Equine Genetics

A Special Issue of Genes (ISSN 2073-4425) belonging to the section "Animal Genetics and Genomics".

Deadline for manuscript submissions: closed (30 September 2019) | Viewed by 147360

Editors


E-Mail Website
Guest Editor
Department of Animal Breeding and Genetics, Swedish University of Agricultural Sciences, 750 07 Uppsala, Sweden
Interests: equine genetics; disease genetics; physical performance; breeding

E-Mail Website
Guest Editor
Department of Veterinary population Medicine, College of Veterinary Medicine, University of Minnesota
Interests: equine genetics; snp; ligament rupture; horse

Special Issue Information

Dear Colleagues,

Horses show a remarkable phenotypic variation both between and within breeds. As flight animals and grazers, the wild ancestors of modern horses were naturally selected for speed and for the ability to traverse long distances. Since the onset of domestication, horses have been strongly selected for speed, strength, and endurance-exercise traits. The development of specific horse breeds has resulted in selection for athletic phenotypes that enable the use of horses for riding, racing, and recreation, with clear differences in morphology and behavior. Today, approximately 400 distinct horse breeds are recognized. However, the breed formation process has also enriched different horse breeds for disease mutations, and sometimes these mutations are breed specific. Disease mutations in horses offer the advantages of spontaneous disease models.

The overall goal for the equine genomics research community is to take advantage of this extensive phenotypic diversity in order to improve the health and welfare of horses. During the last 20 years or more, equine geneticists have successfully revealed molecular variants underlying meaningful equine health, appearance (e.g. size, coat colour), and performance traits. The results from many of these studies demonstrate how the study of unique phenotypes in domestic animals, such as horses, can lead to novel fundamental insights and can also help to decipher the mechanisms underlying the biological and disease processes of relevance for other species.

The development of more advanced genomic tools continues to accelerate variant mapping in equines, and traits of a complex nature can more efficiently be dissected. Deeper information on the structure and function of  the equine genome generated by advanced functional annotation (transcriptomic and epigenetic levels) and cross-species sequence comparisons fascilitate insights into processes of genome function, selection, and adaptation, as well as evolution. Studying equine domestication and important genetic variants in fossil trajectories can provide unique insights into our own history. This Special Issue on equine genetics aims to present some of the latest advances in evolution and genome-to-phenome research in a non-model species of both medical and agricultural interest.

Dr. Gabriella Lindgren
Dr. Molly McCue
Guest Editors

Manuscript Submission Information

Manuscripts should be submitted online at www.mdpi.com by registering and logging in to this website. Once you are registered, click here to go to the submission form. Manuscripts can be submitted until the deadline. All submissions that pass pre-check are peer-reviewed. Accepted papers will be published continuously in the journal (as soon as accepted) and will be listed together on the special issue website. Research articles, review articles as well as short communications are invited. For planned papers, a title and short abstract (about 250 words) can be sent to the Editorial Office for assessment.

Submitted manuscripts should not have been published previously, nor be under consideration for publication elsewhere (except conference proceedings papers). All manuscripts are thoroughly refereed through a single-anonymized peer-review process. A guide for authors and other relevant information for submission of manuscripts is available on the Instructions for Authors page. Genes is an international peer-reviewed open access monthly journal published by MDPI.

Please visit the Instructions for Authors page before submitting a manuscript. The Article Processing Charge (APC) for publication in this open access journal is 2600 CHF (Swiss Francs). Submitted papers should be well formatted and use good English. Authors may use MDPI's English editing service prior to publication or during author revisions.

Keywords

  • genome-to-phenome
  • exercise traits
  • morphologic traits
  • equine genetics
  • domestic horse
  • disease mechanisms

Benefits of Publishing in a Special Issue

  • Ease of navigation: Grouping papers by topic helps scholars navigate broad scope journals more efficiently.
  • Greater discoverability: Special Issues support the reach and impact of scientific research. Articles in Special Issues are more discoverable and cited more frequently.
  • Expansion of research network: Special Issues facilitate connections among authors, fostering scientific collaborations.
  • External promotion: Articles in Special Issues are often promoted through the journal's social media, increasing their visibility.
  • Reprint: MDPI Books provides the opportunity to republish successful Special Issues in book format, both online and in print.

Further information on MDPI's Special Issue policies can be found here.

Published Papers (23 papers)

Order results
Result details
Select all
Export citation of selected articles as:

Research

Jump to: Other

13 pages, 7464 KB  
Article
Genome-Wide Association Study and Subsequent Exclusion of ATCAY as a Candidate Gene Involved in Equine Neuroaxonal Dystrophy Using Two Animal Models
by Erin N Hales, Christina Esparza, Sichong Peng, Anna R Dahlgren, Janel M Peterson, Andrew D Miller and Carrie J Finno
Genes 2020, 11(1), 82; https://doi.org/10.3390/genes11010082 - 10 Jan 2020
Cited by 5 | Viewed by 4301
Abstract
Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder of unknown etiology. Clinical signs of neurological deficits develop within the first year of life in vitamin E (vitE) deficient horses. A genome-wide association study (GWAS) was carried out using 670,000 SNP [...] Read more.
Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder of unknown etiology. Clinical signs of neurological deficits develop within the first year of life in vitamin E (vitE) deficient horses. A genome-wide association study (GWAS) was carried out using 670,000 SNP markers in 27 case and 42 control Quarter Horses. Two markers, encompassing a 2.5 Mb region on ECA7, were associated with the phenotype (p = 2.05 × 10-7 and 4.72 × 10-6). Within this region, caytaxin (ATCAY) was identified as a candidate gene due to its known role in Cayman Ataxia and ataxic/dystonic phenotypes in mouse models. Whole-genome sequence data in four eNAD/EDM and five unaffected horses identified 199 associated variants within the ECA7 region. MassARRAY® genotyping was performed on these variants within the GWAS population. The three variants within ATCAY were not concordant with the disease phenotype. No difference in expression or alternative splicing was identified using qRT-PCR in brainstem across the ATCAY transcript. Atcayji-hes mice were then used to conduct functional analysis in a second animal model. Histologic lesions were not identified in the central nervous system of Atcayji-hes mice. Additionally, supplementation of homozygous Atcayji-hes mice with 600 IU/day of dl-α-tocopheryl acetate (vitE) during gestation, lactation, and adulthood did not improve the phenotype. ATCAY has therefore been excluded as a candidate gene for eNAD/EDM. Full article
(This article belongs to the Special Issue Equine Genetics)
Show Figures

