulation of the mechanistic target of rapamycin (mTOR) pathway. Until now, little scientific evidence supported this hypothesis. The current explorative in vitro study investigated both health-affecting and potential health-promoting mechanisms of airborne phycotoxin exposure, by analyzing cell viability effects via cytotoxicity assays and effects on the mTOR pathway via western blotting. To that end, A549 and BEAS-2B lung cells were exposed to increasing concentrations (ng·L−1–mg·L−1) of (1) pure phycotoxins and (2) an extract of experimental aerosolized homoyessotoxin (hYTX). The lowest cell viability effect concentrations were found for the examined yessotoxins (YTXs). Contradictory to the other phycotoxins, these YTXs only induced a partial cell viability decrease at the highest test concentrations. Growth inhibition and apoptosis, both linked to mTOR pathway activity, may explain these effects, as both YTXs were shown to downregulate this pathway. This proof-of-principle study supports the biogenics hypothesis, as specific aerosolizable marine products (e.g., YTXs) can downregulate the mTOR pathway. Full article
(This article belongs to the Special Issue In Vitro and In Vivo Approaches to Study Potential Marine Drugs)
Show Figures

Figure 1

21 pages, 5043 KB  
Article
Fucoidan Derived from Fucus vesiculosus Inhibits the Development of Human Ovarian Cancer via the Disturbance of Calcium Homeostasis, Endoplasmic Reticulum Stress, and Angiogenesis
by Hyocheol Bae, Jin-Young Lee, Changwon Yang, Gwonhwa Song and Whasun Lim
Mar. Drugs 2020, 18(1), 45; https://doi.org/10.3390/md18010045 - 9 Jan 2020
Cited by 61 | Viewed by 6432
Abstract
Marine organisms are sources of several natural compounds with potential clinical use. However, only a few marine-based pharmaceuticals have been approved for use due to limited knowledge on their biological activities. Here, we identified the functional role of fucoidan extracted from Fucus vesiculosus [...] Read more.
Marine organisms are sources of several natural compounds with potential clinical use. However, only a few marine-based pharmaceuticals have been approved for use due to limited knowledge on their biological activities. Here, we identified the functional role of fucoidan extracted from Fucus vesiculosus on ovarian cancer. Fucoidan increased the death of ES-2 and OV-90 cells, through a reduction in proliferation, cell cycle arrest, releases of cytochrome c, reactive oxygen species (ROS) generation, and endoplasmic reticulum (ER) stress. Additionally, fucoidan increased the concentration of cytosolic and mitochondrial calcium in both cells. The decrease of cell proliferation was controlled by the inactivation of PI3K and MAPK signaling cascades in ES-2 and OV-90 cells. In a toxicity assay with normal zebrafish larvae, fucoidan did not induce toxicity, cardiotoxicity, development, kinesis, and apoptosis at different concentrations. However, it disrupted tumor formation and vascular development in a zebrafish xenograft model and angiogenesis transgenic (Tg, fli1-eGFP) model, respectively. Collectively, the results indicate that fucoidan may be a novel pharmaceutical for the management of human ovarian cancer. Full article
Show Figures

