Next Issue
Volume 13, September
Previous Issue
Volume 13, March
 
 

Microbiol. Res., Volume 13, Issue 2 (June 2022) – 14 articles

Cover Story (view full-size image): Cyanobacteria contain light-harvesting accessory structures composed of phycobiliproteins and attached to thylakoid membranes called phycobilisomes. Central to optimizing light capture for photosynthesis, both phycobiliprotein content and phycobilisome size are tuned to external light cues. Prior studies identified factors critical for controlling the phycobiliprotein content of phycobilisomes. In this study, Layer and Montgomery describe the prevalence and potential biochemical activity of a protein Phycobilisome Abundance Regulator (PsoR) involved in regulating phycobilisomes abundance and/or size. PsoR is widespread across the cyanobacterial phylum but absent in phycobilisome-containing red algae. PsoR is also predicted to function in nucleic acid metabolism to impact phycobilisomes abundance. View this paper
  • Issues are regarded as officially published after their release is announced to the table of contents alert mailing list.
  • You may sign up for e-mail alerts to receive table of contents of newly released issues.
  • PDF is the official format for papers published in both, html and pdf forms. To view the papers in pdf format, click on the "PDF Full-text" link, and use the free Adobe Reader to open them.
Order results
Result details
Section
Select all
Export citation of selected articles as:
10 pages, 2573 KB  
Article
Two Screening Assays to Detect Vancomycin-Resistant Enterococcus spp.
by Beniamino T. Cenci-Goga, Musafiri Karama, Saeed El-Ashram, Cristina Saraiva, Juan García-Díez, Athanasios Chalias and Luca Grispoldi
Microbiol. Res. 2022, 13(2), 332-341; https://doi.org/10.3390/microbiolres13020026 - 13 Jun 2022
Cited by 1 | Viewed by 3572
Abstract
Enterococci have become major nosocomial pathogens. An increasing number of these infections are as a result of vancomycin-resistant enterococci. Accurate detection of vancomycin-resistant enterococci (VRE) is important, so that appropriate therapy and infection control measures may be instituted, including veterinary surveillance. Two screening [...] Read more.
Enterococci have become major nosocomial pathogens. An increasing number of these infections are as a result of vancomycin-resistant enterococci. Accurate detection of vancomycin-resistant enterococci (VRE) is important, so that appropriate therapy and infection control measures may be instituted, including veterinary surveillance. Two screening assays to detect vancomycin resistance in enterococci are proposed. Barnes Basal Medium agar (Ba) and Brain Heart Infusion (BHI) broth (plus 1% TTC-2,3,5-triphenyltetrazolium chloride) with several concentrations of vancomycin were used in this work. Five Enterococcus casseliflavus strains with low-level resistance to vancomycin (4 µg/mL) were used. Both media were able to quickly detect the breakpoint of the vancomycin-resistant strains used in this work, and also provided insight into the dynamics of the antibiotic effect at a low concentration on the tested bacterial suspensions. Full article
Show Figures

Graphical abstract

9 pages, 841 KB  
Communication
Functional Characterisation of Two Novel Deacetylases from Streptococcus pyogenes
by Tiger Aspell, Adrina Hema Jethanand Khemlani, Jacelyn Mei San Loh, Catherine Jia-Yun Tsai and Thomas Proft
Microbiol. Res. 2022, 13(2), 323-331; https://doi.org/10.3390/microbiolres13020025 - 7 Jun 2022
Cited by 1 | Viewed by 3051
Abstract
Streptococcus pyogenes (Group A Streptococcus, GAS) is an exclusively human pathogen that causes a wide range of diseases. We have identified two novel proteins, Spy1094 and Spy1370, which show sequence similarity with peptidoglycan deacetylases (PGDAs) from other streptococcal species like S. pneumoniae [...] Read more.
Streptococcus pyogenes (Group A Streptococcus, GAS) is an exclusively human pathogen that causes a wide range of diseases. We have identified two novel proteins, Spy1094 and Spy1370, which show sequence similarity with peptidoglycan deacetylases (PGDAs) from other streptococcal species like S. pneumoniae and S. iniae, that represent important virulence factors. Recombinant Spy1094 and Spy1370 were active at a wide pH range (pH 4.0–9.0) and showed metal ion-dependence, with the highest activities observed in the presence of Mn2+, Mg2+and Zn2+. The enzymes showed typical Michaelis–Menten saturation kinetics with the pseudo-substrate GlcNAc3. Binding affinities for rSpy1094 and rSpy1370 were high (Km = 2.2 ± 0.9 μM and 3.1 ± 1.1 μM, respectively), but substrate turnover was low (Kcat = 0.0075/s and 0.0089/s, respectively) suggesting that peptidoglycan might not be the preferred target for deacetylation. Both enzymes were expressed during bacterial growth. Full article
Show Figures