Figure 1

10 pages, 1511 KB  
Article
The First Report of Genetic and Structural Diversities in the SPRN Gene in the Horse, an Animal Resistant to Prion Disease
by Sae-Young Won, Yong-Chan Kim, Seon-Kwan Kim and Byung-Hoon Jeong
Genes 2020, 11(1), 39; https://doi.org/10.3390/genes11010039 - 28 Dec 2019
Cited by 14 | Viewed by 4016
Abstract
Prion diseases are fatal neurodegenerative diseases and are characterized by the accumulation of abnormal prion protein (PrPSc) in the brain. During the outbreak of the bovine spongiform encephalopathy (BSE) epidemic in the United Kingdom, prion diseases in several species were reported; [...] Read more.
Prion diseases are fatal neurodegenerative diseases and are characterized by the accumulation of abnormal prion protein (PrPSc) in the brain. During the outbreak of the bovine spongiform encephalopathy (BSE) epidemic in the United Kingdom, prion diseases in several species were reported; however, horse prion disease has not been reported thus far. In previous studies, the shadow of prion protein (Sho) has contributed to an acceleration of conversion from normal prion protein (PrPC) to PrPSc, and the shadow of prion protein gene (SPRN) polymorphisms have been significantly associated with the susceptibility of prion diseases. We investigated the genotype, allele and haplotype frequencies of the SPRN gene using direct sequencing. In addition, we analyzed linkage disequilibrium (LD) and haplotypes among polymorphisms. We also investigated LD between PRNP and SPRN single nucleotide polymorphisms (SNPs). We compared the amino acid sequences of Sho protein between the horse and several prion disease-susceptible species using ClustalW2. To perform Sho protein modeling, we utilized SWISS-MODEL and Swiss-PdbViewer programs. We found a total of four polymorphisms in the equine SPRN gene; however, we did not observe an in/del polymorphism, which is correlated with the susceptibility of prion disease in prion disease-susceptible animals. The SPRN SNPs showed weak LD value with PRNP SNP. In addition, we found 12 horse-specific amino acids of Sho protein that can induce significantly distributional differences in the secondary structure and hydrogen bonds between the horse and several prion disease-susceptible species. To the best of our knowledge, this is the first report regarding the genetic and structural characteristics of the equine SPRN gene. Full article
(This article belongs to the Special Issue Equine Genetics)
Show Figures

Figure 1

22 pages, 3597 KB  
Article
Functionally Annotating Regulatory Elements in the Equine Genome Using Histone Mark ChIP-Seq
by N. B. Kingsley, Colin Kern, Catherine Creppe, Erin N. Hales, Huaijun Zhou, T. S. Kalbfleisch, James N. MacLeod, Jessica L. Petersen, Carrie J. Finno and Rebecca R. Bellone
Genes 2020, 11(1), 3; https://doi.org/10.3390/genes11010003 - 18 Dec 2019
Cited by 30 | Viewed by 7183
Abstract
One of the primary aims of the Functional Annotation of ANimal Genomes (FAANG) initiative is to characterize tissue-specific regulation within animal genomes. To this end, we used chromatin immunoprecipitation followed by sequencing (ChIP-Seq) to map four histone modifications (H3K4me1, H3K4me3, H3K27ac, and H3K27me3) [...] Read more.
One of the primary aims of the Functional Annotation of ANimal Genomes (FAANG) initiative is to characterize tissue-specific regulation within animal genomes. To this end, we used chromatin immunoprecipitation followed by sequencing (ChIP-Seq) to map four histone modifications (H3K4me1, H3K4me3, H3K27ac, and H3K27me3) in eight prioritized tissues collected as part of the FAANG equine biobank from two thoroughbred mares. Data were generated according to optimized experimental parameters developed during quality control testing. To ensure that we obtained sufficient ChIP and successful peak-calling, data and peak-calls were assessed using six quality metrics, replicate comparisons, and site-specific evaluations. Tissue specificity was explored by identifying binding motifs within unique active regions, and motifs were further characterized by gene ontology (GO) and protein–protein interaction analyses. The histone marks identified in this study represent some of the first resources for tissue-specific regulation within the equine genome. As such, these publicly available annotation data can be used to advance equine studies investigating health, performance, reproduction, and other traits of economic interest in the horse. Full article
(This article belongs to the Special Issue Equine Genetics)
Show Figures

Figure 1

20 pages, 2898 KB  
Article
Genomic Divergence in Swedish Warmblood Horses Selected for Equestrian Disciplines
by Michela Ablondi, Susanne Eriksson, Sasha Tetu, Alberto Sabbioni, Åsa Viklund and Sofia Mikko
Genes 2019, 10(12), 976; https://doi.org/10.3390/genes10120976 - 27 Nov 2019
Cited by 19 | Viewed by 6697
Abstract
The equestrian sport horse Swedish Warmblood (SWB) originates from versatile cavalry horses. Most modern SWB breeders have specialized their breeding either towards show jumping or dressage disciplines. The aim of this study was to explore the genomic structure of SWB horses to evaluate [...] Read more.
The equestrian sport horse Swedish Warmblood (SWB) originates from versatile cavalry horses. Most modern SWB breeders have specialized their breeding either towards show jumping or dressage disciplines. The aim of this study was to explore the genomic structure of SWB horses to evaluate the presence of genomic subpopulations, and to search for signatures of selection in subgroups of SWB with high or low breeding values (EBVs) for show jumping. We analyzed high density genotype information from 380 SWB horses born in the period 2010–2011, and used Principal Coordinates Analysis and Discriminant Analysis of Principal Components to detect population stratification. Fixation index and Cross Population Extended Haplotype Homozygosity scores were used to scan the genome for potential signatures of selection. In accordance with current breeding practice, this study highlights the development of two separate breed subpopulations with putative signatures of selection in eleven chromosomes. These regions involve genes with known function in, e.g., mentality, endogenous reward system, development of connective tissues and muscles, motor control, body growth and development. This study shows genetic divergence, due to specialization towards different disciplines in SWB horses. This latter evidence can be of interest for SWB and other horse studbooks encountering specialized breeding. Full article
(This article belongs to the Special Issue Equine Genetics)
Show Figures

