Chloroplast Genome Sequence of Artemisia scoparia: Comparative Analyses and Screening of Mutational Hotspots
Abstract
:1. Introduction
2. Results
2.1. Chloroplast Genome Features of A. scoparia
2.2. Codon Usage and Amino Acid Frequency
2.3. RNA Editing Sites
2.4. Comparison of Genus Artemisia Genomes and the Contraction and Expansion of Large Inverted Repeats
2.5. Microsatellite and Oligonucleotide Repeats Analyses
2.6. Types of Substitutions and InDels Events
2.7. Screening of Divergence Regions
2.8. Inferring of Phylogeny in the Genus Artemisia and Family Asteraceae
3. Discussion
4. Materials and Methods
4.1. DNA Extraction and Sequencing
4.2. Genome Assembly and Annotation
4.3. Comparative Analyses and Genomic Features
4.4. Amino Acid Frequency, Codon Usage, and RNA Editing Sites
4.5. Microsatellites and Oligonucleotide Repeats Analyses
4.6. Substitutions and InDel Analyses
4.7. Screening of Divergence Regions
4.8. Phylogeny in the Genus Artemisia and Family Asteraceae
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Pandey, A.K.; Singh, P. The genus Artemisia: A 2012–2017 literature review on chemical composition, antimicrobial, insecticidal and antioxidant activities of essential oils. Medicines 2017, 4, 68. [Google Scholar] [CrossRef]
- Hayat, M.Q.; Khan, M.A.; Ashraf, M.; Jabeen, S. Ethnobotany of the genus Artemisia L. (Asteraceae) in Pakistan. Ethnobot. Res. Appl. 2009, 7, 147–162. [Google Scholar] [CrossRef]
- Valles, J.; Durant-McArthur, E. Artemisia systematics and phylogeny: Cytogenetic and molecular insights. In Proceedings of the Shrubland Ecosystem Genetics and Biodiversity, Provo, UT, USA, 13–15 June 2000; pp. 67–74. [Google Scholar]
- Abad, M.J.; Bedoya, L.M.; Apaza, L.; Bermejo, P. The Artemisia L. genus: A review of bioactive essential oils. Molecules 2012, 17, 2542–2566. [Google Scholar] [CrossRef]
- Sajid, M.; Khan, M.R.; Shah, N.A.; Ullah, S.; Younis, T.; Majid, M.; Ahmad, B.; Nigussie, D. Proficiencies of Artemisia scoparia against CCl 4 induced DNA damages and renal toxicity in rat. BMC Complement. Altern. Med. 2016, 16, 1–10. [Google Scholar] [CrossRef]
- Wang, L.; Si, L.; Li, Y.; Wang, H.; Xu, F.; Bian, H.; Shi, Y.; Huang, H. Study on mechanism and active ingredient of Artemisia scoparia extracts against influenza virus. Lat. Am. J. Pharm. 2017, 36, 1355–1360. [Google Scholar]
- Choi, E.; Park, H.; Lee, J.; Kim, G. Anticancer, antiobesity, and anti-inflammatory activity of Artemisia species in vitro. J. Tradit. Chin. Med. 2013, 33, 92–97. [Google Scholar] [CrossRef]
- Nam, S.Y.; Han, N.R.; Rah, S.Y.; Seo, Y.; Kim, H.M.; Jeong, H.J. Anti-inflammatory effects of Artemisia scoparia and its active constituent, 3,5-dicaffeoyl-epi-quinic acid against activated mast cells. Immunopharmacol. Immunotoxicol. 2018, 40, 52–58. [Google Scholar] [CrossRef]
- Ryu, K.J.; Yoou, M.S.; Seo, Y.; Yoon, K.W.; Kim, H.M.; Jeong, H.J. Therapeutic effects of Artemisia scoparia Waldst. et Kitaib in a murine model of atopic dermatitis. Clin. Exp. Dermatol. 2018, 43, 798–805. [Google Scholar] [CrossRef]