Figure 1

8 pages, 364 KB  
Article
Identification of Fungi in Flaxseed (L. usitatissimum L.) Using the ITS1 and ITS2 Intergenic Regions
by Nathalia de Castro Rollemberg, Guilherme de Souza Hassemer, Milena Dutra Pierezan, Bruna Marchesan Maran, Flávia Michelon Dalla Nora and Silvani Verruck
Microbiol. Res. 2022, 13(2), 315-322; https://doi.org/10.3390/microbiolres13020024 - 1 Jun 2022
Cited by 6 | Viewed by 4412
Abstract
Flaxseed (Linum usitatissimum L.) displays functional properties and contains α-linolenic acid (omega-3). It also contains soluble and insoluble fiber, lignans, phenolic acids, flavonoids, phytic acid, vitamins, and minerals. However, its microbiota can cause fungal contaminations, drastically reducing its quality. The objective of [...] Read more.
Flaxseed (Linum usitatissimum L.) displays functional properties and contains α-linolenic acid (omega-3). It also contains soluble and insoluble fiber, lignans, phenolic acids, flavonoids, phytic acid, vitamins, and minerals. However, its microbiota can cause fungal contaminations, drastically reducing its quality. The objective of this work was to identify the fungi present in bulk flaxseed through the internal transcribed spacer (ITS1) intergenic region using a metataxonomics approach. Fungal identification was performed via high-performance sequencing of the ITS1 region using ITS1 (GAACCWGCGGARGGATCA) and ITS2 (GCTGCGTTCTTCATCGATGC) as primers with 300 cycles and single-end sequencing in the MiSeq Sequencing System equipment (Illumina Inc., San Diego, CA, USA). Six genera and eight species of fungi were found in the sample. The genus Aspergillus stood out with three xerophilic species found, A. cibarius, A. Appendiculatus, and A. amstelodami, the first being the most abundant. The second most abundant genus was Wallemia, with the species W. muriae. This is one of the fungi taxa with great xerophilic potential, and some strains can produce toxins. Metataxonomics has proved to be a complete, fast, and efficient method to identify different fungi. Furthermore, high-performance genetic sequencing is an important ally in research, helping to develop novel technological advances related to food safety. Full article
Show Figures