Figure 1

23 pages, 1602 KB  
Article
Genome-Wide Association Analyses of Equine Metabolic Syndrome Phenotypes in Welsh Ponies and Morgan Horses
by Elaine Norton, Nichol Schultz, Ray Geor, Dianne McFarlane, James Mickelson and Molly McCue
Genes 2019, 10(11), 893; https://doi.org/10.3390/genes10110893 - 6 Nov 2019
Cited by 12 | Viewed by 4638
Abstract
Equine metabolic syndrome (EMS) is a complex trait for which few genetic studies have been published. Our study objectives were to perform within breed genome-wide association analyses (GWA) to identify associated loci in two high-risk breeds, coupled with meta-analysis to identify shared and [...] Read more.
Equine metabolic syndrome (EMS) is a complex trait for which few genetic studies have been published. Our study objectives were to perform within breed genome-wide association analyses (GWA) to identify associated loci in two high-risk breeds, coupled with meta-analysis to identify shared and unique loci between breeds. GWA for 12 EMS traits identified 303 and 142 associated genomic regions in 264 Welsh ponies and 286 Morgan horses, respectively. Meta-analysis demonstrated that 65 GWA regions were shared across breeds. Region boundaries were defined based on a fixed-size or the breakdown of linkage disequilibrium, and prioritized if they were: shared between breeds or across traits (high priority), identified in a single GWA cohort (medium priority), or shared across traits with no SNPs reaching genome-wide significance (low priority), resulting in 56 high, 26 medium, and seven low priority regions including 1853 candidate genes in the Welsh ponies; and 39 high, eight medium, and nine low priority regions including 1167 candidate genes in the Morgans. The prioritized regions contained protein-coding genes which were functionally enriched for pathways associated with inflammation, glucose metabolism, or lipid metabolism. These data demonstrate that EMS is a polygenic trait with breed-specific risk alleles as well as those shared across breeds. Full article
(This article belongs to the Special Issue Equine Genetics)
Show Figures

Figure 1

19 pages, 1900 KB  
Article
A Mechanogenetic Model of Exercise-Induced Pulmonary Haemorrhage in the Thoroughbred Horse
by Sarah Blott, Hannah Cunningham, Laurène Malkowski, Alexandra Brown and Cyril Rauch
Genes 2019, 10(11), 880; https://doi.org/10.3390/genes10110880 - 1 Nov 2019
Cited by 9 | Viewed by 4550
Abstract
Exercise-induced pulmonary haemorrhage (EIPH) occurs in horses performing high-intensity athletic activity. The application of physics principles to derive a ‘physical model’, which is coherent with existing physiology and cell biology data, shows that critical parameters for capillary rupture are cell–cell adhesion and cell [...] Read more.
Exercise-induced pulmonary haemorrhage (EIPH) occurs in horses performing high-intensity athletic activity. The application of physics principles to derive a ‘physical model’, which is coherent with existing physiology and cell biology data, shows that critical parameters for capillary rupture are cell–cell adhesion and cell stiffness (cytoskeleton organisation). Specifically, length of fracture in the capillary is a ratio between the energy involved in cell–cell adhesion and the stiffness of cells suggesting that if the adhesion diminishes and/or that the stiffness of cells increases EIPH is more likely to occur. To identify genes associated with relevant cellular or physiological phenotypes, the physical model was used in a post-genome-wide association study (GWAS) to define gene sets associated with the model parameters. The primary study was a GWAS of EIPH where the phenotype was based on weekly tracheal wash samples collected over a two-year period from 72 horses in a flat race training yard. The EIPH phenotype was determined from cytological analysis of the tracheal wash samples, by scoring for the presence of red blood cells and haemosiderophages. Genotyping was performed using the Illumina Equine SNP50 BeadChip and analysed using linear regression in PLINK. Genes within significant genome regions were selected for sets based on their GeneOntology biological process, and analysed using fastBAT. The gene set analysis showed that genes associated with cell stiffness (cytoskeleton organisation) and blood flow have the most significant impact on EIPH risk. Full article
(This article belongs to the Special Issue Equine Genetics)
Show Figures

Figure 1

15 pages, 2364 KB  
Article
Frameshift Variant in MFSD12 Explains the Mushroom Coat Color Dilution in Shetland Ponies
by Jocelyn Tanaka, Tosso Leeb, James Rushton, Thomas R. Famula, Maura Mack, Vidhya Jagannathan, Christine Flury, Iris Bachmann, John Eberth, Sue M. McDonnell, Maria Cecilia T. Penedo and Rebecca R. Bellone
Genes 2019, 10(10), 826; https://doi.org/10.3390/genes10100826 - 19 Oct 2019
Cited by 14 | Viewed by 17572
Abstract
Mushroom is a unique coat color phenotype in Shetland Ponies characterized by the dilution of the chestnut coat color to a sepia tone and is hypothesized to be a recessive trait. A genome wide association study (GWAS), utilizing the Affymetrix 670K array (MNEc670k) [...] Read more.
Mushroom is a unique coat color phenotype in Shetland Ponies characterized by the dilution of the chestnut coat color to a sepia tone and is hypothesized to be a recessive trait. A genome wide association study (GWAS), utilizing the Affymetrix 670K array (MNEc670k) and a single locus mixed linear model analysis (EMMAX), identified a locus on ECA7 for further investigation (Pcorrected = 2.08 × 10−10). This locus contained a 3 Mb run of homozygosity in the 12 mushroom ponies tested. Analysis of high throughput Illumina sequencing data from one mushroom Shetland pony compared to 87 genomes from horses of various breeds, uncovered a frameshift variant, p.Asp201fs, in the MFSD12 gene encoding the major facilitator superfamily domain containing 12 protein. This variant was perfectly concordant with phenotype in 96 Shetland Ponies (P = 1.15 × 10−22), was identified in the closely related Miniature Horse for which the mushroom phenotype is suspected to occur (fmu = 0.02), and was absent in 252 individuals from seven additional breeds not reported to have the mushroom phenotype. MFSD12 is highly expressed in melanocytes and variants in this gene in humans, mice, and dogs impact pigmentation. Given the role of MFSD12 in melanogenesis, we propose that p.Asp201fs is causal for the dilution observed in mushroom ponies. Full article
(This article belongs to the Special Issue Equine Genetics)
Show Figures