- Afshar, F.H.; Delazar, A.; Janneh, O.; Nazemiyeh, H.; Pasdaran, A.; Nahar, L.; Sarker, S.D. Evaluation of antimalarial, free-radicalscavenging and insecticidal activities of Artemisia scoparia and A. spicigera, Asteraceae. Braz. J. Pharmacogn. 2011, 21, 986–990. [Google Scholar] [CrossRef]
- Baykan Erel, Ş.; Reznicek, G.; Şenol, S.G.; Karabay Yavaşoǧulu, N.Ü.; Konyalioǧlu, S.; Zeybek, A.U. Batı Anadolu Artemisia L. türlerinin antimikrobiyal ve antioksidan özellikleri. Turk. J. Biol. 2012, 36, 75–84. [Google Scholar] [CrossRef]
- Cho, J.Y.; Park, K.H.; Hwang, D.Y.; Chanmuang, S.; Jaiswal, L.; Park, Y.K.; Park, S.Y.; Kim, S.Y.; Kim, H.R.; Moon, J.H.; et al. Antihypertensive effects of Artemisia scoparia Waldst in spontaneously hypertensive rats and identification of angiotensin I converting enzyme inhibitors. Molecules 2015, 20, 19789–19804. [Google Scholar] [CrossRef]
- Richard, A.J.; Fuller, S.; Fedorcenco, V.; Beyl, R.; Burris, T.P.; Mynatt, R.; Ribnicky, D.M.; Stephens, J.M. Artemisia scoparia enhances adipocyte development and endocrine function in vitro and enhances insulin action in vivo. PLoS ONE 2014, 9, e98897. [Google Scholar] [CrossRef]
- Waris, T.S.; Khan, M.R.; Shah, N.A.; Shuaib, M.; Hussain, F.; Ishaq, M.; Kamal, Z.; Zeb, U.; Ali, S.; Ali, K.; et al. Heptoprotective role of Artemisia scoparia Waldst. and kit against CCl 4 -induced toxicity in rats. Pol. J. Environ. Stud. 2018, 27, 1307–1314. [Google Scholar] [CrossRef]
- Boudreau, A.; Richard, A.J.; Burrell, J.A.; King, W.T.; Dunn, R.; Schwarz, J.M.; Ribnicky, D.M.; Rood, J.; Salbaum, J.M.; Stephens, J.M. An ethanolic extract of Artemisia scoparia inhibits lipolysis in vivo and has antilipolytic effects on murine adipocytes in vitro. Am. J. Physiol. Endocrinol. Metab. 2018, 315, E1053–E1061. [Google Scholar] [CrossRef]
- Khan, M.A.; Khan, H.; Tariq, S.A.; Pervez, S. Urease inhibitory activity of aerial parts of Artemisia scoparia: Exploration in an in vitro study. Ulcers 2014, 2014, 1–5. [Google Scholar] [CrossRef]
- Promyo, K.; Cho, J.Y.; Park, K.H.; Jaiswal, L.; Park, S.Y.; Ham, K.S. Artemisia scoparia attenuates amyloid β accumulation and tau hyperphosphorylation in spontaneously hypertensive rats. Food Sci. Biotechnol. 2017, 26, 775–782. [Google Scholar] [CrossRef] [PubMed]
- Khan, A.; Asaf, S.; Khan, A.L.; Al-Harrasi, A.; Al-Sudairy, O.; AbdulKareem, N.M.; Khan, A.; Shehzad, T.; Alsaady, N.; Al-Lawati, A.; et al. First complete chloroplast genomics and comparative phylogenetic analysis of Commiphora gileadensis and C. foliacea: Myrrh producing trees. PLoS ONE 2019, 14, e0208511. [Google Scholar] [CrossRef] [PubMed]
- Palmer, J.D. Comparative organization of chloroplast genomes. Annu. Rev. Genet. 1985, 19, 325–354. [Google Scholar] [CrossRef]
- Oldenburg, D.J.; Bendich, A.J. The linear plastid chromosomes of maize: Terminal sequences, structures, and implications for DNA replication. Curr. Genet. 2016. [Google Scholar] [CrossRef]
- Daniell, H.; Lin, C.-S.; Yu, M.; Chang, W.-J. Chloroplast genomes: Diversity, evolution, and applications in genetic engineering. Genome Biol. 2016, 17, 134. [Google Scholar] [CrossRef]
- Ahmed, I. Evolutionary Dynamics in Taro. Ph.D. Thesis, Massey University, Palmerston North, New Zealand, August 2014. Available online: https://mro.massey.ac.nz/handle/10179/5610 (accessed on 24 June 2019).