Figure 1

23 pages, 464 KB  
Review
Deoxynivalenol: An Overview on Occurrence, Chemistry, Biosynthesis, Health Effects and Its Detection, Management, and Control Strategies in Food and Feed
by Madhu Kamle, Dipendra Kumar Mahato, Akansha Gupta, Shikha Pandhi, Bharti Sharma, Kajal Dhawan, Vasundhara, Sadhna Mishra, Manoj Kumar, Abhishek Dutt Tripathi, Prasad Rasane, Raman Selvakumar, Arvind Kumar, Shirani Gamlath and Pradeep Kumar
Microbiol. Res. 2022, 13(2), 292-314; https://doi.org/10.3390/microbiolres13020023 - 1 Jun 2022
Cited by 75 | Viewed by 14192
Abstract
Mycotoxins are fungi-produced secondary metabolites that can contaminate many foods eaten by humans and animals. Deoxynivalenol (DON), which is formed by Fusarium, is one of the most common occurring predominantly in cereal grains and thus poses a significant health risk. When DON [...] Read more.
Mycotoxins are fungi-produced secondary metabolites that can contaminate many foods eaten by humans and animals. Deoxynivalenol (DON), which is formed by Fusarium, is one of the most common occurring predominantly in cereal grains and thus poses a significant health risk. When DON is ingested, it can cause both acute and chronic toxicity. Acute signs include abdominal pain, anorexia, diarrhea, increased salivation, vomiting, and malaise. The most common effects of chronic DON exposure include changes in dietary efficacy, weight loss, and anorexia. This review provides a succinct overview of various sources, biosynthetic mechanisms, and genes governing DON production, along with its consequences on human and animal health. It also covers the effect of environmental factors on its production with potential detection, management, and control strategies. Full article
(This article belongs to the Topic Microbiology Metabolomics)
14 pages, 4634 KB  
Article
An Assessment of the Lactic Acid-Producing Potential of Bacterial Strains Isolated from Food Waste
by Henriette Peace Uwamahoro, Fuyu Li, Arbindra Timilsina, Binbin Liu, Xinzhen Wang and Yinping Tian
Microbiol. Res. 2022, 13(2), 278-291; https://doi.org/10.3390/microbiolres13020022 - 21 May 2022
Cited by 17 | Viewed by 11948 | Correction
Abstract
Lactic acid (LA) is widely used in many industries as a crucial starting material in food products, bio-based materials, and biodegradable polymers. The goals of this research were to isolate LA bacteria from food wastes, assess their potential for LA production, and study [...] Read more.
Lactic acid (LA) is widely used in many industries as a crucial starting material in food products, bio-based materials, and biodegradable polymers. The goals of this research were to isolate LA bacteria from food wastes, assess their potential for LA production, and study their growth characteristics. In this study, six bacterial strains were isolated from food waste and identified using 16S rRNA gene sequencing; namely, Weissella viridescens WJ39, Leuconostoc lactis YS33, Leuconostoc citreum KD42, Leuconostoc mesenteroides VN60, Macrococcus caseolyticus FCI29, and Weissella confusa RG41. W. viridescens WJ39 showed the highest potential for lactic acid production (17.56 g L−1day1), and the lowest potential was found in L. lactis YS33 (14.09 g L−1day−1). There were significant differences (p < 0.05) in the LA production rates among Weissella spp., Leuconostoc spp., and Macrococcus spp. Moreover, dramatic differences in growth rate were observed among the six strains. W. viridescens WJ39 exhibited the highest growth rate (0.80 h−1), while M. caseolyticus FCI29 exhibited the lowest growth rate (0.57 h−1). W. viridescens WJ39 also exhibited lactic acid production (at a rate around 2 g L−1day−1) in a lab incubation experiment with food waste as a nutrient source. The draft genome of W. viridescens WJ39 with 16 contigs was constructed with an N50 of 215217 bp. The genome size was approximately 1.54 Mb, with a GC content of 41%. A hicD gene, known to catalyze the conversion of pyruvate to D-lactate, was discovered in the genome. This study illustrated the potential for the production of lactic acid from food waste with lactic acid bacteria. Full article
Show Figures

