Next Issue
Volume 10, November
Previous Issue
Volume 10, September
 
 

Genes, Volume 10, Issue 10 (October 2019) – 105 articles

Cover Story (view full-size image): Development is orchestrated by regulatory elements that turn genes ON or OFF in precise patterns. Many safety mechanisms prevent a regulatory element from inappropriately regulating the wrong gene. In flies and mammals, dedicated DNA elements called insulators recruit insulator binding proteins (IBPs) to shield promoters from regulatory elements. A single IBP called CCCTC-binding factor (CTCF) is known in mammals, whereas functional studies in Drosophila have identified several IBPs. How insulators function at the molecular level is unclear, but they may fold chromosomes into conformations that affect regulatory element-promoter communication. We compare and contrast recent studies in flies and mice to ask: Is insulation important for animal development? Though requirements for insulation differ, insulation emerges as a conserved and critical gene regulation strategy. View this paper.
  • Issues are regarded as officially published after their release is announced to the table of contents alert mailing list.
  • You may sign up for e-mail alerts to receive table of contents of newly released issues.
  • PDF is the official format for papers published in both, html and pdf forms. To view the papers in pdf format, click on the "PDF Full-text" link, and use the free Adobe Reader to open them.
Order results
Result details
Section
Select all
Export citation of selected articles as:
31 pages, 5816 KiB  
Article
A Method for the Structure-Based, Genome-Wide Analysis of Bacterial Intergenic Sequences Identifies Shared Compositional and Functional Features
by Leonardo Lenzini, Francesca Di Patti, Roberto Livi, Marco Fondi, Renato Fani and Alessio Mengoni
Genes 2019, 10(10), 834; https://doi.org/10.3390/genes10100834 - 22 Oct 2019
Viewed by 3059
Abstract
In this paper, we propose a computational strategy for performing genome-wide analyses of intergenic sequences in bacterial genomes. Following similar directions of a previous paper, where a method for genome-wide analysis of eucaryotic Intergenic sequences was proposed, here we developed a tool for [...] Read more.
In this paper, we propose a computational strategy for performing genome-wide analyses of intergenic sequences in bacterial genomes. Following similar directions of a previous paper, where a method for genome-wide analysis of eucaryotic Intergenic sequences was proposed, here we developed a tool for implementing similar concepts in bacteria genomes. This allows us to (i) classify intergenic sequences into clusters, characterized by specific global structural features and (ii) draw possible relations with their functional features. Full article
(This article belongs to the Special Issue Tools for Population and Evolutionary Genetics)
Show Figures

Figure 1

9 pages, 859 KiB  
Article
Likely Pathogenic Variants in One Third of Non-Syndromic Discontinuous Cleft Lip and Palate Patients
by Bénédicte Demeer, Nicole Revencu, Raphael Helaers, Cica Gbaguidi, Stéphanie Dakpe, Geneviève François, Bernard Devauchelle, Bénédicte Bayet and Miikka Vikkula
Genes 2019, 10(10), 833; https://doi.org/10.3390/genes10100833 - 22 Oct 2019
Cited by 10 | Viewed by 4967
Abstract
Oral clefts are composed of cleft of the lip, cleft of the lip and palate, or cleft of the palate, and they are associated with a wide range of expression and severity. When cleft of the palate is associated with cleft of the [...] Read more.
Oral clefts are composed of cleft of the lip, cleft of the lip and palate, or cleft of the palate, and they are associated with a wide range of expression and severity. When cleft of the palate is associated with cleft of the lip with preservation of the primary palate, it defines an atypical phenotype called discontinuous cleft. Although this phenotype may represent 5% of clefts of the lip and/or palate (CLP), it is rarely specifically referred to and its pathophysiology is unknown. We conducted whole exome sequencing (WES) and apply a candidate gene approach to non-syndromic discontinuous CLP individuals in order to identify genes and deleterious variants that could underlie this phenotype. We discovered loss-of-function variants in two out of the seven individuals, implicating FGFR1 and DLG1 genes, which represents almost one third of this cohort. Whole exome sequencing of clinically well-defined subgroups of CLP, such as discontinuous cleft, is a relevant approach to study CLP etiopathogenesis. It could facilitate more accurate clinical, epidemiological and fundamental research, ultimately resulting in better diagnosis and care of CLP patients. Non-syndromic discontinuous cleft lip and palate seems to have a strong genetic basis. Full article
(This article belongs to the Special Issue Molecular Genetics of Facial Traits and Malformations)
Show Figures

Figure 1

18 pages, 3113 KiB  
Article
Germline-Specific Repetitive Elements in Programmatically Eliminated Chromosomes of the Sea Lamprey (Petromyzon marinus)
by Vladimir A. Timoshevskiy, Nataliya Y. Timoshevskaya and Jeramiah J. Smith
Genes 2019, 10(10), 832; https://doi.org/10.3390/genes10100832 - 22 Oct 2019
Cited by 14 | Viewed by 4706
Abstract
The sea lamprey (Petromyzon marinus) is one of few vertebrate species known to reproducibly eliminate large fractions of its genome during normal embryonic development. This germline-specific DNA is lost in the form of large fragments, including entire chromosomes, and available evidence [...] Read more.
The sea lamprey (Petromyzon marinus) is one of few vertebrate species known to reproducibly eliminate large fractions of its genome during normal embryonic development. This germline-specific DNA is lost in the form of large fragments, including entire chromosomes, and available evidence suggests that DNA elimination acts as a permanent silencing mechanism that prevents the somatic expression of a specific subset of “germline” genes. However, reconstruction of eliminated regions has proven to be challenging due to the complexity of the lamprey karyotype. We applied an integrative approach aimed at further characterization of the large-scale structure of eliminated segments, including: (1) in silico identification of germline-enriched repeats; (2) mapping the chromosomal location of specific repetitive sequences in germline metaphases; and (3) 3D DNA/DNA-hybridization to embryonic lagging anaphases, which permitted us to both verify the specificity of elements to physically eliminated chromosomes and characterize the subcellular organization of these elements during elimination. This approach resulted in the discovery of several repetitive elements that are found exclusively on the eliminated chromosomes, which subsequently permitted the identification of 12 individual chromosomes that are programmatically eliminated during early embryogenesis. The fidelity and specificity of these highly abundant sequences, their distinctive patterning in eliminated chromosomes, and subcellular localization in elimination anaphases suggest that these sequences might contribute to the specific targeting of chromosomes for elimination or possibly in molecular interactions that mediate their decelerated poleward movement in chromosome elimination anaphases, isolation into micronuclei and eventual degradation. Full article
(This article belongs to the Special Issue Chromosome-Centric View of the Genome Organization and Evolution)
Show Figures