Figure 1

10 pages, 434 KB  
Article
Non-Coding RNA Sequencing of Equine Endometrium During Maternal Recognition of Pregnancy
by Kristin M. Klohonatz, Stephen J. Coleman, Ashley D. Cameron, Ann M. Hess, Kailee J. Reed, Angela Canovas, Juan F. Medrano, Alma D. Islas-Trejo, Ted Kalbfleisch, Gerrit J. Bouma and Jason E. Bruemmer
Genes 2019, 10(10), 821; https://doi.org/10.3390/genes10100821 - 18 Oct 2019
Cited by 8 | Viewed by 4005
Abstract
Maternal recognition of pregnancy (MRP) in the mare is not well defined. In a non-pregnant mare, prostaglandin F (PGF) is released on day 14 post-ovulation (PO) to cause luteal regression, resulting in loss of progesterone production. Equine MRP occurs prior to day [...] Read more.
Maternal recognition of pregnancy (MRP) in the mare is not well defined. In a non-pregnant mare, prostaglandin F (PGF) is released on day 14 post-ovulation (PO) to cause luteal regression, resulting in loss of progesterone production. Equine MRP occurs prior to day 14 to halt PGF production. Studies have failed to identify a gene candidate for MRP, so attention has turned to small, non-coding RNAs. The objective of this study was to evaluate small RNA (<200 nucleotides) content in endometrium during MRP. Mares were used in a cross-over design with each having a pregnant and non-mated cycle. Each mare was randomly assigned to collection day 11 or 13 PO (n = 3/day) and endometrial biopsies were obtained. Total RNA was isolated and sequencing libraries were prepared using a small RNA library preparation kit and sequenced on a HiSeq 2000. EquCab3 was used as the reference genome and DESeq2 was used for statistical analysis. On day 11, 419 ncRNAs, representing miRNA, snRNA, snoRNA, scaRNA, and vaultRNA, were different between pregnancy statuses, but none on day 13. Equine endometrial ncRNAs with unknown structure and function were also identified. This study is the first to describe ncRNA transcriptome in equine endometrium. Identifying targets of these ncRNAs could lead to determining MRP. Full article
(This article belongs to the Special Issue Equine Genetics)
Show Figures

Figure 1

14 pages, 2209 KB  
Article
Coding RNA Sequencing of Equine Endometrium during Maternal Recognition of Pregnancy
by Kristin M. Klohonatz, Stephen J. Coleman, Alma D. Islas-Trejo, Juan F. Medrano, Ann M. Hess, Ted Kalbfleisch, Milton G. Thomas, Gerrit J. Bouma and Jason E. Bruemmer
Genes 2019, 10(10), 749; https://doi.org/10.3390/genes10100749 - 25 Sep 2019
Cited by 17 | Viewed by 3710
Abstract
Equine maternal recognition of pregnancy (MRP) is a process whose signal remains unknown. During MRP the conceptus and endometrium communicate to attenuate prostaglandin F (PGF) secretion, sparing the corpus luteum and maintaining progesterone production. Recognition of a mobile conceptus by the endometrium [...] Read more.
Equine maternal recognition of pregnancy (MRP) is a process whose signal remains unknown. During MRP the conceptus and endometrium communicate to attenuate prostaglandin F (PGF) secretion, sparing the corpus luteum and maintaining progesterone production. Recognition of a mobile conceptus by the endometrium is critical by days 14–16 post-ovulation (PO), when endometrium produces PGF, initiating luteolysis. The objective of this study was to evaluate endometrial gene expression changes based upon pregnancy status via RNA sequencing. This experiment utilized a cross-over design with each mare serving as both a pregnant and non-mated control on days nine, 11, and 13 PO (n = 3/status/day). Mares were randomly assigned to collection day and pregnancy confirmed by terminal uterine lavage at the time of endometrial biopsy. Total RNA was isolated and libraries prepared using Illumina TruSeq RNA sample preparation kit. Reads were mapped and annotated using HISAT2 and Stringtie. Expression values were evaluated with DESEQ2 (P ≤ 0.05 indicated significance). On day nine, 11, and 13 there were 1435, 1435 and 916 significant transcripts, respectively. Multiple genes with splice variants had different expression patterns within the same day. These are the first data to evaluate the endometrial transcriptome during MRP on days nine, 11, and 13. Full article
(This article belongs to the Special Issue Equine Genetics)
Show Figures

Figure 1

23 pages, 947 KB  
Article
Differential Gene Expression in Articular Cartilage and Subchondral Bone of Neonatal and Adult Horses
by Ann M. Kemper, Jenny Drnevich, Molly E. McCue and Annette M. McCoy
Genes 2019, 10(10), 745; https://doi.org/10.3390/genes10100745 - 25 Sep 2019
Cited by 7 | Viewed by 3610
Abstract
Skeletogenesis is complex and incompletely understood. Derangement of this process likely underlies developmental skeletal pathologies. Examination of tissue-specific gene expression may help elucidate novel skeletal developmental pathways that could contribute to disease risk. Our aim was to identify and functionally annotate differentially expressed [...] Read more.
Skeletogenesis is complex and incompletely understood. Derangement of this process likely underlies developmental skeletal pathologies. Examination of tissue-specific gene expression may help elucidate novel skeletal developmental pathways that could contribute to disease risk. Our aim was to identify and functionally annotate differentially expressed genes in equine neonatal and adult articular cartilage (AC) and subchondral bone (SCB). RNA was sequenced from healthy AC and SCB from the fetlock, hock, and stifle joints of 6 foals (≤4 weeks of age) and six adults (8–12 years of age). There was distinct clustering by age and tissue type. After differential expression analysis, functional annotation and pathway analysis were performed using PANTHER and Reactome. Approximately 1115 and 3574 genes were differentially expressed between age groups in AC and SCB, respectively, falling within dozens of overrepresented gene ontology terms and enriched pathways reflecting a state of growth, high metabolic activity, and tissue turnover in the foals. Enriched pathways were dominated by those related to extracellular matrix organization and turnover, and cell cycle and signal transduction. Additionally, we identified enriched pathways related to neural development and neurotransmission in AC and innate immunity in SCB. These represent novel potential mechanisms for disease that can be explored in future work. Full article
(This article belongs to the Special Issue Equine Genetics)
Show Figures