Figure 1

20 pages, 4763 KB  
Article
Multi-Mycotoxin Contamination, Mold Incidence and Risk Assessment of Aflatoxin in Maize Kernels Originating from Nepal
by Prateek Joshi, Chananya Chauysrinule, Warapa Mahakarnchanakul and Thanapoom Maneeboon
Microbiol. Res. 2022, 13(2), 258-277; https://doi.org/10.3390/microbiolres13020021 - 15 May 2022
Cited by 28 | Viewed by 6129
Abstract
Occurrence of mycotoxins in staple foods is a major threat to attaining food safety in developing countries. The study investigated multi-mycotoxin contamination for the first time in Nepalese maize along with the incidence of molds in 45 samples of maize used as human [...] Read more.
Occurrence of mycotoxins in staple foods is a major threat to attaining food safety in developing countries. The study investigated multi-mycotoxin contamination for the first time in Nepalese maize along with the incidence of molds in 45 samples of maize used as human food from 45 districts of Nepal. The samples were analyzed quantitatively for the presence of five different mycotoxins (total aflatoxins (AF), total fumonisins (FUM), ochratoxin (OT), zearalenone (ZEA) and (DON) deoxynivalenol) using the competitive direct ELISA technique. The most frequent occurrences were for DON (100%) and AF (78%) followed by FUM and ZEA (both 76%) and OT (62%). Interestingly, all the samples contained at least two mycotoxins while at least three or more mycotoxins were found in 87% of the samples. The most commonly reported binary, ternary and quaternary combinations were DON+AF, AF+FUM+DON and AF+FUM+ZEA+DON, respectively. The mean percentage kernel mold infection was 35.33% with Fusarium, Aspergillus, Rhizopus and Penicillium genera being the predominant molds. Six different species of Aspergillus and a single species of Fusarium were identified. The estimated daily intake, margin of exposure and risk of liver cancer from consuming maize were 30.46 ng/kg bw/day and 5.58 and 0.38 cancer cases/year/100,000 population, respectively. Since maize is the second-most consumed cereal in Nepal, the contamination levels of various mycotoxins and the incidence of molds identified in the study suggests that stricter control is needed to safeguard the health of the substantial population consuming maize as a staple diet. Full article
Show Figures

Figure 1

23 pages, 3298 KB  
Article
Assessing Microbial Monitoring Methods for Challenging Environmental Strains and Cultures
by Damon C. Brown and Raymond J. Turner
Microbiol. Res. 2022, 13(2), 235-257; https://doi.org/10.3390/microbiolres13020020 - 13 May 2022
Cited by 17 | Viewed by 9414
Abstract
This paper focuses on the comparison of microbial biomass increase (cell culture growth) using field-relevant testing methods and moving away from colony counts. Challenges exist in exploring the antimicrobial growth of fastidious strains, poorly culturable bacteria and bacterial communities of environmental interest. Thus, [...] Read more.
This paper focuses on the comparison of microbial biomass increase (cell culture growth) using field-relevant testing methods and moving away from colony counts. Challenges exist in exploring the antimicrobial growth of fastidious strains, poorly culturable bacteria and bacterial communities of environmental interest. Thus, various approaches have been explored to follow bacterial growth that can be efficient surrogates for classical optical density or colony-forming unit measurements. Here, six species grown in pure culture were monitored using optical density, ATP assays, DNA concentrations and 16S rRNA qPCR. Each of these methods have different advantages and disadvantages concerning the measurement of growth and activity in complex field samples. The species used as model systems for monitoring were: Acetobacterium woodii, Bacillus subtilis, Desulfovibrio vulgaris, Geoalkalibacter subterraneus, Pseudomonas putida and Thauera aromatica. All four techniques were found to successfully measure and detect cell biomass/activity differences, though the shape and accuracy of each technique varied between species. DNA concentrations were found to correlate the best with the other three assays (ATP, DNA concentrations and 16S rRNA-targeted qPCR) and provide the advantages of rapid extraction, consistency between replicates and the potential for downstream analysis. DNA concentrations were determined to be the best universal monitoring method for complex environmental samples. Full article
Show Figures