Figure 1

18 pages, 2225 KiB  
Review
The Mechanisms of Mating in Pathogenic Fungi—A Plastic Trait
by Jane Usher
Genes 2019, 10(10), 831; https://doi.org/10.3390/genes10100831 - 21 Oct 2019
Cited by 15 | Viewed by 14478
Abstract
The impact of fungi on human and plant health is an ever-increasing issue. Recent studies have estimated that human fungal infections result in an excess of one million deaths per year and plant fungal infections resulting in the loss of crop yields worth [...] Read more.
The impact of fungi on human and plant health is an ever-increasing issue. Recent studies have estimated that human fungal infections result in an excess of one million deaths per year and plant fungal infections resulting in the loss of crop yields worth approximately 200 million per annum. Sexual reproduction in these economically important fungi has evolved in response to the environmental stresses encountered by the pathogens as a method to target DNA damage. Meiosis is integral to this process, through increasing diversity through recombination. Mating and meiosis have been extensively studied in the model yeast Saccharomyces cerevisiae, highlighting that these mechanisms have diverged even between apparently closely related species. To further examine this, this review will inspect these mechanisms in emerging important fungal pathogens, such as Candida, Aspergillus, and Cryptococcus. It shows that both sexual and asexual reproduction in these fungi demonstrate a high degree of plasticity. Full article
(This article belongs to the Special Issue Genome Plasticity of Human and Plant Pathogenic Fungi)
Show Figures

Figure 1

10 pages, 1145 KiB  
Article
Molecular Characterization of Leishmania RNA virus 2 in Leishmania major from Uzbekistan
by Yuliya Kleschenko, Danyil Grybchuk, Nadezhda S. Matveeva, Diego H. Macedo, Evgeny N. Ponirovsky, Alexander N. Lukashev and Vyacheslav Yurchenko
Genes 2019, 10(10), 830; https://doi.org/10.3390/genes10100830 - 21 Oct 2019
Cited by 25 | Viewed by 4497
Abstract
Here we report sequence and phylogenetic analysis of two new isolates of Leishmania RNA virus 2 (LRV2) found in Leishmania major isolated from human patients with cutaneous leishmaniasis in south Uzbekistan. These new virus-infected flagellates were isolated in the same region of Uzbekistan [...] Read more.
Here we report sequence and phylogenetic analysis of two new isolates of Leishmania RNA virus 2 (LRV2) found in Leishmania major isolated from human patients with cutaneous leishmaniasis in south Uzbekistan. These new virus-infected flagellates were isolated in the same region of Uzbekistan and the viral sequences differed by only nineteen SNPs, all except one being silent mutations. Therefore, we concluded that they belong to a single LRV2 species. New viruses are closely related to the LRV2-Lmj-ASKH documented in Turkmenistan in 1995, which is congruent with their shared host (L. major) and common geographical origin. Full article
(This article belongs to the Special Issue Genetics of Leishmania)
Show Figures

Figure 1

17 pages, 2683 KiB  
Article
A Genome-Wide Association Study Revealed Key SNPs/Genes Associated With Salinity Stress Tolerance In Upland Cotton
by Muhammad Yasir, Shoupu He, Gaofei Sun, Xiaoli Geng, Zhaoe Pan, Wenfang Gong, Yinhua Jia and Xiongming Du
Genes 2019, 10(10), 829; https://doi.org/10.3390/genes10100829 - 21 Oct 2019
Cited by 33 | Viewed by 4931
Abstract
Millions of hectares of land are too saline to produce economically valuable crop yields. Salt tolerance in cotton is an imperative approach for improvement in response to ever-increasing soil salinization. Little is known about the genetic basis of salt tolerance in cotton at [...] Read more.
Millions of hectares of land are too saline to produce economically valuable crop yields. Salt tolerance in cotton is an imperative approach for improvement in response to ever-increasing soil salinization. Little is known about the genetic basis of salt tolerance in cotton at the seedling stage. To address this issue, a genome-wide association study (GWAS) was conducted on a core collection of a genetically diverse population of upland cotton (Gossypium hirsutum L.) comprising of 419 accessions, representing various geographic origins, including China, USA, Pakistan, the former Soviet Union, Chad, Australia, Brazil, Mexico, Sudan, and Uganda. Phenotypic evaluation of 7 traits under control (0 mM) and treatment (150 mM) NaCl conditions depicted the presence of broad natural variation in the studied population. The association study was carried out with the efficient mixed-model association eXpedited software package. A total of 17,264 single-nucleotide polymorphisms (SNPs) associated with different salinity stress tolerance related traits were found. Twenty-three candidate SNPs related to salinity stress-related traits were selected. Final key SNPs were selected based on the r2 value with nearby SNPs in a linkage disequilibrium (LD) block. Twenty putative candidate genes surrounding SNPs, A10_95330133 and D10_61258588, associated with leaf relative water content, RWC_150, and leaf fresh weight, FW_150, were identified, respectively. We further validated the expression patterns of twelve candidate genes with qRT-PCR, which revealed different expression levels in salt-tolerant and salt-sensitive genotypes. The results of our GWAS provide useful knowledge about the genetic control of salt tolerance at the seedling stage, which could assist in elucidating the genetic and molecular mechanisms of salinity stress tolerance in cotton plants. Full article
(This article belongs to the Special Issue Selection Methods in Plant Breeding: From Visual Phenotyping to NGS)
Show Figures

Figure 1

13 pages, 1523 KiB  
Article
i6mA-DNCP: Computational Identification of DNA N6-Methyladenine Sites in the Rice Genome Using Optimized Dinucleotide-Based Features
by Liang Kong and Lichao Zhang
Genes 2019, 10(10), 828; https://doi.org/10.3390/genes10100828 - 20 Oct 2019
Cited by 36 | Viewed by 3679
Abstract
DNA N6-methyladenine (6mA) plays an important role in regulating the gene expression of eukaryotes. Accurate identification of 6mA sites may assist in understanding genomic 6mA distributions and biological functions. Various experimental methods have been applied to detect 6mA sites in a [...] Read more.
DNA N6-methyladenine (6mA) plays an important role in regulating the gene expression of eukaryotes. Accurate identification of 6mA sites may assist in understanding genomic 6mA distributions and biological functions. Various experimental methods have been applied to detect 6mA sites in a genome-wide scope, but they are too time-consuming and expensive. Developing computational methods to rapidly identify 6mA sites is needed. In this paper, a new machine learning-based method, i6mA-DNCP, was proposed for identifying 6mA sites in the rice genome. Dinucleotide composition and dinucleotide-based DNA properties were first employed to represent DNA sequences. After a specially designed DNA property selection process, a bagging classifier was used to build the prediction model. The jackknife test on a benchmark dataset demonstrated that i6mA-DNCP could obtain 84.43% sensitivity, 88.86% specificity, 86.65% accuracy, a 0.734 Matthew’s correlation coefficient (MCC), and a 0.926 area under the receiver operating characteristic curve (AUC). Moreover, three independent datasets were established to assess the generalization ability of our method. Extensive experiments validated the effectiveness of i6mA-DNCP. Full article
(This article belongs to the Section Technologies and Resources for Genetics)
Show Figures