Graphical abstract

16 pages, 1963 KB  
Article
Origin and Evolution of Deleterious Mutations in Horses
by Ludovic Orlando and Pablo Librado
Genes 2019, 10(9), 649; https://doi.org/10.3390/genes10090649 - 28 Aug 2019
Cited by 40 | Viewed by 9536
Abstract
Domestication has changed the natural evolutionary trajectory of horses by favoring the reproduction of a limited number of animals showing traits of interest. Reduced breeding stocks hampered the elimination of deleterious variants by means of negative selection, ultimately inflating mutational loads. However, ancient [...] Read more.
Domestication has changed the natural evolutionary trajectory of horses by favoring the reproduction of a limited number of animals showing traits of interest. Reduced breeding stocks hampered the elimination of deleterious variants by means of negative selection, ultimately inflating mutational loads. However, ancient genomics revealed that mutational loads remained steady during most of the domestication history until a sudden burst took place some 250 years ago. To identify the factors underlying this trajectory, we gather an extensive dataset consisting of 175 modern and 153 ancient genomes previously published, and carry out the most comprehensive characterization of deleterious mutations in horses. We confirm that deleterious variants segregated at low frequencies during the last 3500 years, and only spread and incremented their occurrence in the homozygous state during modern times, owing to inbreeding. This independently happened in multiple breeds, following both the development of closed studs and purebred lines, and the deprecation of horsepower in the 20th century, which brought many draft breeds close to extinction. Our work illustrates the paradoxical effect of some conservation and improvement programs, which reduced the overall genomic fitness and viability. Full article
(This article belongs to the Special Issue Equine Genetics)
Show Figures

Figure 1

15 pages, 2664 KB  
Article
Population Genetic Analysis of the Estonian Native Horse Suggests Diverse and Distinct Genetics, Ancient Origin and Contribution from Unique Patrilines
by Caitlin Castaneda, Rytis Juras, Anas Khanshour, Ingrid Randlaht, Barbara Wallner, Doris Rigler, Gabriella Lindgren, Terje Raudsepp and E. Gus Cothran
Genes 2019, 10(8), 629; https://doi.org/10.3390/genes10080629 - 20 Aug 2019
Cited by 18 | Viewed by 7263
Abstract
The Estonian Native Horse (ENH) is a medium-size pony found mainly in the western islands of Estonia and is well-adapted to the harsh northern climate and poor pastures. The ancestry of the ENH is debated, including alleged claims about direct descendance from the [...] Read more.
The Estonian Native Horse (ENH) is a medium-size pony found mainly in the western islands of Estonia and is well-adapted to the harsh northern climate and poor pastures. The ancestry of the ENH is debated, including alleged claims about direct descendance from the extinct Tarpan. Here we conducted a detailed analysis of the genetic makeup and relationships of the ENH based on the genotypes of 15 autosomal short tandem repeats (STRs), 18 Y chromosomal single nucleotide polymorphisms (SNPs), mitochondrial D-loop sequence and lateral gait allele in DMRT3. The study encompassed 2890 horses of 61 breeds, including 33 ENHs. We show that the expected and observed genetic diversities of the ENH are among the highest within 52 global breeds, and the highest among 8 related Northern European ponies. The genetically closest breeds to the ENH are the Finn Horse, and the geographically more distant primitive Hucul and Konik. ENH matrilines are diverse and relate to draught and Pontic-Caspian breeds. ENH patrilines relate to draught breeds, and to a unique haplogroup not described before. None of the 33 ENHs carried the “gait” mutation, but the mutation was found in 2 Huculs. The study demonstrates that the ENH is a genetically distinct and diverse breed of ancient origin with no notable pressure of selective breeding. Full article
(This article belongs to the Special Issue Equine Genetics)
Show Figures

Figure 1

30 pages, 3096 KB  
Article
Genomic Regions Associated with IgE Levels against Culicoides spp. Antigens in Three Horse Breeds
by Liesbeth François, Hanne Hoskens, Brandon D. Velie, Anneleen Stinckens, Susanne Tinel, Chris Lamberigts, Liesbet Peeters, Huub F. J. Savelkoul, Edwin Tijhaar, Gabriella Lindgren, Steven Janssens, Bart J. Ducro, Nadine Buys and Anouk Schurink
Genes 2019, 10(8), 597; https://doi.org/10.3390/genes10080597 - 8 Aug 2019
Cited by 8 | Viewed by 4286
Abstract
Insect bite hypersensitivity (IBH), which is a cutaneous allergic reaction to antigens from Culicoides spp., is the most prevalent skin disorder in horses. Misdiagnosis is possible, as IBH is usually diagnosed based on clinical signs. Our study is the first to employ IgE [...] Read more.
Insect bite hypersensitivity (IBH), which is a cutaneous allergic reaction to antigens from Culicoides spp., is the most prevalent skin disorder in horses. Misdiagnosis is possible, as IBH is usually diagnosed based on clinical signs. Our study is the first to employ IgE levels against several recombinant Culicoides spp. allergens as an objective, independent, and quantitative phenotype to improve the power to detect genetic variants that underlie IBH. Genotypes of 200 Shetland ponies, 127 Icelandic horses, and 223 Belgian Warmblood horses were analyzed while using a mixed model approach. No single-nucleotide polymorphism (SNP) passed the Bonferroni corrected significance threshold, but several regions were identified within and across breeds, which confirmed previously identified regions of interest and, in addition, identifying new regions of interest. Allergen-specific IgE levels are a continuous and objective phenotype that allow for more powerful analyses when compared to a case-control set-up, as more significant associations were obtained. However, the use of a higher density array seems necessary to fully employ the use of IgE levels as a phenotype. While these results still require validation in a large independent dataset, the use of allergen-specific IgE levels showed value as an objective and continuous phenotype that can deepen our understanding of the biology underlying IBH. Full article
(This article belongs to the Special Issue Equine Genetics)
Show Figures