- Ahmed, I.; Matthews, P.J.; Biggs, P.J.; Naeem, M.; Mclenachan, P.A.; Lockhart, P.J. Identification of chloroplast genome loci suitable for high-resolution phylogeographic studies of Colocasia esculenta (L.) Schott (Araceae) and closely related taxa. Mol. Ecol. Resour. 2013, 13, 929–937. [Google Scholar] [CrossRef] [PubMed]
- Henriquez, C.L.; Arias, T.; Pires, J.C.; Croat, T.B.; Schaal, B.A. Phylogenomics of the plant family Araceae. Mol. Phylogenet. Evol. 2014, 75, 91–102. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Zhang, Z.; Yang, J.; Lv, G. Complete chloroplast genome of seven Fritillaria species, variable DNA markers identification and phylogenetic relationships within the genus. PLoS ONE 2018, 13. [Google Scholar] [CrossRef] [PubMed]
- Mehmood, F.; Abdullah; Shahzadi, I.; Ahmed, I.; Waheed, M.T.; Mirza, B. Characterization of Withania somnifera chloroplast genome and its comparison with other selected species of Solanaceae. Genomics 2019. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Huo, N.; Dong, L.; Wang, Y.; Zhang, S.; Young, H.A.; Feng, X.; Gu, Y.Q. Complete chloroplast genome sequences of Mongolia medicine Artemisia frigida and phylogenetic relationships with other plants. PLoS One 2013, 8. [Google Scholar] [CrossRef]
- Lössl, A.G.; Waheed, M.T. Chloroplast-derived vaccines against human diseases: Achievements, challenges and scopes. Plant Biotechnol. J. 2011, 9, 527–539. [Google Scholar] [CrossRef]
- Haghighi, A.R.; Belduz, A.O.; Vahed, M.M.; Coskuncelebi, K.; Terzioglu, S. Phylogenetic relationships among Artemisia species based on nuclear ITS and chloroplast psbA-trnH DNA markers. Biologia 2014, 69, 834–839. [Google Scholar] [CrossRef]
- Turuspekov, Y.; Genievskaya, Y.; Baibulatova, A.; Zatybekov, A.; Kotuhov, Y.; Ishmuratova, M.; Imanbayeva, A.; Abugalieva, S. Phylogenetic taxonomy of Artemisia L. species from Kazakhstan based on matK analyses. Proc. Latv. Acad. Sci. Sect. B Nat. Exact Appl. Sci. 2018, 72, 29–37. [Google Scholar] [CrossRef]
- Jiang, D.; Zhao, Z.; Zhang, T.; Zhong, W.; Liu, C.; Yuan, Q.J.; Huang, L. The chloroplast genome sequence of Scutellaria baicalensis provides insight into intraspecific and interspecific chloroplast genome diversity in Scutellaria. Genes 2017, 8, 227. [Google Scholar] [CrossRef]
- Saina, J.K.; Li, Z.Z.; Gichira, A.W.; Liao, Y.Y. The complete chloroplast genome sequence of tree of heaven (Ailanthus altissima (Mill.) (Sapindales: Simaroubaceae), an important pantropical tree. Int. J. Mol. Sci. 2018, 19, 929. [Google Scholar] [CrossRef]
- Park, I.; Yang, S.; Kim, W.; Song, J.-H.; Lee, H.-S.; Lee, H.; Lee, J.-H.; Ahn, S.-N.; Moon, B. Sequencing and comparative analysis of the chloroplast genome of Angelica polymorpha and the development of a novel indel marker for species identification. Molecules 2019, 24, 1038. [Google Scholar] [CrossRef] [PubMed]