Graphical abstract

17 pages, 10677 KiB  
Article
Comparative Study of Gut Microbiota in Wild and Captive Giant Pandas (Ailuropoda melanoleuca)
by Wei Guo, Sudhanshu Mishra, Chengdong Wang, Hemin Zhang, Ruihong Ning, Fanli Kong, Bo Zeng, Jiangchao Zhao and Ying Li
Genes 2019, 10(10), 827; https://doi.org/10.3390/genes10100827 - 20 Oct 2019
Cited by 87 | Viewed by 8835
Abstract
Captive breeding has been used as an effective approach to protecting endangered animals but its effect on the gut microbiome and the conservation status of these species is largely unknown. The giant panda is a flagship species for the conservation of wildlife. With [...] Read more.
Captive breeding has been used as an effective approach to protecting endangered animals but its effect on the gut microbiome and the conservation status of these species is largely unknown. The giant panda is a flagship species for the conservation of wildlife. With integrated efforts including captive breeding, this species has been recently upgraded from “endangered” to “vulnerable” (IUCN 2016). Since a large proportion (21.8%) of their global population is still captive, it is critical to understand how captivity changes the gut microbiome of these pandas and how such alterations to the microbiome might affect their future fitness and potential impact on the ecosystem after release into the wild. Here, we use 16S rRNA (ribosomal RNA) marker gene sequencing and shotgun metagenomics sequencing to demonstrate that the fecal microbiomes differ substantially between wild and captive giant pandas. Fecal microbiome diversity was significantly lower in captive pandas, as was the diversity of functional genes. Additionally, captive pandas have reduced functional potential for cellulose degradation but enriched metabolic pathways for starch metabolism, indicating that they may not adapt to a wild diet after being released into the wild since a major component of their diet in the wild will be bamboo. Most significantly, we observed a significantly higher level of amylase activity but a lower level of cellulase activity in captive giant panda feces than those of wild giant pandas, shown by an in vitro experimental assay. Furthermore, antibiotic resistance genes and virulence factors, as well as heavy metal tolerance genes were enriched in the microbiomes of captive pandas, which raises a great concern of spreading these genes to other wild animals and ecosystems when they are released into a wild environment. Our results clearly show that captivity has altered the giant panda microbiome, which could have unintended negative consequences on their adaptability and the ecosystem during the reintroduction of giant pandas into the wild. Full article
(This article belongs to the Section Microbial Genetics and Genomics)
Show Figures

Graphical abstract

15 pages, 2364 KiB  
Article
Frameshift Variant in MFSD12 Explains the Mushroom Coat Color Dilution in Shetland Ponies
by Jocelyn Tanaka, Tosso Leeb, James Rushton, Thomas R. Famula, Maura Mack, Vidhya Jagannathan, Christine Flury, Iris Bachmann, John Eberth, Sue M. McDonnell, Maria Cecilia T. Penedo and Rebecca R. Bellone
Genes 2019, 10(10), 826; https://doi.org/10.3390/genes10100826 - 19 Oct 2019
Cited by 13 | Viewed by 14936
Abstract
Mushroom is a unique coat color phenotype in Shetland Ponies characterized by the dilution of the chestnut coat color to a sepia tone and is hypothesized to be a recessive trait. A genome wide association study (GWAS), utilizing the Affymetrix 670K array (MNEc670k) [...] Read more.
Mushroom is a unique coat color phenotype in Shetland Ponies characterized by the dilution of the chestnut coat color to a sepia tone and is hypothesized to be a recessive trait. A genome wide association study (GWAS), utilizing the Affymetrix 670K array (MNEc670k) and a single locus mixed linear model analysis (EMMAX), identified a locus on ECA7 for further investigation (Pcorrected = 2.08 × 10−10). This locus contained a 3 Mb run of homozygosity in the 12 mushroom ponies tested. Analysis of high throughput Illumina sequencing data from one mushroom Shetland pony compared to 87 genomes from horses of various breeds, uncovered a frameshift variant, p.Asp201fs, in the MFSD12 gene encoding the major facilitator superfamily domain containing 12 protein. This variant was perfectly concordant with phenotype in 96 Shetland Ponies (P = 1.15 × 10−22), was identified in the closely related Miniature Horse for which the mushroom phenotype is suspected to occur (fmu = 0.02), and was absent in 252 individuals from seven additional breeds not reported to have the mushroom phenotype. MFSD12 is highly expressed in melanocytes and variants in this gene in humans, mice, and dogs impact pigmentation. Given the role of MFSD12 in melanogenesis, we propose that p.Asp201fs is causal for the dilution observed in mushroom ponies. Full article
(This article belongs to the Special Issue Equine Genetics)
Show Figures

Figure 1

13 pages, 2233 KiB  
Article
Rare Genetic Variants in Jewish Patients Suffering from Age-Related Macular Degeneration
by Nadav Shoshany, Chen Weiner, Margarita Safir, Adi Einan-Lifshitz, Russell Pokroy, Ayala Kol, Shira Modai, Noam Shomron and Eran Pras
Genes 2019, 10(10), 825; https://doi.org/10.3390/genes10100825 - 18 Oct 2019
Cited by 8 | Viewed by 4242
Abstract
Purpose: To identify rare genetic variants in early age-related macular degeneration (AMD) utilizing whole-exome sequencing (WES). Methods: Eight non-related early-AMD families of different Jewish ethnicities were ascertained. Initial mutation screening (phase-1) included common complement factor-H (CFH) p.Y402H; and age related maculopathy [...] Read more.
Purpose: To identify rare genetic variants in early age-related macular degeneration (AMD) utilizing whole-exome sequencing (WES). Methods: Eight non-related early-AMD families of different Jewish ethnicities were ascertained. Initial mutation screening (phase-1) included common complement factor-H (CFH) p.Y402H; and age related maculopathy susceptibility 2 (ARMS2) p.A69S; and rare variants complement factor-I (CFI) p.V412M; and hemicentin1 (HMCN1) c.4163delC identified previously in our population. Four families, whose initial screening for the aforementioned variants was negative, underwent WES (phase-2). Bioinformatics filtering was based on functionality (from a panel of 234 genes with proven or presumed association to AMD); predicted severity; and frequency (rare variants with minor allele frequency <1%). When applicable, further screening for specific rare variants was carried out on additional cases of similar ethnicities and phenotypes (phase-3). Results: Phase-1 identified three families carrying CFI p.V412M mutation. WES analysis detected probable disease-related variants in three out of the remaining families. These included: a family with a variant in PLEKHA1 gene p.S177N; a family with previously reported variant p.R1210C in CFH gene; and two families with the C3 p.R735W variant. Conclusions: Rare, high-penetrance variants have a profound contribution to early-AMD pathogenesis. Utilization of WES in genetic research of multifactorial diseases as AMD, allows a thorough comprehensive analysis with the identification of previously unreported rare variants. Full article
(This article belongs to the Special Issue Recent Advances in Inherited Eye Disease)
Show Figures