Figure 1

16 pages, 263 KB  
Review
Review of Treatments for Oropharyngeal Fungal Infections in HIV/AIDS Patients
by Alexandre Noël de Tilly and Sujeenthar Tharmalingam
Microbiol. Res. 2022, 13(2), 219-234; https://doi.org/10.3390/microbiolres13020019 - 11 May 2022
Cited by 12 | Viewed by 8060
Abstract
HIV and AIDS patients are susceptible to opportunistic infections. Oral candidiasis or thrush is the primary manifestation of fungal infection in these patients. The primary objective of this literature review was to summarize established and novel treatment options for oropharyngeal fungal infections in [...] Read more.
HIV and AIDS patients are susceptible to opportunistic infections. Oral candidiasis or thrush is the primary manifestation of fungal infection in these patients. The primary objective of this literature review was to summarize established and novel treatment options for oropharyngeal fungal infections in HIV/AIDS patients. Azoles and polyenes are the two primary antifungal drug classes employed for the treatment of oral candidiasis. A literature review was conducted on Medline and Google Scholar in October of 2021 using the keywords “Oral”, “Fungal”, “HIV”, and “Treatment”. Included studies were clinical trials, meta-analyses, and randomized controlled trials. Nineteen studies regarding azoles, polyenes, and novel treatments for oropharyngeal fungal infections in HIV/AIDS patients were examined in this review. The primary concern demonstrated from these studies is increased reports of resistance to antifungals, especially development of fluconazole resistance. Additionally, studies demonstrated that fluconazole had different relapse durations comparative to other medications, and that posaconazole could possibly act as an alternate form of treatment. Nystatin was indicated as a first-line therapy for thrush in multiple studies but could be upstaged by miconazole nitrate in resource-poor settings. Amphotericin B was an effective treatment option and was shown to be resilient in terms of fungal resistance, however potent adverse side effects were reported. Alternative treatments, such as immunoglobulin antibodies and lemon grass, revealed promising antifungal effects for immunocompromised individuals. Taken together, this review provides a thorough summary of treatment options of oropharyngeal fungal infections in HIV/AIDS patients. Full article
9 pages, 8763 KB  
Brief Report
Oligotrophic Bacterial Community Structure Associated with Muscovite Mineral Is Rich in Proteobacterial Microbiomes Revealed through Next-Generation Sequencing
by Charan Theja Pindi, Prasada Babu Gundala, Lakshmi Subhadra Paruchuri, Jyothirmayee Kolapratap, Vidyasagar Chennupati and Paramageetham Chinthala
Microbiol. Res. 2022, 13(2), 210-218; https://doi.org/10.3390/microbiolres13020018 - 11 May 2022
Cited by 2 | Viewed by 2891
Abstract
The microbial life indigenous to mineral deposits are generally regarded as extremophiles as they are tolerant to extreme conditions. The microorganisms that thrive in such environments survive by modifying their metabolic pathway or mechanisms. The microbiome associated with ore deposits remain poorly studied. [...] Read more.
The microbial life indigenous to mineral deposits are generally regarded as extremophiles as they are tolerant to extreme conditions. The microorganisms that thrive in such environments survive by modifying their metabolic pathway or mechanisms. The microbiome associated with ore deposits remain poorly studied. The present study is the first attempt to explore the taxonomic composition of the bacterial community associated with the muscovite ore deposit from Southern India by using high throughput Illumina sequencing employing the V3 and V4 region of the16S rDNA and bioinformatics channel. A total of 20 bacterial phyla with 55 classes, 96 orders, 192 families, 382 genera and 462 species were recovered in the study. The alpha diversity index suggests that muscovite ore deposits harbored highly variable bacterial communities. Among the bacterial communities, Proteobacteria (33%), Actinobacteria (29.9%), Firmicutes (25.4%), Bacteroidetes (5.5%) and Chloroflexi (2.7%) were the dominate phyla. A total of 156 abundant species and 306 rare species were observed and is an indication of the presence of novel species. This study helps to understand the survival strategy of oligotrophs, which are an important aspect of microbial ecology. Full article
Show Figures