- Li, D.-M.; Zhao, C.-Y.; Liu, X.-F. Complete chloroplast genome sequences of Kaempferia Galanga and Kaempferia Elegans: Molecular structures and comparative analysis. Molecules 2019, 24, 474. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Rong, C.; Qin, L.; Mo, C.; Fan, L.; Yan, J.; Zhang, M. Complete chloroplast genome sequence of Malus hupehensis: Genome structure, comparative analysis, and phylogenetic relationships. Molecules 2018, 23, 2917. [Google Scholar] [CrossRef] [PubMed]
- Abdullah; Shahzadi, I.; Mehmood, F.; Ali, Z.; Malik, M.S.; Waseem, S.; Mirza, B.; Ahmed, I.; Waheed, M.T. Comparative analyses of chloroplast genomes among three Firmiana species: Identification of mutational hotspots and phylogenetic relationship with other species of Malvaceae. Plant Gene 2019, 19, 100199. [Google Scholar] [CrossRef]
- Abdullah; Mehmood, F.; Shahzadi, I.; Waseem, S.; Mirza, B.; Ahmed, I.; Waheed, M.T. Chloroplast genome of Hibiscus rosa-sinensis (Malvaceae): Comparative analyses and identification of mutational hotspots. Genomics 2019, 1. [Google Scholar] [CrossRef]
- Menezes, A.P.A.; Resende-Moreira, L.C.; Buzatti, R.S.O.; Nazareno, A.G.; Carlsen, M.; Lobo, F.P.; Kalapothakis, E.; Lovato, M.B. Chloroplast genomes of Byrsonima species (Malpighiaceae): Comparative analysis and screening of high divergence sequences. Sci. Rep. 2018, 8, 1–12. [Google Scholar] [CrossRef]
- Ahmed, I.; Biggs, P.J.; Matthews, P.J.; Collins, L.J.; Hendy, M.D.; Lockhart, P.J. Mutational dynamics of aroid chloroplast genomes. Genome Biol. Evol. 2012, 4, 1316–1323. [Google Scholar] [CrossRef]
- Amiryousefi, A.; Hyvönen, J.; Poczai, P. The chloroplast genome sequence of bittersweet (Solanum dulcamara): Plastid genome structure evolution in Solanaceae. PLoS ONE 2018, 13, e196069. [Google Scholar] [CrossRef]
- Yu, X.; Zuo, L.; Lu, D.; Lu, B.; Yang, M.; Wang, J. Comparative analysis of chloroplast genomes of five Robinia species: Genome comparative and evolution analysis. Gene 2019, 689, 141–151. [Google Scholar] [CrossRef]
- Yu, X.Q.; Drew, B.T.; Yang, J.B.; Gao, L.M.; Li, D.Z. Comparative chloroplast genomes of eleven Schima (Theaceae) species: Insights into DNA barcoding and phylogeny. PLoS ONE 2017, 12, e178026. [Google Scholar] [CrossRef]
- He, L.; Qian, J.; Li, X.; Sun, Z.; Xu, X.; Chen, S.; McPhee, D.J. Complete chloroplast genome of medicinal plant Lonicera japonica: Genome rearrangement, intron gain and loss, and implications for phylogenetic studies. Molecules 2017, 22, 249. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Wang, Y.; He, P.; Li, P.; Lee, J.; Soltis, D.E.; Fu, C. Chloroplast genome analyses and genomic resource development for epilithic sister genera Oresitrophe and Mukdenia (Saxifragaceae), using genome skimming data. BMC Genom. 2018, 19, 235. [Google Scholar] [CrossRef] [PubMed]