Figure 1

12 pages, 2718 KiB  
Article
Implications of Gene Inheritance Patterns on the Heterosis of Abdominal Fat Deposition in Chickens
by Chunning Mai, Chaoliang Wen, Congjiao Sun, Zhiyuan Xu, Sirui Chen and Ning Yang
Genes 2019, 10(10), 824; https://doi.org/10.3390/genes10100824 - 18 Oct 2019
Cited by 20 | Viewed by 3523
Abstract
Heterosis, a phenomenon characterized by the superior performance of hybrid individuals relative to their parents, has been widely utilized in livestock and crop breeding, while the underlying genetic basis remains elusive in chickens. Here, we performed a reciprocal crossing experiment with broiler and [...] Read more.
Heterosis, a phenomenon characterized by the superior performance of hybrid individuals relative to their parents, has been widely utilized in livestock and crop breeding, while the underlying genetic basis remains elusive in chickens. Here, we performed a reciprocal crossing experiment with broiler and layer chickens and conducted RNA sequencing on liver tissues for reciprocal crosses and their parental lines to identify inheritance patterns of gene expression. Our results showed that heterosis of the abdominal fat percentage was 69.28%–154.71% in reciprocal crosses. Over-dominant genes of reciprocal crosses were significantly enriched in three biological pathways, namely, butanoate metabolism, the synthesis and degradation of ketone bodies, and valine, leucine, and isoleucine degradation. Among these shared over-dominant genes, we found that a lipid-related gene, HMGCL, was enriched in these pathways. Furthermore, we validated this gene as over-dominant using qRT-PCR. Although no shared significant pathway was detected in the high-parent dominant genes of reciprocal crosses, high-parent dominant gene expression was the major gene inheritance pattern in reciprocal crosses and we could not exclude the effect of high-parent dominant genes. These findings suggest that non-additive genes play important roles in the heterosis of important traits in chickens and have important implications regarding our understanding of heterosis. Full article
(This article belongs to the Section Animal Genetics and Genomics)
Show Figures

Figure 1

16 pages, 5039 KiB  
Article
Dissecting the Genome-Wide Evolution and Function of R2R3-MYB Transcription Factor Family in Rosa chinensis
by Yu Han, Jiayao Yu, Tao Zhao, Tangren Cheng, Jia Wang, Weiru Yang, Huitang Pan and Qixiang Zhang
Genes 2019, 10(10), 823; https://doi.org/10.3390/genes10100823 - 18 Oct 2019
Cited by 27 | Viewed by 4592
Abstract
Rosa chinensis, an important ancestor species of Rosa hybrida, the most popular ornamental plant species worldwide, produces flowers with diverse colors and fragrances. The R2R3-MYB transcription factor family controls a wide variety of plant-specific metabolic processes, especially phenylpropanoid metabolism. Despite their [...] Read more.
Rosa chinensis, an important ancestor species of Rosa hybrida, the most popular ornamental plant species worldwide, produces flowers with diverse colors and fragrances. The R2R3-MYB transcription factor family controls a wide variety of plant-specific metabolic processes, especially phenylpropanoid metabolism. Despite their importance for the ornamental value of flowers, the evolution of R2R3-MYB genes in plants has not been comprehensively characterized. In this study, 121 predicted R2R3-MYB gene sequences were identified in the rose genome. Additionally, a phylogenomic synteny network (synnet) was applied for the R2R3-MYB gene families in 35 complete plant genomes. We also analyzed the R2R3-MYB genes regarding their genomic locations, Ka/Ks ratio, encoded conserved motifs, and spatiotemporal expression. Our results indicated that R2R3-MYBs have multiple synteny clusters. The RcMYB114a gene was included in the Rosaceae-specific Cluster 54, with independent evolutionary patterns. On the basis of these results and an analysis of RcMYB114a-overexpressing tobacco leaf samples, we predicted that RcMYB114a functions in the phenylpropanoid pathway. We clarified the relationship between R2R3-MYB gene evolution and function from a new perspective. Our study data may be relevant for elucidating the regulation of floral metabolism in roses at the transcript level. Full article
(This article belongs to the Section Plant Genetics and Genomics)
Show Figures

Figure 1

13 pages, 2014 KiB  
Article
Genetic Diversity Assessed by Genotyping by Sequencing (GBS) in Watermelon Germplasm
by Kyung Jun Lee, Jung-Ro Lee, Raveendar Sebastin, Myoung-Jae Shin, Seong-Hoon Kim, Gyu-Taek Cho and Do Yoon Hyun
Genes 2019, 10(10), 822; https://doi.org/10.3390/genes10100822 - 18 Oct 2019
Cited by 12 | Viewed by 5645
Abstract
Watermelon is an economically important vegetable fruit worldwide. The objective of this study was to conduct a genetic diversity of 68 watermelon accessions using single nucleotide polymorphisms (SNPs). Genotyping by sequencing (GBS) was used to discover SNPs and assess genetic diversity and population [...] Read more.
Watermelon is an economically important vegetable fruit worldwide. The objective of this study was to conduct a genetic diversity of 68 watermelon accessions using single nucleotide polymorphisms (SNPs). Genotyping by sequencing (GBS) was used to discover SNPs and assess genetic diversity and population structure using STRUCTURE and discriminant analysis of principal components (DAPC) in watermelon accessions. Two groups of watermelons were used: 1) highly utilized 41 watermelon accessions at the National Agrobiodiversity Center (NAC) at the Rural Development Administration in South Korea; and 2) 27 Korean commercial watermelons. Results revealed the presence of four clusters within the populations differentiated principally based on seed companies. In addition, there was higher genetic differentiation among commercial watermelons of each company. It is hypothesized that the results obtained from this study would contribute towards the expansion of this crop as well as providing data about genetic diversity, which would be useful for the preservation of genetic resources or for future breeding programs. Full article
(This article belongs to the Section Population and Evolutionary Genetics and Genomics)
Show Figures

Figure 1

10 pages, 434 KiB  
Article
Non-Coding RNA Sequencing of Equine Endometrium During Maternal Recognition of Pregnancy
by Kristin M. Klohonatz, Stephen J. Coleman, Ashley D. Cameron, Ann M. Hess, Kailee J. Reed, Angela Canovas, Juan F. Medrano, Alma D. Islas-Trejo, Ted Kalbfleisch, Gerrit J. Bouma and Jason E. Bruemmer
Genes 2019, 10(10), 821; https://doi.org/10.3390/genes10100821 - 18 Oct 2019
Cited by 8 | Viewed by 3365
Abstract
Maternal recognition of pregnancy (MRP) in the mare is not well defined. In a non-pregnant mare, prostaglandin F (PGF) is released on day 14 post-ovulation (PO) to cause luteal regression, resulting in loss of progesterone production. Equine MRP occurs prior to day [...] Read more.
Maternal recognition of pregnancy (MRP) in the mare is not well defined. In a non-pregnant mare, prostaglandin F (PGF) is released on day 14 post-ovulation (PO) to cause luteal regression, resulting in loss of progesterone production. Equine MRP occurs prior to day 14 to halt PGF production. Studies have failed to identify a gene candidate for MRP, so attention has turned to small, non-coding RNAs. The objective of this study was to evaluate small RNA (<200 nucleotides) content in endometrium during MRP. Mares were used in a cross-over design with each having a pregnant and non-mated cycle. Each mare was randomly assigned to collection day 11 or 13 PO (n = 3/day) and endometrial biopsies were obtained. Total RNA was isolated and sequencing libraries were prepared using a small RNA library preparation kit and sequenced on a HiSeq 2000. EquCab3 was used as the reference genome and DESeq2 was used for statistical analysis. On day 11, 419 ncRNAs, representing miRNA, snRNA, snoRNA, scaRNA, and vaultRNA, were different between pregnancy statuses, but none on day 13. Equine endometrial ncRNAs with unknown structure and function were also identified. This study is the first to describe ncRNA transcriptome in equine endometrium. Identifying targets of these ncRNAs could lead to determining MRP. Full article
(This article belongs to the Special Issue Equine Genetics)
Show Figures