Figure 1

22 pages, 5493 KB  
Article
Vaginal Polyelectrolyte Layer-by-Layer Films Based on Chitosan Derivatives and Eudragit® S100 for pH Responsive Release of Tenofovir
by Raúl Cazorla-Luna, Araceli Martín-Illana, Fernando Notario-Pérez, Luis Miguel Bedoya, Aitana Tamayo, Roberto Ruiz-Caro, Juan Rubio and María-Dolores Veiga
Mar. Drugs 2020, 18(1), 44; https://doi.org/10.3390/md18010044 - 9 Jan 2020
Cited by 35 | Viewed by 7376
Abstract
Women are still at high risk of contracting the human immunodeficiency virus (HIV) virus due to the lack of protection methods under their control, especially in sub-Saharan countries. Polyelectrolyte multilayer smart vaginal films based on chitosan derivatives (chitosan lactate, chitosan tartate, and chitosan [...] Read more.
Women are still at high risk of contracting the human immunodeficiency virus (HIV) virus due to the lack of protection methods under their control, especially in sub-Saharan countries. Polyelectrolyte multilayer smart vaginal films based on chitosan derivatives (chitosan lactate, chitosan tartate, and chitosan citrate) and Eudragit® S100 were developed for the pH-sensitive release of Tenofovir. Films were characterized through texture analysis and scanning electron microscopy (SEM). Swelling and drug release studies were carried out in simulated vaginal fluid and a mixture of simulated vaginal and seminal fluids. Ex vivo mucoadhesion was evaluated in bovine vaginal mucosa. SEM micrographs revealed the formation of multilayer films. According to texture analysis, chitosan citrate was the most flexible compared to chitosan tartrate and lactate. The swelling studies showed a moderate water uptake (<300% in all cases), leading to the sustained release of Tenofovir in simulated vaginal fluid (up to 120 h), which was accelerated in the simulated fluid mixture (4–6 h). The films had high mucoadhesion in bovine vaginal mucosa. The multilayer films formed by a mixture of chitosan citrate and Eudragit® S100 proved to be the most promising, with zero toxicity, excellent mechanical properties, moderate swelling (<100%), high mucoadhesion capacity, and Tenofovir release of 120 h and 4 h in vaginal fluid and the simulated fluid mixture respectively. Full article
(This article belongs to the Special Issue Marine Chitin 2019)
Show Figures

Graphical abstract

23 pages, 4571 KB  
Review
Distribution, Contents, and Types of Mycosporine-Like Amino Acids (MAAs) in Marine Macroalgae and a Database for MAAs Based on These Characteristics
by Yingying Sun, Naisheng Zhang, Jing Zhou, Shasha Dong, Xin Zhang, Lei Guo and Ganlin Guo
Mar. Drugs 2020, 18(1), 43; https://doi.org/10.3390/md18010043 - 7 Jan 2020
Cited by 78 | Viewed by 9512
Abstract
Mycosporine-like amino acids (MAAs), maximally absorbed in the wavelength region of 310–360 nm, are widely distributed in algae, phytoplankton and microorganisms, as a class of possible multi-functional compounds. In this work, based on the Web of Science, Springer, Google Scholar, and China national [...] Read more.
Mycosporine-like amino acids (MAAs), maximally absorbed in the wavelength region of 310–360 nm, are widely distributed in algae, phytoplankton and microorganisms, as a class of possible multi-functional compounds. In this work, based on the Web of Science, Springer, Google Scholar, and China national knowledge infrastructure (CNKI), we have summarized and analyzed the studies related to MAAs in marine macroalgae over the past 30 years (1990–2019), mainly focused on MAAs distribution, contents, and types. It was confirmed that 572 species marine macroalgae contained MAAs, namely in 45 species of Chlorophytes, 41 species of Phaeophytes, and 486 species of Rhodophytes, and they respectively belonged to 28 orders. On this basis, we established an open online database to quickly retrieve MAAs in 501 species of marine macroalgae. Furthermore, research concerning MAAs in marine macroalgae were analyzed using CiteSpace. It could easily be seen that the preparation and purification of MAAs in marine macroalgae have not been intensively studied during the past 10 years, and therefore it is necessary to strengthen the research in the preparation and purification of MAA purified standards from marine macroalgae in the future. We agreed that this process is not only interesting, but important due to the potential use of MAAs as food and cosmetics, as well as within the medicine industry. Full article
(This article belongs to the Special Issue Mycosporine-Like Amino Acids from Marine Resource)
Show Figures