Figure 1

17 pages, 2507 KB  
Article
A High Protein Model Alters the Endometrial Transcriptome of Mares
by Yatta L. Boakari, Hossam El-Sheikh Ali, Pouya Dini, Shavahn Loux, Claudia B. Fernandes, Kirsten Scoggin, Alejandro Esteller-Vico, Laurie Lawrence and Barry Ball
Genes 2019, 10(8), 576; https://doi.org/10.3390/genes10080576 - 30 Jul 2019
Cited by 9 | Viewed by 4498
Abstract
High blood urea nitrogen (BUN) decreases fertility of several mammals; however, the mechanisms have not been investigated in mares. We developed an experimental model to elevate BUN, with urea and control treatments (7 mares/treatment), in a crossover design. Urea-treatment consisted of a loading [...] Read more.
High blood urea nitrogen (BUN) decreases fertility of several mammals; however, the mechanisms have not been investigated in mares. We developed an experimental model to elevate BUN, with urea and control treatments (7 mares/treatment), in a crossover design. Urea-treatment consisted of a loading dose of urea (0.03 g/kg of body weight (BW)) and urea injections over 6 h (0.03 g/kg of BW/h). Control mares received the same volume of saline solution. Blood samples were collected to measure BUN. Uterine and vaginal pH were evaluated after the last intravenous infusion, then endometrial biopsies were collected for RNA-sequencing with a HiSeq 4000. Cuffdiff (2.2.1) was used to identify the differentially expressed genes (DEG) between urea and control groups (false discovery rate-adjusted p-value < 0.1). There was a significant increase in BUN and a decrease of uterine pH in the urea group compared to the control group. A total of 193 genes were DEG between the urea and control groups, with five genes identified as upstream regulators (ETV4, EGF, EHF, IRS2, and SGK1). The DEG were predicted to be related to cell pH, ion homeostasis, changes in epithelial tissue, and solute carriers. Changes in gene expression reveal alterations in endometrial function that could be associated with adverse effects on fertility of mares. Full article
(This article belongs to the Special Issue Equine Genetics)
Show Figures

Figure 1

12 pages, 3490 KB  
Article
Landscape of Overlapping Gene Expression in The Equine Placenta
by Pouya Dini, Jamie Norris, Hossam El-Sheikh Ali, Shavahn C. Loux, Mariano Carossino, Alejandro Esteller-Vico, Ernest Bailey, Theodore Kalbfleisch, Peter Daels and Barry A. Ball
Genes 2019, 10(7), 503; https://doi.org/10.3390/genes10070503 - 2 Jul 2019
Cited by 9 | Viewed by 4001
Abstract
Increasing evidence suggests that overlapping genes are much more common in eukaryotic genomes than previously thought. These different-strand overlapping genes are potential sense–antisense (SAS) pairs, which might have regulatory effects on each other. In the present study, we identified the SAS loci in [...] Read more.
Increasing evidence suggests that overlapping genes are much more common in eukaryotic genomes than previously thought. These different-strand overlapping genes are potential sense–antisense (SAS) pairs, which might have regulatory effects on each other. In the present study, we identified the SAS loci in the equine genome using previously generated stranded, paired-end RNA sequencing data from the equine chorioallantois. We identified a total of 1261 overlapping loci. The ratio of the number of overlapping regions to chromosomal length was numerically higher on chromosome 11 followed by chromosomes 13 and 12. These results show that overlapping transcription is distributed throughout the equine genome, but that distributions differ for each chromosome. Next, we evaluated the expression patterns of SAS pairs during the course of gestation. The sense and antisense genes showed an overall positive correlation between the sense and antisense pairs. We further provide a list of SAS pairs with both positive and negative correlation in their expression patterns throughout gestation. This study characterizes the landscape of sense and antisense gene expression in the placenta for the first time and provides a resource that will enable researchers to elucidate the mechanisms of sense/antisense regulation during pregnancy. Full article
(This article belongs to the Special Issue Equine Genetics)
Show Figures

Figure 1

23 pages, 2801 KB  
Article
Genome-Wide Homozygosity Patterns and Evidence for Selection in a Set of European and Near Eastern Horse Breeds
by Gertrud Grilz-Seger, Markus Neuditschko, Anne Ricard, Brandon Velie, Gabriella Lindgren, Matjaz Mesarič, Marko Cotman, Michaela Horna, Max Dobretsberger, Gottfried Brem and Thomas Druml
Genes 2019, 10(7), 491; https://doi.org/10.3390/genes10070491 - 28 Jun 2019
Cited by 56 | Viewed by 8270
Abstract
Intensive artificial and natural selection have shaped substantial variation among European horse breeds. Whereas most equine selection signature studies employ divergent genetic population structures in order to derive specific inter-breed targets of selection, we screened a total of 1476 horses originating from 12 [...] Read more.
Intensive artificial and natural selection have shaped substantial variation among European horse breeds. Whereas most equine selection signature studies employ divergent genetic population structures in order to derive specific inter-breed targets of selection, we screened a total of 1476 horses originating from 12 breeds for the loss of genetic diversity by runs of homozygosity (ROH) utilizing a 670,000 single nucleotide polymorphism (SNP) genotyping array. Overlapping homozygous regions (ROH islands) indicating signatures of selection were identified by breed and similarities/dissimilarities between populations were evaluated. In the entire dataset, 180 ROH islands were identified, whilst 100 islands were breed specific, all other overlapped in 36 genomic regions with at least one ROH island of another breed. Furthermore, two ROH hot spots were determined at horse chromosome 3 (ECA3) and ECA11. Besides the confirmation of previously documented target genes involved in selection for coat color (MC1R, STX17, ASIP), body size (LCORL/NCAPG, ZFAT, LASP1, HMGA2), racing ability (PPARGC1A), behavioral traits (GRIN2B, NTM/OPCML) and gait patterns (DMRT3), several putative target genes related to embryonic morphogenesis (HOXB), energy metabolism (IGFBP-1, IGFBP-3), hair follicle morphogenesis (KRT25, KRT27, INTU) and autophagy (RALB) were highlighted. Furthermore, genes were pinpointed which might be involved in environmental adaptation of specific habitats (UVSSA, STXBP4, COX11, HLF, MMD). Full article
(This article belongs to the Special Issue Equine Genetics)
Show Figures