Figure 1

13 pages, 1314 KiB  
Article
The Complete Mitogenome of Pyrrhocoris tibialis (Hemiptera: Pyrrhocoridae) and Phylogenetic Implications
by Qi-Lin Zhang, Run-Qiu Feng, Min Li, Zhong-Long Guo, Li-Jun Zhang, Fang-Zhen Luo, Ya Cao and Ming-Long Yuan
Genes 2019, 10(10), 820; https://doi.org/10.3390/genes10100820 - 18 Oct 2019
Cited by 12 | Viewed by 3384
Abstract
We determined the complete mitogenome of Pyrrhocoris tibialis (Hemiptera: Heteroptera: Pyrrhocoridae) to better understand the diversity and phylogeny within Pentatomomorpha, which is the second largest infra-order of Heteroptera. Gene content, gene arrangement, nucleotide composition, codon usage, ribosomal RNA (rRNA) structures, and sequences of [...] Read more.
We determined the complete mitogenome of Pyrrhocoris tibialis (Hemiptera: Heteroptera: Pyrrhocoridae) to better understand the diversity and phylogeny within Pentatomomorpha, which is the second largest infra-order of Heteroptera. Gene content, gene arrangement, nucleotide composition, codon usage, ribosomal RNA (rRNA) structures, and sequences of the mitochondrial transcription termination factor were well conserved in Pyrrhocoroidea. Different protein-coding genes have been subject to different evolutionary rates correlated with the G + C content. The size of control regions (CRs) was highly variable among mitogenomes of three sequenced Pyrrhocoroidea species, with the P. tibialis CR being the largest. All the transfer RNA genes found in Pyrrhocoroidea had the typical clover leaf secondary structure, except for trnS1 (AGN), which lacked the dihydrouridine arm and possessed an unusual anticodon stem (9 bp vs. the normal 5 bp). A total of three different phylogenetic relationships among the five super-families of Pentatomomorpha were obtained using three analytical methods (MrBayes and RAxML under site-homogeneous models and PhyloBayes under a site-heterogeneous CAT + GTR model) and two mitogenomic datasets (nucleotides and amino acids). The tree topology test using seven methods statistically supported a phylogeny of (Aradoidea + (Pentatomoidea + (Lygaeoidea + (Pyrrhocoroidea + Coreoidea)))) as the best topology, as recognized by both RAxML and MrBayes based on the two datasets. Full article
(This article belongs to the Special Issue Arthropod Genetics and Genomics)
Show Figures

Figure 1

2 pages, 2220 KiB  
Erratum
Erratum: The MAPKKK CgMck1 Is Required for Cell Wall Integrity, Appressorium Development, and Pathogenicity in Colletotrichum gloeosporioides (Genes 2018, 9, 543)
by Yu-Lan Fang, Li-Ming Xia, Ping Wang, Li-Hua Zhu, Jian-Ren Ye and Lin Huang
Genes 2019, 10(10), 819; https://doi.org/10.3390/genes10100819 - 17 Oct 2019
Cited by 3 | Viewed by 2194
Abstract
The authors wish to make the following correction to this paper [...] Full article
(This article belongs to the Section Microbial Genetics and Genomics)
17 pages, 3708 KiB  
Article
Morphological Characterization of Flower Buds Development and Related Gene Expression Profiling at Bud Break Stage in Heterodichogamous Cyclocarya paliurus (Batal.) lljinskaja
by Xiaoling Chen, Xia Mao, Peng Huang and Shengzuo Fang
Genes 2019, 10(10), 818; https://doi.org/10.3390/genes10100818 - 17 Oct 2019
Cited by 25 | Viewed by 6339
Abstract
Cyclocarya paliurus (Batal.) Iljinskaja, a unique species growing in southern China, is a multi-function tree species with medicinal, healthcare, material, and ornamental values. So far, sexual reproduction is the main method for extensive cultivation of C. paliurus plantations, but this is limited by [...] Read more.
Cyclocarya paliurus (Batal.) Iljinskaja, a unique species growing in southern China, is a multi-function tree species with medicinal, healthcare, material, and ornamental values. So far, sexual reproduction is the main method for extensive cultivation of C. paliurus plantations, but this is limited by low seed plumpness resulted from the character of heterodichogamy. Phenological observations have revealed the asynchronism of flower development in this species. However, its molecular mechanism remains largely unknown. To reveal molecular mechanism of heterodichogamy in C. paliurus, transcriptome of female (F) and male (M) buds from two mating types (protandry, PA; protogyny, PG) at bud break stage were sequenced using Illumina Hiseq 4000 platform. The expression patterns of both 32 genes related to flowering and 58 differentially expressed transcription factors (DETFs) selected from 6 families were divided four groups (PG-F, PG-M, PA-F, and PA-M) into two categories: first flowers (PG-F and PA-M) and later flowers (PA-F and PG-M). The results indicated that genes related to plant hormones (IAA, ABA, and GA) synthesis and response, glucose metabolism, and transcription factors (especially in MIKC family) played significant roles in regulating asynchronism of male and female flowers in the same mating type. The expression of DETFs showed two patterns. One contained DETFs up-regulated in first flowers in comparison to later flowers, and the other was the reverse. Nine genes related to flowering were selected for qRT-PCR to confirm the accuracy of RNA-seq, and generally, the RPKM values of these genes were consistent with the result of qRT-PCR. The results of this work could improve our understanding in asynchronism of floral development within one mating type in C. paliurus at transcriptional level, as well as lay a foundation for further study in heterodichogamous plants. Full article
(This article belongs to the Section Plant Genetics and Genomics)
Show Figures

Figure 1

19 pages, 2549 KiB  
Article
Detection of Microaneurysms in Fundus Images Based on an Attention Mechanism
by Lizong Zhang, Shuxin Feng, Guiduo Duan, Ying Li and Guisong Liu
Genes 2019, 10(10), 817; https://doi.org/10.3390/genes10100817 - 17 Oct 2019
Cited by 29 | Viewed by 3944
Abstract
Microaneurysms (MAs) are the earliest detectable diabetic retinopathy (DR) lesions. Thus, the ability to automatically detect MAs is critical for the early diagnosis of DR. However, achieving the accurate and reliable detection of MAs remains a significant challenge due to the size and [...] Read more.
Microaneurysms (MAs) are the earliest detectable diabetic retinopathy (DR) lesions. Thus, the ability to automatically detect MAs is critical for the early diagnosis of DR. However, achieving the accurate and reliable detection of MAs remains a significant challenge due to the size and complexity of retinal fundus images. Therefore, this paper presents a novel MA detection method based on a deep neural network with a multilayer attention mechanism for retinal fundus images. First, a series of equalization operations are performed to improve the quality of the fundus images. Then, based on the attention mechanism, multiple feature layers with obvious target features are fused to achieve preliminary MA detection. Finally, the spatial relationships between MAs and blood vessels are utilized to perform a secondary screening of the preliminary test results to obtain the final MA detection results. We evaluated the method on the IDRiD_VOC dataset, which was collected from the open IDRiD dataset. The results show that our method effectively improves the average accuracy and sensitivity of MA detection. Full article
Show Figures

