Next Article in Journal
Isolation and Characterization of Antimicrobial Peptides with Unusual Disulfide Connectivity from the Colonial Ascidian Synoicum turgens
Previous Article in Journal
Promotion of Wound Healing and Prevention of Frostbite Injury in Rat Skin by Exopolysaccharide from the Arctic Marine Bacterium Polaribacter sp. SM1127
Previous Article in Special Issue
Fast Detection of Two Smenamide Family Members Using Molecular Networking
Open AccessArticle

Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures

1
Department of Pharmacy, University of Naples Federico II, Via Domenico Montesano 49, 80131 Naples, Italy
2
Institute of Biostructures and Bioimaging—CNR 1, Via Mezzocannone 16, 80134 Naples, Italy
3
Department of Molecular Medicine and Medical Biotechnologies, University of Napoli Federico II, Via Sergio Pansini 5, 80131 Naples, Italy
*
Author to whom correspondence should be addressed.
Mar. Drugs 2020, 18(1), 49; https://doi.org/10.3390/md18010049
Received: 7 November 2019 / Revised: 4 January 2020 / Accepted: 9 January 2020 / Published: 11 January 2020
ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies. View Full-Text
Keywords: marine peptide; epsilon-poly-l-lysine; ε-PLL; G-quadruplex DNA; human telomere; c-myc oncogene marine peptide; epsilon-poly-l-lysine; ε-PLL; G-quadruplex DNA; human telomere; c-myc oncogene
Show Figures

Figure 1

MDPI and ACS Style

Marzano, M.; Falanga, A.P.; Marasco, D.; Borbone, N.; D’Errico, S.; Piccialli, G.; Roviello, G.N.; Oliviero, G. Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures. Mar. Drugs 2020, 18, 49.

Show more citation formats Show less citations formats
Note that from the first issue of 2016, MDPI journals use article numbers instead of page numbers. See further details here.

Article Access Map by Country/Region

1
Back to TopTop