- Shahzadi, I.; Abdullah; Mehmood, F.; Ali, Z.; Ahmed, I.; Mirza, B. Chloroplast genome sequences of Artemisia maritima and Artemisia absinthium: Comparative analyses, mutational hotspots in genus Artemisia and phylogeny in family Asteraceae. Genomics 2019. [Google Scholar] [CrossRef]
- Yang, Z.; Huang, Y.; An, W.; Zheng, X.; Huang, S.; Liang, L. Sequencing and structural analysis of the complete chloroplast genome of the medicinal plant Lycium Chinense Mill. Plants 2019, 8, 87. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; Yang, Z.; Huang, S.; An, W.; Li, J.; Zheng, X. Comprehensive analysis of Rhodomyrtus tomentosa chloroplast genome. Plants 2019, 8, 89. [Google Scholar] [CrossRef] [PubMed]
- Cui, Y.; Nie, L.; Sun, W.; Xu, Z.; Wang, Y.; Yu, J.; Song, J.; Yao, H. Comparative and phylogenetic analyses of ginger (Zingiber officinale) in the family Zingiberaceae based on the complete chloroplast genome. Plants 2019, 8, 283. [Google Scholar] [CrossRef]
- Poczai, P.; Hyvönen, J. The complete chloroplast genome sequence of the CAM epiphyte Spanish moss (Tillandsia usneoides, Bromeliaceae) and its comparative analysis. PLoS ONE 2017, 12, e187199. [Google Scholar] [CrossRef]
- Keller, J.; Rousseau-Gueutin, M.; Martin, G.E.; Morice, J.; Boutte, J.; Coissac, E.; Ourari, M.; Aïnouche, M.; Salmon, A.; Cabello-Hurtado, F.; et al. The evolutionary fate of the chloroplast and nuclear rps16 genes as revealed through the sequencing and comparative analyses of four novel legume chloroplast genomes from Lupinus. DNA Res. 2017, 24, 343–358. [Google Scholar] [CrossRef]
- McDonald, M.J.; Wang, W.C.; Huang, H.D.; Leu, J.Y. Clusters of nucleotide substitutions and insertion/deletion mutations are associated with repeat sequences. PLoS Biol. 2011, 9. [Google Scholar] [CrossRef]
- Cheon, K.-S.; Kim, K.-A.; Kwak, M.; Lee, B.; Yoo, K.-O. The complete chloroplast genome sequences of four Viola species (Violaceae) and comparative analyses with its congeneric species. PLoS ONE 2019, 14, e0214162. [Google Scholar] [CrossRef]
- Liu, E.; Yang, C.; Liu, J.; Jin, S.; Harijati, N.; Hu, Z.; Diao, Y.; Zhao, L. Comparative analysis of complete chloroplast genome sequences of four major Amorphophallus species. Sci. Rep. 2019, 9, 809. [Google Scholar] [CrossRef]
- Cai, J.; Ma, P.F.; Li, H.T.; Li, D.Z. Complete plastid genome sequencing of four Tilia species (Malvaceae): A comparative analysis and phylogenetic implications. PLoS ONE 2015, 10, e142705. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Zheng, S.; Liu, Y.; Han, J. ITS2, a Better DNA Barcode than ITS in Identification of Species in Artemisia L. Chin. Herb. Med. 2016, 8, 352–358. [Google Scholar] [CrossRef]
- Liu, G.; Ning, H.; Ayidaerhan, N.; Aisa, H.A. Evaluation of DNA barcode candidates for the discrimination of Artemisia L. Mitochondrial DNA Part A 2016, 1394. [Google Scholar] [CrossRef]