Figure 1

4 pages, 203 KiB  
Brief Report
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses
by Victor N. Rivas, Monica Aleman, Janel A. Peterson, Anna R. Dahlgren, Erin N. Hales and Carrie J. Finno
Genes 2019, 10(10), 816; https://doi.org/10.3390/genes10100816 - 16 Oct 2019
Cited by 5 | Viewed by 2967
Abstract
Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, [...] Read more.
Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed. Full article
(This article belongs to the Special Issue Equine Genetics)
44 pages, 2871 KiB  
Review
Ubiquitin Ligases Involved in the Regulation of Wnt, TGF-β, and Notch Signaling Pathways and Their Roles in Mouse Development and Homeostasis
by Nikol Baloghova, Tomas Lidak and Lukas Cermak
Genes 2019, 10(10), 815; https://doi.org/10.3390/genes10100815 - 16 Oct 2019
Cited by 22 | Viewed by 8798
Abstract
The Wnt, TGF-β, and Notch signaling pathways are essential for the regulation of cellular polarity, differentiation, proliferation, and migration. Differential activation and mutual crosstalk of these pathways during animal development are crucial instructive forces in the initiation of the body axis and the [...] Read more.
The Wnt, TGF-β, and Notch signaling pathways are essential for the regulation of cellular polarity, differentiation, proliferation, and migration. Differential activation and mutual crosstalk of these pathways during animal development are crucial instructive forces in the initiation of the body axis and the development of organs and tissues. Due to the ability to initiate cell proliferation, these pathways are vulnerable to somatic mutations selectively producing cells, which ultimately slip through cellular and organismal checkpoints and develop into cancer. The architecture of the Wnt, TGF-β, and Notch signaling pathways is simple. The transmembrane receptor, activated by the extracellular stimulus, induces nuclear translocation of the transcription factor, which subsequently changes the expression of target genes. Nevertheless, these pathways are regulated by a myriad of factors involved in various feedback mechanisms or crosstalk. The most prominent group of regulators is the ubiquitin–proteasome system (UPS). To open the door to UPS-based therapeutic manipulations, a thorough understanding of these regulations at a molecular level and rigorous confirmation in vivo are required. In this quest, mouse models are exceptional and, thanks to the progress in genetic engineering, also an accessible tool. Here, we reviewed the current understanding of how the UPS regulates the Wnt, TGF-β, and Notch pathways and we summarized the knowledge gained from related mouse models. Full article
(This article belongs to the Special Issue Animal Modeling in Cancer)
Show Figures

Figure 1

2 pages, 158 KiB  
Editorial
Genomics of Avian Viral Infections
by Jacqueline Smith
Genes 2019, 10(10), 814; https://doi.org/10.3390/genes10100814 - 15 Oct 2019
Cited by 5 | Viewed by 2856
Abstract
The poultry industry currently accounts for the production of around 118 million metric tons of meat and around 74 million metric tons of eggs annually. As the global population continues to increase, so does our reliance on poultry as a food source. It [...] Read more.
The poultry industry currently accounts for the production of around 118 million metric tons of meat and around 74 million metric tons of eggs annually. As the global population continues to increase, so does our reliance on poultry as a food source. It is therefore of vital importance that we safeguard this valuable resource and make the industry as economically competitive as possible. Avian viral infections, however, continue to cost the poultry industry billions of dollars annually. This can be in terms of vaccination costs, loss of birds and decreased production. With a view to improving the health and welfare of commercial birds and to minimizing associated economic losses, it is therefore of great importance that we try to understand the genetic mechanisms underlying host susceptibility and resilience to some of the major viral pathogens that threaten the poultry species. Some avian viruses, through their zoonotic potential, also pose a risk to human health. This Special Issue will present papers that describe our current knowledge on host responses to various viral pathogens, the genetics underlying those responses and how genomics can begin to provide a solution for resolving the threat posed by these infections. Full article
(This article belongs to the Special Issue Genomics of Avian Viral Infections)
13 pages, 249 KiB  
Review
Experimental Modeling of Myeloproliferative Neoplasms
by Lucie Lanikova, Olga Babosova and Josef T. Prchal
Genes 2019, 10(10), 813; https://doi.org/10.3390/genes10100813 - 15 Oct 2019
Cited by 13 | Viewed by 4962
Abstract
Myeloproliferative neoplasms (MPN) are genetically very complex and heterogeneous diseases in which the acquisition of a somatic driver mutation triggers three main myeloid cytokine receptors, and phenotypically expresses as polycythemia vera (PV), essential thrombocytosis (ET), and primary myelofibrosis (PMF). The course of the [...] Read more.
Myeloproliferative neoplasms (MPN) are genetically very complex and heterogeneous diseases in which the acquisition of a somatic driver mutation triggers three main myeloid cytokine receptors, and phenotypically expresses as polycythemia vera (PV), essential thrombocytosis (ET), and primary myelofibrosis (PMF). The course of the diseases may be influenced by germline predispositions, modifying mutations, their order of acquisition and environmental factors such as aging and inflammation. Deciphering these contributory elements, their mutual interrelationships, and their contribution to MPN pathogenesis brings important insights into the diseases. Animal models (mainly mouse and zebrafish) have already significantly contributed to understanding the role of several acquired and germline mutations in MPN oncogenic signaling. Novel technologies such as induced pluripotent stem cells (iPSCs) and precise genome editing (using CRISPR/Cas9) contribute to the emerging understanding of MPN pathogenesis and clonal architecture, and form a convenient platform for evaluating drug efficacy. In this overview, the genetic landscape of MPN is briefly described, with an attempt to cover the main discoveries of the last 15 years. Mouse and zebrafish models of the driver mutations are discussed and followed by a review of recent progress in modeling MPN with patient-derived iPSCs and CRISPR/Cas9 gene editing. Full article
(This article belongs to the Special Issue Animal Modeling in Cancer)
10 pages, 2903 KiB  
Article
Identification of Key Genes for the Precise Classification between Solenopsis invicta and S. geminata Facilitating the Quarantine Process
by Kil-Hyun Kim, Ji-Su Kim, Hyun-Ji Cho, Jong-Ho Lee, Tae-Hwan Jun and Yang Jae Kang
Genes 2019, 10(10), 812; https://doi.org/10.3390/genes10100812 - 15 Oct 2019
Cited by 3 | Viewed by 4395
Abstract
One of the 100 worst invasive exotic species, Solenopsis invicta (red imported fire ant), has the possibility to induce an allergic reaction that may eventually cause death from its aggressive stinging. In 2017, S. invicta was found at a container yard in Gamman [...] Read more.
One of the 100 worst invasive exotic species, Solenopsis invicta (red imported fire ant), has the possibility to induce an allergic reaction that may eventually cause death from its aggressive stinging. In 2017, S. invicta was found at a container yard in Gamman Port, Busan, South Korea for the first time. It may result in an infestation of fire ants in the Korean environment. After this incident, sensitive quarantine procedures are required to detect possible contamination of fire ants in imported containers. However, currently, fire ant identification relies on phenotypic characteristics. This requires highly trained experts for identification and there are not enough to cover all imported containers. Here, we develop a key molecular marker to distinguish S. invicta from others using the whole genome sequence (WGS) of collected S. invicta from Gamman Port and NCBI-deposited WGS data of S.invicta and S. geminata. The consolidated genotypes of Solenopsis genus successfully indicate the distinguishable gene. The gel-based experimental validation confirmed expected classification and the developed cleaved amplified polymorphic sequences (CAPS) marker also gave a consistent result. Using the CAPS marker derived from our consolidated genotypes, the samples collected from containers in several ports can be easily tested by PCR in a few hours. The quick and easy test would increase not only the labor efficiency but also the environmental safety from fire ants. Full article
Show Figures