Figure 1

27 pages, 7206 KB  
Article
The Genomic Makeup of Nine Horse Populations Sampled in the Netherlands
by Anouk Schurink, Merina Shrestha, Susanne Eriksson, Mirte Bosse, Henk Bovenhuis, Willem Back, Anna M. Johansson and Bart J. Ducro
Genes 2019, 10(6), 480; https://doi.org/10.3390/genes10060480 - 25 Jun 2019
Cited by 24 | Viewed by 9635
Abstract
The spectrum of modern horse populations encompasses populations with a long history of development in isolation and relatively recently formed types. To increase our understanding of the evolutionary history and provide information on how to optimally conserve or improve these populations with varying [...] Read more.
The spectrum of modern horse populations encompasses populations with a long history of development in isolation and relatively recently formed types. To increase our understanding of the evolutionary history and provide information on how to optimally conserve or improve these populations with varying development and background for the future, we analyzed genotype data of 184 horses from 9 Dutch or common horse populations in the Netherlands: The Belgian draft horse, Friesian horse, Shetland pony, Icelandic horse, Gelder horse, Groninger horse, harness horse, KWPN sport horse and the Lipizzaner horse population. Various parameters were estimated (e.g., runs of homozygosity and FST values) to gain insight into genetic diversity and relationships within and among these populations. The identified genomic makeup and quantified relationships did mostly conform to the development of these populations as well as past and current breeding practices. In general, populations that allow gene-flow showed less inbreeding and homozygosity. Also, recent bottlenecks (e.g., related to high selective pressure) caused a larger contribution of long ROHs to inbreeding. Maintaining genetic diversity through tailor-made breeding practices is crucial for a healthy continuation of the investigated, mostly inbred and (effectively) small sized horse populations, of which several already experience inbreeding related issues. Full article
(This article belongs to the Special Issue Equine Genetics)
Show Figures

Figure 1

17 pages, 6549 KB  
Article
Genome-Wide Association Studies Based on Equine Joint Angle Measurements Reveal New QTL Affecting the Conformation of Horses
by Annik Imogen Gmel, Thomas Druml, Rudolf von Niederhäusern, Tosso Leeb and Markus Neuditschko
Genes 2019, 10(5), 370; https://doi.org/10.3390/genes10050370 - 14 May 2019
Cited by 20 | Viewed by 7763
Abstract
The evaluation of conformation traits is an important part of selection for breeding stallions and mares. Some of these judged conformation traits involve joint angles that are associated with performance, health, and longevity. To improve our understanding of the genetic background of joint [...] Read more.
The evaluation of conformation traits is an important part of selection for breeding stallions and mares. Some of these judged conformation traits involve joint angles that are associated with performance, health, and longevity. To improve our understanding of the genetic background of joint angles in horses, we have objectively measured the angles of the poll, elbow, carpal, fetlock (front and hind), hip, stifle, and hock joints based on one photograph of each of the 300 Franches-Montagnes (FM) and 224 Lipizzan (LIP) horses. After quality control, genome-wide association studies (GWASs) for these traits were performed on 495 horses, using 374,070 genome-wide single nucleotide polymorphisms (SNPs) in a mixed-effect model. We identified two significant quantitative trait loci (QTL) for the poll angle on ECA28 (p = 1.36 × 10−7), 50 kb downstream of the ALX1 gene, involved in cranial morphology, and for the elbow joint on ECA29 (p = 1.69 × 10−7), 49 kb downstream of the RSU1 gene, and 75 kb upstream of the PTER gene. Both genes are associated with bone mineral density in humans. Furthermore, we identified other suggestive QTL associated with the stifle joint on ECA8 (p = 3.10 × 10−7); the poll on ECA1 (p = 6.83 × 10−7); the fetlock joint of the hind limb on ECA27 (p = 5.42 × 10−7); and the carpal joint angle on ECA3 (p = 6.24 × 10−7), ECA4 (p = 6.07 × 10−7), and ECA7 (p = 8.83 × 10−7). The application of angular measurements in genetic studies may increase our understanding of the underlying genetic effects of important traits in equine breeding. Full article
(This article belongs to the Special Issue Equine Genetics)
Show Figures

Figure 1

15 pages, 3374 KB  
Article
Droplet Digital PCR Detection of the Erythropoietin Transgene from Horse Plasma and Urine for Gene-Doping Control
by Teruaki Tozaki, Aoi Ohnuma, Masaki Takasu, Mio Kikuchi, Hironaga Kakoi, Kei-ichi Hirota, Kanichi Kusano and Shun-ichi Nagata
Genes 2019, 10(3), 243; https://doi.org/10.3390/genes10030243 - 21 Mar 2019
Cited by 49 | Viewed by 7683
Abstract
Indiscriminate genetic manipulation to improve athletic ability is a major threat to human sports and the horseracing industry, in which methods involving gene-doping, such as transgenesis, should be prohibited to ensure fairness. Therefore, development of methods to detect indiscriminate genetic manipulation are urgently [...] Read more.
Indiscriminate genetic manipulation to improve athletic ability is a major threat to human sports and the horseracing industry, in which methods involving gene-doping, such as transgenesis, should be prohibited to ensure fairness. Therefore, development of methods to detect indiscriminate genetic manipulation are urgently needed. Here, we developed a highly sensitive method to detect horse erythropoietin (EPO) transgenes using droplet digital PCR (ddPCR). We designed two TaqMan probe/primer sets, and the EPO transgene was cloned into a plasmid for use as a model. We extracted the spiked EPO transgene from horse plasma and urine via magnetic beads, followed by ddPCR amplification for absolute quantification and transgene detection. The results indicated high recovery rates (at least ~60% and ~40% in plasma and urine, respectively), suggesting successful detection of the spiked transgene at concentrations of >130 and 200 copies/mL of plasma and urine, respectively. Additionally, successful detection was achieved following intramuscular injection of 20 mg of the EPO transgene. This represents the first study demonstrating a method for detecting the EPO transgene in horse plasma and urine, with our results demonstrating its efficacy for promoting the control of gene-doping in the horseracing industry. Full article
(This article belongs to the Special Issue Equine Genetics)
Show Figures