- Li, X.; Yang, Y.; Henry, R.J.; Rossetto, M.; Wang, Y.; Chen, S. Plant DNA barcoding: From gene to genome. Biol. Rev. 2014. [Google Scholar] [CrossRef]
- Meng, D.; Xiaomei, Z.; Wenzhen, K.; Id, Z.X. Detecting useful genetic markers and reconstructing the phylogeny of an important medicinal resource plant, Artemisia selengensis, based on chloroplast genomics. PLoS ONE 2019, 14, 1–19. [Google Scholar] [CrossRef]
- Zerbino, D.R.; Birney, E. Velvet: Algorithms for de novo short read assembly using de Bruijn graphs. Genome Res. 2008, 18, 821–829. [Google Scholar] [CrossRef] [Green Version]
- Li, H.; Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef] [Green Version]
- Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C.; et al. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 2012, 28, 1647–1649. [Google Scholar] [CrossRef]
- Tillich, M.; Lehwark, P.; Pellizzer, T.; Ulbricht-Jones, E.S.; Fischer, A.; Bock, R.; Greiner, S. GeSeq—Versatile and accurate annotation of organelle genomes. Nucleic Acids Res. 2017, 45, W6–W11. [Google Scholar] [CrossRef]
- Lowe, T.M.; Chan, P.P. tRNAscan-SE On-line: Integrating search and context for analysis of transfer RNA genes. Nucleic Acids Res. 2016, 44, W54–W57. [Google Scholar] [CrossRef]
- Laslett, D.; Canback, B. ARAGORN, a program to detect tRNA genes and tmRNA genes in nucleotide sequences. Nucleic Acids Res. 2004, 32, 11–16. [Google Scholar] [CrossRef] [PubMed]
- Lohse, M.; Drechsel, O.; Bock, R. OrganellarGenomeDRAW (OGDRAW): A tool for the easy generation of high-quality custom graphical maps of plastid and mitochondrial genomes. Curr. Genet. 2007, 52, 267–274. [Google Scholar] [CrossRef] [PubMed]
- Lehwark, P.; Greiner, S. GB2sequin—A file converter preparing custom GenBank files for database submission. Genomics 2018. [Google Scholar] [CrossRef] [PubMed]
- Amiryousefi, A.; Hyvönen, J.; Poczai, P. IRscope: An online program to visualize the junction sites of chloroplast genomes. Bioinformatics 2018, 34, 3030–3031. [Google Scholar] [CrossRef]
- Mower, J.P. The PREP suite: Predictive RNA editors for plant mitochondrial genes, chloroplast genes and user-defined alignments. Nucleic Acids Res. 2009, 37, W253–W259. [Google Scholar] [CrossRef]
- Beier, S.; Thiel, T.; Münch, T.; Scholz, U.; Mascher, M. MISA-web: A web server for microsatellite prediction. Bioinformatics 2017, 33, 2583–2585. [Google Scholar] [CrossRef]
- Kurtz, S.; Choudhuri, J.V.; Ohlebusch, E.; Schleiermacher, C.; Stoye, J.; Giegerich, R. REPuter: The manifold applications of repeat analysis on a genomic scale. Nucleic Acids Res. 2001, 29, 4633–4642. [Google Scholar] [CrossRef]
- Katoh, K.; Kuma, K.I.; Toh, H.; Miyata, T. MAFFT version 5: Improvement in accuracy of multiple sequence alignment. Nucleic Acids Res. 2005, 33, 511–518. [Google Scholar] [CrossRef]
- Rozas, J.; Ferrer-Mata, A.; Sanchez-DelBarrio, J.C.; Guirao-Rico, S.; Librado, P.; Ramos-Onsins, S.E.; Sanchez-Gracia, A. DnaSP 6: DNA sequence polymorphism analysis of large data sets. Mol. Biol. Evol. 2017, 34, 3299–3302. [Google Scholar] [CrossRef]