Figure 1

28 pages, 2970 KiB  
Review
Comprehensive Insight into Gibberellin- and Jasmonate-Mediated Stamen Development
by Katarzyna Marciniak and Krzysztof Przedniczek
Genes 2019, 10(10), 811; https://doi.org/10.3390/genes10100811 - 15 Oct 2019
Cited by 45 | Viewed by 9183
Abstract
In flowering plants, proper development of male generative organs is required for successful sexual reproduction. Stamen primordia arise in the third whorl of floral organs and subsequently differentiate into filaments and anthers. The early phase of stamen development, in which meiosis occurs, is [...] Read more.
In flowering plants, proper development of male generative organs is required for successful sexual reproduction. Stamen primordia arise in the third whorl of floral organs and subsequently differentiate into filaments and anthers. The early phase of stamen development, in which meiosis occurs, is followed by a late developmental phase, which consists of filament elongation coordinated with pollen maturation, anther dehiscence and finally viable pollen grain release. Stamen development and function are modulated by phytohormones, with a key role of gibberellins (GAs) and jasmonates (JAs). Long-term, extensive investigations, mainly involving GA/JA-deficient and GA/JA-response mutants, have led to a better understanding of the hormone-dependent molecular mechanisms of stamen development. In several species, the principal functions of GAs are to stimulate filament elongation through increased cell elongation and to promote anther locule opening. In the GA-dependent regulation of early stamen development, both the tapetum and developing pollen were identified as major targets. JAs mainly control the late stages of stamen development, such as filament elongation, viable pollen formation and anther dehiscence. A hierarchical relationship between GAs and JAs was recognized mainly in the control of late stamen development. By repressing DELLA proteins, GAs modulate the transcriptional activity of JA biosynthesis genes to promote JA production. A high level of JAs induces a complex of transcription factors crucial for normal stamen development. Full article
Show Figures

Figure 1

2 pages, 355 KiB  
Correction
Correction: Berner, D. Allele Frequency Difference AFD—An Intuitive Alternative to FST for Quantifying Genetic Population Differentiation. Genes 2019, 10, 308
by Daniel Berner
Genes 2019, 10(10), 810; https://doi.org/10.3390/genes10100810 - 14 Oct 2019
Cited by 4 | Viewed by 2532
Abstract
This note is to correct an error in my paper, concerning the Shannon differentiation metric (DShannon) (Reference [43] in the paper) [...] Full article
Show Figures

Figure 1

13 pages, 1518 KiB  
Article
Overexpression of OsPT8 Increases Auxin Content and Enhances Tolerance to High-Temperature Stress in Nicotiana tabacum
by Zhaopeng Song, Ningbo Fan, Guizhen Jiao, Minghong Liu, Xiaoyan Wang and Hongfang Jia
Genes 2019, 10(10), 809; https://doi.org/10.3390/genes10100809 - 14 Oct 2019
Cited by 18 | Viewed by 4175
Abstract
Temperature is a primary factor affecting the rate of plant development; as the climate warms, extreme temperature events are likely to increasingly affect agriculture. Understanding how to improve crop tolerance to heat stress is a key concern. Wild plants have evolved numerous strategies [...] Read more.
Temperature is a primary factor affecting the rate of plant development; as the climate warms, extreme temperature events are likely to increasingly affect agriculture. Understanding how to improve crop tolerance to heat stress is a key concern. Wild plants have evolved numerous strategies to tolerate environmental conditions, notably the regulation of root architecture by phytohormones, but the molecular mechanisms of stress resistance are unclear. In this study, we showed that high temperatures could significantly reduce tobacco biomass and change its root architecture, probably through changes in auxin content and distribution. Overexpression of the OsPT8 phosphate transporter enhanced tobacco tolerance to high-temperature stress by changing the root architecture and increased the antioxidant ability. Molecular assays suggested that overexpression of OsPT8 in tobacco significantly increased the expression of auxin synthesis genes NtYUCCA 6, 8 and auxin efflux carriers genes NtPIN 1,2 under high-temperature stress. We also found that the expression levels of auxin response factors NtARF1 and NtARF2 were increased in OsPT8 transgenic tobacco under high-temperature stress, suggesting that OsPT8 regulates auxin signaling in response to high-temperature conditions. Our findings provided new insights into the molecular mechanisms of plant stress signaling and showed that OsPT8 plays a key role in regulating plant tolerance to stress conditions. Full article
(This article belongs to the Special Issue Abiotic Stress in Plants: Current Challenges and Perspectives)
Show Figures

Figure 1

13 pages, 3679 KiB  
Article
Spatial Transcriptomic and miRNA Analyses Revealed Genes Involved in the Mesometrial-Biased Implantation in Pigs
by Ji Huang, Yifen Yang, Miao Tian, Dadong Deng and Mei Yu
Genes 2019, 10(10), 808; https://doi.org/10.3390/genes10100808 - 14 Oct 2019
Cited by 16 | Viewed by 3228
Abstract
Implantation failure is a major cause of early embryonic loss. Normally, the conceptus attachment is initiated at mesometrial side of the uterus and then spread to the anti-mesometrial side in pigs, however, the mechanisms that direct the mesometrial-biased attachment are largely unknown. In [...] Read more.
Implantation failure is a major cause of early embryonic loss. Normally, the conceptus attachment is initiated at mesometrial side of the uterus and then spread to the anti-mesometrial side in pigs, however, the mechanisms that direct the mesometrial-biased attachment are largely unknown. In this study, the histological features of the entire uterine cross-section from gestational days 12 (pre-attachment stage) and 15 (post-attachment stage) were investigated and the differences in histological features between the mesometrial and anti-mesometrial side of the uterus were observed. Then, transcriptomic and miRNA analyses were performed on mesometrial and anti-mesometrial endometrium obtained from gestational days 12 and 15, respectively. Differentially expressed genes (DEGs) and miRNAs (DE-miRs) that were common to both or unique to either of the two anatomical locations of uterus were identified, respectively, indicating that differences in molecular response to the implanting conceptus exist between the two anatomical locations. In addition, we detected DEGs and DE-miRs between the two anatomical locations on the two gestational days, respectively. Of these DEGs, a number of genes, such as chemokine and T cell surface marker genes, were found to be significantly up-regulated mesometrially. Furthermore, we detected the interaction of CXCR4, CXCL11 and miR-9 using dual luciferase reporter assay. Taken together, this study revealed genes and pathways that might play the role of creating a receptive microenvironment at the mesometrial side, which is required to guide a proper positioning of conceptus in the uterus in pigs. Full article
(This article belongs to the Section Animal Genetics and Genomics)
Show Figures