Figure 1

13 pages, 1080 KB  
Article
Ectoine from Bacterial and Algal Origin Is a Compatible Solute in Microalgae
by Simona Fenizia, Kathleen Thume, Marino Wirgenings and Georg Pohnert
Mar. Drugs 2020, 18(1), 42; https://doi.org/10.3390/md18010042 - 6 Jan 2020
Cited by 61 | Viewed by 8037
Abstract
Osmoregulation in phytoplankton is attributed to several highly polar low-molecular-weight metabolites. A widely accepted model considers dimethylsulfoniopropionate (DMSP) as the most important and abundant osmotically active metabolite. Using an optimized procedure for the extraction and detection of highly polar metabolites, we expand the [...] Read more.
Osmoregulation in phytoplankton is attributed to several highly polar low-molecular-weight metabolites. A widely accepted model considers dimethylsulfoniopropionate (DMSP) as the most important and abundant osmotically active metabolite. Using an optimized procedure for the extraction and detection of highly polar metabolites, we expand the group of phytoplankton osmolytes by identifying ectoine in several microalgae. Ectoine is known as a bacterial compatible solute, but, to the best of our knowledge, was never considered as a phytoplankton-derived product. Given the ability of microalgae to take up zwitterions, such as DMSP, we tested the hypothesis that the algal ectoine is derived from associated bacteria. We therefore analyzed methanol extracts of xenic and axenic cultures of two different species of microalgae and could detect elevated concentrations of ectoine in those that harbor associated bacteria. However, also microalgae without an associated microbiome contain ectoine in smaller amounts, pointing towards a dual origin of this metabolite in the algae from their own biosynthesis as well as from uptake. We also tested the role of ectoine in the osmoadaptation of microalgae. In the model diatoms Thalassiosira weissflogii and Phaeodactylum tricornutum, elevated amounts of ectoine were found when cultivated in seawater with salinities of 50 PSU compared to the standard culture conditions of 35 PSU. Therefore, we add ectoine to the family of osmoadaptive metabolites in phytoplankton and prove a new, potentially synergistic metabolic interplay of bacteria and algae. Full article
(This article belongs to the Special Issue Bioactive Compounds Derived from Marine Microalgae)
Show Figures

Figure 1

42 pages, 2524 KB  
Review
Chemical Diversity in Species Belonging to Soft Coral Genus Sacrophyton and Its Impact on Biological Activity: A Review
by Yasmin A. Elkhawas, Ahmed M. Elissawy, Mohamed S. Elnaggar, Nada M. Mostafa, Eman Al-Sayed, Mokhtar M. Bishr, Abdel Nasser B. Singab and Osama M. Salama
Mar. Drugs 2020, 18(1), 41; https://doi.org/10.3390/md18010041 - 6 Jan 2020
Cited by 70 | Viewed by 8086
Abstract
One of the most widely distributed soft coral species, found especially in shallow waters of the Indo-Pacific region, Red Sea, Mediterranean Sea, and also the Arctic, is genus Sacrophyton. The total number of species belonging to it was estimated to be 40. [...] Read more.
One of the most widely distributed soft coral species, found especially in shallow waters of the Indo-Pacific region, Red Sea, Mediterranean Sea, and also the Arctic, is genus Sacrophyton. The total number of species belonging to it was estimated to be 40. Sarcophyton species are considered to be a reservoir of bioactive natural metabolites. Secondary metabolites isolated from members belonging to this genus show great chemical diversity. They are rich in terpenoids, in particular, cembranoids diterpenes, tetratepenoids, triterpenoids, and ceramide, in addition to steroids, sesquiterpenes, and fatty acids. They showed a broad range of potent biological activities, such as antitumor, neuroprotective, antimicrobial, antiviral, antidiabetic, antifouling, and anti-inflammatory activity. This review presents all isolated secondary metabolites from species of genera Sacrophyton, as well as their reported biological activities covering a period of about two decades (1998–2019). It deals with 481 metabolites, including 323 diterpenes, 39 biscembranoids, 11 sesquiterpenes, 53 polyoxygenated sterols, and 55 miscellaneous and their pharmacological activities. Full article
Show Figures

Figure 1

176 pages, 18462 KB  
Conference Report
XVI International Symposium on Marine Natural Products|XI European Conference on Marine Natural Products
by Rui Pedrosa, Susana P. Gaudêncio and Vitor Vasconcelos
Mar. Drugs 2020, 18(1), 40; https://doi.org/10.3390/md18010040 - 6 Jan 2020
Cited by 16 | Viewed by 28222
Abstract
The International Symposium on Marine Natural Products (MaNaPro) happened for the first time in 1975 in the city of Aberdeen, Scotland, organized by Professor Ronald H [...] Full article
(This article belongs to the Special Issue Selected Papers from XVI MaNaPro and XI ECMNP)
Show Figures

Figure 1

Previous Issue
Next Issue
Back to TopTop