- Nguyen, L.-T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating Maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef]
- Hoang, D.T.; Chernomor, O.; von Haeseler, A.; Minh, B.Q.; Vinh, L.S. UFBoot2: Improving the ultrafast bootstrap approximation. Mol. Biol. Evol. 2018, 35, 518–522. [Google Scholar] [CrossRef] [PubMed]
- Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef] [PubMed]
- Dereeper, A.; Guignon, V.; Blanc, G.; Audic, S.; Buffet, S.; Chevenet, F.; Dufayard, J.-F.; Guindon, S.; Lefort, V.; Lescot, M.; et al. Phylogeny.fr: Robust phylogenetic analysis for the non-specialist. Nucleic Acids Res. 2008, 36, W465–W469. [Google Scholar] [CrossRef] [PubMed]
- Chevenet, F.; Brun, C.; Bañuls, A.-L.; Jacq, B.; Christen, R. TreeDyn: Towards dynamic graphics and annotations for analyses of trees. BMC Bioinform. 2006, 7, 439. [Google Scholar] [CrossRef] [PubMed]
Characteristics | Artemisia scoparia | |
---|---|---|
Size (Base Pair; bp) | 151,060 | |
IR length (bp) | 24,972 | |
LSC length (bp) | 82,834 | |
SSC length (bp) | 18,282 | |
Number of genes | 114 | |
Duplicate genes | 18 | |
tRNA genes | 30 | |
rRNA genes | 4 | |
Protein-coding genes | 80 | |
GC content | Total (%) | 37.5 |
CDS (%) | 37.8 | |
IR (%) | 43.1 | |
LSC (%) | 35.6 | |
SSC (%) | 30.8 | |
rRNA (%) | 55 | |
tRNA (%) | 52.7 | |
All gene % | 39.3 |
Repeats | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | 14 | 15 | 16 | 17 | 18 | 19 | 20 | Total |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
A | - | - | - | - | - | - | - | 10 | 2 | 5 | 17 | ||||||||
T | - | - | - | - | - | - | - | 11 | 3 | 1 | 3 | 2 | 1 | 1 | 1 | 23 | |||
AT | - | - | 3 | 2 | 1 | 6 | |||||||||||||
TA | - | - | 2 | 1 | 3 | ||||||||||||||
ATA | - | 1 | 1 | ||||||||||||||||
ATT | - | 1 | 1 | ||||||||||||||||
TAA | - | 1 | 1 | ||||||||||||||||
TTA | - | 1 | 1 | ||||||||||||||||
TTC | - | 1 | 1 | ||||||||||||||||
AATA | 2 | 2 | |||||||||||||||||
AATC | 2 | 2 | |||||||||||||||||
AATT | 1 | 1 | |||||||||||||||||
ATTT | 1 | 1 | |||||||||||||||||
CAAT | 1 | 1 | |||||||||||||||||
TAAT | 1 | 1 | |||||||||||||||||
TATT | 1 | 1 | |||||||||||||||||
TTTA | 1 | 1 | |||||||||||||||||
TTTC | 1 | 1 | |||||||||||||||||
AAATT | 1 | 1 |
S.No | Type | Size | Regions | IGS/CDS/Intron | 1st Position | 2nd Position | Sequence |
---|---|---|---|---|---|---|---|
1 | F | 32 | LSC | psaB/psaA | 37,977 | 40,201 | AGAAAAATAAATGCAATAGCTAAATGATGATG |
2 | F | 30 | LSC | psaB/psaA | 37,988 | 40,212 | TGCAATAGCTAAATGATGATGAGCCATATC |
3 | R | 30 | LSC | psaA-ycf3/rps4-trnT | 41,744 | 45,790 | ATAAAAAAAAAAAAGATATATATCTAATAT |
4 | F | 41 | LSC/IR | ycf3 intron/rps12-ycf15 | 42,974 | 96,836 | TACAGAACCGTACATGAGATTTTCATCTCATACGGCTCCTC |
5 | F | 39 | LSC/SSC | ycf3 intron/ndhA intron | 42,976 | 118,122 | CAGAACCGTACATGAGATTTTCATCTCATACGGCTCCTC |