Figure 1

16 pages, 5527 KiB  
Article
D-GPM: A Deep Learning Method for Gene Promoter Methylation Inference
by Xingxin Pan, Biao Liu, Xingzhao Wen, Yulu Liu, Xiuqing Zhang, Shengbin Li and Shuaicheng Li
Genes 2019, 10(10), 807; https://doi.org/10.3390/genes10100807 - 14 Oct 2019
Cited by 10 | Viewed by 3304
Abstract
Whole-genome bisulfite sequencing generates a comprehensive profiling of the gene methylation levels, but is limited by a high cost. Recent studies have partitioned the genes into landmark genes and target genes and suggested that the landmark gene expression levels capture adequate information to [...] Read more.
Whole-genome bisulfite sequencing generates a comprehensive profiling of the gene methylation levels, but is limited by a high cost. Recent studies have partitioned the genes into landmark genes and target genes and suggested that the landmark gene expression levels capture adequate information to reconstruct the target gene expression levels. This inspired us to propose that the methylation level of the promoters in landmark genes might be adequate to reconstruct the promoter methylation level of target genes, which would eventually reduce the cost of promoter methylation profiling. Here, we propose a deep learning model called Deep-Gene Promoter Methylation (D-GPM) to predict the whole-genome promoter methylation level based on the promoter methylation profile of the landmark genes from The Cancer Genome Atlas (TCGA). D-GPM-15%-7000 × 5, the optimal architecture of D-GPM, acquires the least overall mean absolute error (MAE) and the highest overall Pearson correlation coefficient (PCC), with values of 0.0329 and 0.8186, respectively, when testing data. Additionally, the D-GPM outperforms the regression tree (RT), linear regression (LR), and the support vector machine (SVM) in 95.66%, 92.65%, and 85.49% of the target genes by virtue of its relatively lower MAE and in 98.25%, 91.00%, and 81.56% of the target genes based on its relatively higher PCC, respectively. More importantly, the D-GPM predominates in predicting 79.86% and 78.34% of the target genes according to the model distribution of the least MAE and the highest PCC, respectively. Full article
(This article belongs to the Section Technologies and Resources for Genetics)
Show Figures

Figure 1

9 pages, 898 KiB  
Article
A TAC3 Missense Variant in a Domestic Shorthair Cat with Testicular Hypoplasia and Persistent Primary Dentition
by Petra Hug, Patricia Kern, Vidhya Jagannathan and Tosso Leeb
Genes 2019, 10(10), 806; https://doi.org/10.3390/genes10100806 - 14 Oct 2019
Cited by 3 | Viewed by 4148
Abstract
A single male domestic shorthair cat that did not complete puberty was reported. At four years of age, it still had primary dentition, testicular hypoplasia, and was relatively small for its age. We hypothesized that the phenotype might have been due to an [...] Read more.
A single male domestic shorthair cat that did not complete puberty was reported. At four years of age, it still had primary dentition, testicular hypoplasia, and was relatively small for its age. We hypothesized that the phenotype might have been due to an inherited form of hypogonadotropic hypogonadism (HH). We sequenced the genome of the affected cat and compared the data to 38 genomes from control cats. A search for private variants in 40 candidate genes associated with human HH revealed a single protein-changing variant in the affected cat. It was located in the TAC3 gene encoding tachykinin 3, a precursor protein of the signaling molecule neurokinin B, which is known to play a role in sexual development. TAC3 variants have been reported in human patients with HH. The identified feline variant, TAC3:c.220G>A or p.(Val74Met), affects a moderately conserved region of the precursor protein, 11 residues away from the mature neurokinin B sequence. The affected cat was homozygous for the mutant allele. In a cohort of 171 randomly sampled cats, 169 were homozygous for the wildtype allele and 2 were heterozygous. These data tentatively suggest that the identified TAC3 variant might have caused the suppression of puberty in the affected cat. Full article
(This article belongs to the Special Issue Genomics of Sexual Development and Reproduction in Mammals)
Show Figures

Figure 1

14 pages, 2278 KiB  
Article
Upregulated microRNA-106a Promotes Porcine Preadipocyte Proliferation and Differentiation by Targeting Different Genes
by Kuilong Huang, Xin’e Shi, Jie Wang, Ying Yao, Ying Peng, Xiaochang Chen, Xiao Li and Gongshe Yang
Genes 2019, 10(10), 805; https://doi.org/10.3390/genes10100805 - 14 Oct 2019
Cited by 13 | Viewed by 3395
Abstract
Adipose tissue is one of the main organs for the energy storage and supply of organisms. Adipose deposition and metabolism are controlled by a cascade of transcription factors and epigenetic regulatory mechanisms. Previous studies have also shown that miR-106a plays a considerable role [...] Read more.
Adipose tissue is one of the main organs for the energy storage and supply of organisms. Adipose deposition and metabolism are controlled by a cascade of transcription factors and epigenetic regulatory mechanisms. Previous studies have also shown that miR-106a plays a considerable role in the development of organisms. The regulatory mechanism of miR-106a on porcine preadipocytes is still not clear. In this study, preadipocytes were isolated from the neck subcutaneous deposits of 3–5-day old Chinese native Guanzhong black pigs using 5-ethynyl-20-deoxyuridine (EdU) staining and a CCK-8 assay to detect the number of proliferous cells and real-time qPCR (RT-qPCR) and western blot analysis to detect gene expression, as well as Oil Red O and BODIPY staining dye lipid droplets and flow cytometry (FCM) to detect cell cycles. We also used the double luciferase method to detect the relative luciferase activities. Upregulated miR-106a increased the number of proliferous cells and enhanced the expression of cell proliferation-related genes in porcine adipocytes. The double luciferase reporter vector confirmed that p21 was a target gene of miR-106a in the cell proliferation phase. miR-106a upregulation increased the number of lipid droplets and the expression of lipogenic genes and directly targeted BMP and activin membrane-bound inhibitor (BAMBI) in the process of differentiation. Our results indicated that miR-106a promotes porcine preadipocyte proliferation and differentiation by targeting p21 and BAMBI. Full article
(This article belongs to the Section Animal Genetics and Genomics)
Show Figures

Figure 1

Previous Issue
Next Issue
Back to TopTop