Figure 1

27 pages, 19633 KB  
Article
The Origin of a Coastal Indigenous Horse Breed in China Revealed by Genome-Wide SNP Data
by Hongying Ma, Sheng Wang, Guorong Zeng, Jintu Guo, Minghao Guo, Xianggui Dong, Guoying Hua, Yu Liu, Min Wang, Yao Ling, Xiangdong Ding, Chunjiang Zhao and Changxin Wu
Genes 2019, 10(3), 241; https://doi.org/10.3390/genes10030241 - 21 Mar 2019
Cited by 17 | Viewed by 6959
Abstract
The Jinjiang horse is a unique Chinese indigenous horse breed distributed in the southern coastal areas, but the ancestry of Jinjiang horses is not well understood. Here, we used Equine SNP70 Bead Array technology to genotype 301 horses representing 10 Chinese indigenous horse [...] Read more.
The Jinjiang horse is a unique Chinese indigenous horse breed distributed in the southern coastal areas, but the ancestry of Jinjiang horses is not well understood. Here, we used Equine SNP70 Bead Array technology to genotype 301 horses representing 10 Chinese indigenous horse breeds, and we integrated the published genotyped data of 352 individuals from 14 foreign horse breeds to study the relationships between Jinjiang horses and horse breeds from around the world. Principal component analysis (PCA), linkage disequilibrium (LD), runs of homozygosity (ROH) analysis, and ancestry estimating methods were conducted to study the population relationships and the ancestral sources and genetic structure of Jinjiang horses. The results showed that there is no close relationship between foreign horse breeds and Jinjiang horses, and Jinjiang horses shared a similar genetic background with Baise horses. TreeMix analysis revealed that there was gene flow from Chakouyi horses to Jinjiang horses. The ancestry analysis showed that Baise horses and Chakouyi horses are the most closely related ancestors of Jinjiang horses. In conclusion, our results showed that Jinjiang horses have a native origin and that Baise horses and Chakouyi horses were key ancestral sources of Jinjiang horses. The study also suggested that ancient trade activities and the migration of human beings had important effects on indigenous horse breeds in China. Full article
(This article belongs to the Special Issue Equine Genetics)
Show Figures

Figure 1

Other

Jump to: Research

4 pages, 203 KB  
Brief Report
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses
by Victor N. Rivas, Monica Aleman, Janel A. Peterson, Anna R. Dahlgren, Erin N. Hales and Carrie J. Finno
Genes 2019, 10(10), 816; https://doi.org/10.3390/genes10100816 - 16 Oct 2019
Cited by 5 | Viewed by 3420
Abstract
Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, [...] Read more.
Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed. Full article
(This article belongs to the Special Issue Equine Genetics)
5 pages, 458 KB  
Brief Report
Previously Identified Genetic Variants in ADGRL3 Are not Associated with Risk for Equine Degenerative Myeloencephalopathy across Breeds
by Sabin A. Marquardt, Callie V. Wilcox, Erin N. Burns, Janel A. Peterson and Carrie J. Finno
Genes 2019, 10(9), 681; https://doi.org/10.3390/genes10090681 - 5 Sep 2019
Cited by 1 | Viewed by 4631
Abstract
Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurologic disease that has been reported in young horses from a wide range of breeds. The disease is inherited and associated with vitamin E deficiency during the first two years of life, resulting in bilateral [...] Read more.
Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurologic disease that has been reported in young horses from a wide range of breeds. The disease is inherited and associated with vitamin E deficiency during the first two years of life, resulting in bilateral symmetric ataxia. A missense mutation (chr3:71,917,591 C > T) within adhesion G protein-coupled receptor L3 (ADGRL3) was recently associated with risk for EDM in the Caspian breed. In order to confirm these findings, genotyping of this missense mutation, along with the three other associated single nucleotide polymorphisms (SNPs) in the genomic region, was carried out on 31 postmortem-confirmed eNAD/EDM cases and 43 clinically phenotyped controls from various breeds. No significant association was found between eNAD/EDM confirmed cases and genotype at any of the four identified SNPs (P > 0.05), including the nonsynonymous variant (EquCab2.0 chr3:71,917,591; allelic P = 0.85). These findings suggest that the four SNPs, including the missense variant in the ADGRL3 region, are not associated with risk for eNAD/EDM across multiple breeds of horses. Full article
(This article belongs to the Special Issue Equine Genetics)
Show Figures

Figure 1

11 pages, 1591 KB  
Brief Report
Satellite DNA at the Centromere Is Dispensable for Segregation Fidelity
by Annalisa Roberti, Mirella Bensi, Alice Mazzagatti, Francesca M. Piras, Solomon G. Nergadze, Elena Giulotto and Elena Raimondi
Genes 2019, 10(6), 469; https://doi.org/10.3390/genes10060469 - 20 Jun 2019
Cited by 12 | Viewed by 5077
Abstract
The typical vertebrate centromeres contain long stretches of highly repeated DNA sequences (satellite DNA). We previously demonstrated that the karyotypes of the species belonging to the genus Equus are characterized by the presence of satellite-free and satellite-based centromeres and represent a unique biological [...] Read more.
The typical vertebrate centromeres contain long stretches of highly repeated DNA sequences (satellite DNA). We previously demonstrated that the karyotypes of the species belonging to the genus Equus are characterized by the presence of satellite-free and satellite-based centromeres and represent a unique biological model for the study of centromere organization and behavior. Using horse primary fibroblasts cultured in vitro, we compared the segregation fidelity of chromosome 11, whose centromere is satellite-free, with that of chromosome 13, which has similar size and a centromere containing long stretches of satellite DNA. The mitotic stability of the two chromosomes was compared under normal conditions and under mitotic stress induced by the spindle inhibitor, nocodazole. Two independent molecular-cytogenetic approaches were used—the interphase aneuploidy analysis and the cytokinesis-block micronucleus assay. Both assays were coupled to fluorescence in situ hybridization with chromosome specific probes in order to identify chromosome 11 and chromosome 13, respectively. In addition, we tested if the lack of centromeric satellite DNA affected chromatid cohesion under normal and stress conditions. We demonstrated that, in our system, the segregation fidelity of a chromosome is not influenced by the presence of long stretches of tandem repeats at its centromere. To our knowledge, the present study is the first analysis of the mitotic behavior of a natural satellite-free centromere. Full article
(This article belongs to the Special Issue Equine Genetics)
Show Figures

Figure 1

Back to TopTop