Figure 1

9 pages, 922 KB  
Communication
Does DHN-Melanin Always Protect Fungi against Antifungal Drugs? The Fonsecaea/Micafungin Paradigm
by Rowena Alves Coelho, Maria Helena Galdino Figueiredo-Carvalho, Juliana Vitória dos Santos Silva, Dario Correa-Junior, Susana Frases, Rosely Maria Zancopé-Oliveira, Dayvison Francis Saraiva Freitas and Rodrigo Almeida-Paes
Microbiol. Res. 2022, 13(2), 201-209; https://doi.org/10.3390/microbiolres13020017 - 6 May 2022
Cited by 6 | Viewed by 4905
Abstract
Several human pathogenic fungi produce melanin. One of its properties during parasitism is the protection against antifungal drugs. This occurs with the agents of chromoblastomycosis, in which DHN-melanin reduces antifungal susceptibility to terbinafine and itraconazole. Since these agents are resistant to some antifungal [...] Read more.
Several human pathogenic fungi produce melanin. One of its properties during parasitism is the protection against antifungal drugs. This occurs with the agents of chromoblastomycosis, in which DHN-melanin reduces antifungal susceptibility to terbinafine and itraconazole. Since these agents are resistant to some antifungal drugs, we investigated the role of DHN-melanin on the Fonsecaea susceptibility to amphotericin B, micafungin, fluconazole, and flucytosine, drugs that usually present high minimal inhibitory concentrations (MIC) to this genus. Seven strains from three Fonsecaea human pathogenic species were treated with tricyclazole, a DHN-melanin inhibitor, and the MIC of the treated and untreated cells were compared. A survival assay was performed to confirm the alterations in the susceptibility of strains with reduced melanization, and the chitin levels of the strains were estimated by fluorescence. Tricyclazole did not affect fluconazole and flucytosine MIC, while melanin inhibition increased susceptibility to amphotericin B. Surprisingly, DHN-melanin inhibition decreased the susceptibility to micafungin. Survival assays confirmed this result on five strains. Cell wall chitin levels of the strains were not associated with the decrease in micafungin susceptibility. The results show that DHN-melanin does not have a role in the intrinsic resistance of Fonseacaea spp. to amphotericin B, fluconazole, and flucytosine, and its inhibition may promote micafungin resistance. Full article
Show Figures

Figure 1

13 pages, 4546 KB  
Review
Insights into the Virulence of Campylobacter jejuni Associated with Two-Component Signal Transduction Systems and Single Regulators
by Noel Gahamanyi, Dae-Geun Song, Leonard E. G. Mboera, Mecky I. Matee, Dieudonné Mutangana, Raghavendra G. Amachawadi, Erick V. G. Komba and Cheol-Ho Pan
Microbiol. Res. 2022, 13(2), 188-200; https://doi.org/10.3390/microbiolres13020016 - 5 May 2022
Cited by 2 | Viewed by 5058
Abstract
Campylobacter jejuni is one of the major aetiologies of diarrhoea. Understanding the processes and virulence factors contributing to C. jejuni fitness is a cornerstone for developing mitigation strategies. Two-component signal transduction systems, known as two-component systems (TCSs), along with single regulators with no [...] Read more.
Campylobacter jejuni is one of the major aetiologies of diarrhoea. Understanding the processes and virulence factors contributing to C. jejuni fitness is a cornerstone for developing mitigation strategies. Two-component signal transduction systems, known as two-component systems (TCSs), along with single regulators with no obvious cognate histidine kinase, help pathogens in interacting with their environments, but the available literature on C. jejuni is limited. A typical TCS possesses histidine kinase and response regulator proteins. The objective of this review was to provide insights into the virulence of C. jejuni associated with TCSs and single regulators. Despite limited research, TCSs are important contributors to the pathogenicity of C. jejuni by influencing motility (FlgSR), colonisation (DccRS), nutrient acquisition (PhosSR and BumSR), and stress response (RacRS). Of the single regulators, CbrR and CosR are involved in bile resistance and oxidative stress response, respectively. Cross-talks among TCSs complicate the full elucidation of their molecular mechanisms. Although progress has been made in characterising C. jejuni TCSs, shortfalls such as triggering signals, inability to induce mutations in some genes, or developing suitable in vivo models are still being encountered. Further research is expected to shed light on the unexplored sides of the C. jejuni TCSs, which may allow new drug discoveries and better control strategies. Full article
(This article belongs to the Topic Veterinary Infectious Diseases)
Show Figures