6 | F | 35 | LSC/IR | ycf3 intron/ndhB intron | 42,979 | 93,787 | AACCGTACATGAGATTTTCATCTCATACGGCTCCT |
7 | F | 30 | LSC | rbcL*-rbcL-accD | 56,187 | 56,211 | AAAAGAGATAAGGTTCGTTCTCTTAAAAGA |
8 | F | 30 | LSC/IR | psaJ-rpl33/ycf15-trnV | 66,253 | 97,999 | TAAGAGGATAGCAAGTTACAAATTCTATTT |
9 | P | 48 | LSC | psbT-psbN | 72,973 | 72,973 | AATTGAAGTAATGAGCCTCCCAATATTGGGAGGCTCATTACTTCAATT |
10 | P | 31 | IR | ycf2 | 86,489 | 86,489 | CGAGAAGCAGATGATTAATCATCTGCTTCCG |
11 | F | 60 | IR | ycf2 | 90,062 | 90,080 | CGATATTGATGAGATTGACGATATTGATGCTAGTGACGATATTGATGCTAGTGACGATAT |
12 | F | 39 | IR/SSC | rps12-trnV/ndhA intron | 96,838 | 118,122 | CAGAACCGTACATGAGATTTTCACCTCATACGGCTCCTC |
13 | F | 34 | IR | rrn4.5-rrn5 | 105,729 | 105,761 | CATTGTTCAACTCTTTAACAACATGAAAAAACCATTGTT |
14 | P | 43 | SSC | ndhD-psaC | 115,012 | 115,012 | AAAACATGTGCCCAAAAATAAGATATTTTTGGGCACATGTTTT |
Substitution Type | LSC | SSC | IR |
---|---|---|---|
A/C | 15 | 5 | 1 |
A/G | 12 | 2 | 2 |
G/T | 16 | 11 | 0 |
C/T | 9 | 1 | 3 |
C/G | 5 | 2 | 0 |
A/T | 2 | 2 | 0 |
Total | 59 | 23 | 6 |
No’s of InDels | 42 | 9 | 3 |
Average size | 3.86 | 3.11 | 3.67 |
Serial No | Region | Nucleotide Diversity | Total No’s of Mutations | Region Length |
---|---|---|---|---|
1 | ccsA-ndhD | 0.054545 | 12 | 220 |
2 | trnH-psbA | 0.047382 | 19 | 401 |
3 | ndhG-ndhI | 0.042553 | 16 | 376 |
4 | rps18-rpl20 | 0.042403 | 12 | 283 |
5 | rps15-ycf1 | 0.042056 | 18 | 428 |
6 | trnC-GCA-petN | 0.038917 | 23 | 591 |
7 | rpl32-trnL | 0.037443 | 39 | 908 |
8 | rpoC2-rps2 | 0.035433 | 9 | 254 |
9 | trnK-UUU-rps16 | 0.035267 | 31 | 879 |
10 | ndhF-rpl32 | 0.033915 | 35 | 1032 |
11 | psbA-trnK-UUU | 0.033654 | 7 | 208 |
12 | ndhC-trnV | 0.033646 | 43 | 1278 |
13 | trnS-GGA-rps4 | 0.032934 | 11 | 334 |
14 | petN-psbM | 0.032847 | 18 | 548 |
15 | rps16-trnQ-UUG | 0.031729 | 29 | 914 |
16 | trnS-GCU-trnC-GCA | 0.031291 | 24 | 767 |
17 | accD-psaI | 0.03071 | 16 | 521 |
18 | psbK-psbI | 0.030534 | 12 | 393 |
19 | rbcL-accD | 0.030019 | 16 | 533 |
20 | ycf4-cemA | 0.029091 | 8 | 275 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Iram, S.; Hayat, M.Q.; Tahir, M.; Gul, A.; Abdullah; Ahmed, I. Chloroplast Genome Sequence of Artemisia scoparia: Comparative Analyses and Screening of Mutational Hotspots. Plants 2019, 8, 476. https://doi.org/10.3390/plants8110476
Iram S, Hayat MQ, Tahir M, Gul A, Abdullah, Ahmed I. Chloroplast Genome Sequence of Artemisia scoparia: Comparative Analyses and Screening of Mutational Hotspots. Plants. 2019; 8(11):476. https://doi.org/10.3390/plants8110476
Chicago/Turabian StyleIram, Shabina, Muhammad Qasim Hayat, Muhammad Tahir, Alvina Gul, Abdullah, and Ibrar Ahmed. 2019. "Chloroplast Genome Sequence of Artemisia scoparia: Comparative Analyses and Screening of Mutational Hotspots" Plants 8, no. 11: 476. https://doi.org/10.3390/plants8110476