Graphical abstract

5 pages, 3084 KB  
Editorial
Microbiota and Kidney: Is There a Correlation?
by Giuseppe Merra, Annunziata Capacci, Giuseppe Cenname, Ernesto Esposito, Maria Dri, Laura Di Renzo and Marco Marchetti
Microbiol. Res. 2022, 13(2), 183-187; https://doi.org/10.3390/microbiolres13020015 - 20 Apr 2022
Cited by 1 | Viewed by 2575
Abstract
The relationship between microbiota and chronic kidney disease (CKD) has long been known [...] Full article
(This article belongs to the Topic Microbiology Metabolomics)
Show Figures

Figure 1

16 pages, 3007 KB  
Communication
Homologs of Phycobilisome Abundance Regulator PsoR Are Widespread across Cyanobacteria
by Alicia Layer and Beronda L. Montgomery
Microbiol. Res. 2022, 13(2), 167-182; https://doi.org/10.3390/microbiolres13020014 - 12 Apr 2022
Cited by 1 | Viewed by 3275
Abstract
During chromatic acclimation (CA), cyanobacteria undergo shifts in their physiology and metabolism in response to changes in their light environment. Various forms of CA, which involves the tuning of light-harvesting accessory complexes known as phycobilisomes (PBS) in response to distinct wavelengths of light, [...] Read more.
During chromatic acclimation (CA), cyanobacteria undergo shifts in their physiology and metabolism in response to changes in their light environment. Various forms of CA, which involves the tuning of light-harvesting accessory complexes known as phycobilisomes (PBS) in response to distinct wavelengths of light, have been recognized. Recently, a negative regulator of PBS abundance, PsoR, about which little was known, was identified. We used sequence analyses and bioinformatics to predict the role of PsoR in cyanobacteria and PBS regulation and to examine its presence in a diverse range of cyanobacteria. PsoR has sequence similarities to the β-CASP family of proteins involved in DNA and RNA processing. PsoR is a putative nuclease widespread across Cyanobacteria, of which over 700 homologs have been observed. Promoter analysis suggested that psoR is co-transcribed with upstream gene tcpA. Multiple transcription factors involved in global gene regulation and stress responses were predicted to bind to the psoR-tcpA promoter. The predicted protein–protein interactions with PsoR homologs included proteins involved in DNA and RNA metabolism, as well as a phycocyanin-associated protein predicted to interact with PsoR from Fremyella diplosiphon (FdPsoR). The widespread presence of PsoR homologs in Cyanobacteria and their ties to DNA- and RNA-metabolizing proteins indicated a potentially unique role for PsoR in CA and PBS abundance regulation. Full article
Show Figures

Figure 1

15 pages, 2620 KB  
Article
Melanin Pathway Determination in Sclerotium cepivorum Berk Using Spectrophotometric Assays, Inhibition Compound, and Protein Validation
by Luis M. Salazar-García, Rocío Ivette Ortega-Cuevas, José A. Martínez-Álvarez, Sandra E. González-Hernández, Román Antonio Martínez-Álvarez, Diana Mendoza-Olivares, Miguel Ángel Vázquez, Alberto Flores-Martínez and Patricia Ponce-Noyola
Microbiol. Res. 2022, 13(2), 152-166; https://doi.org/10.3390/microbiolres13020013 - 29 Mar 2022
Cited by 5 | Viewed by 5047
Abstract
Sclerotium cepivorum Berk is the etiological agent of white rot disease that affects plants of the genus Allium. This fungus produces resistance structures called sclerotia that are formed by a rolled mycelium with a thick layer of melanin and it can remain [...] Read more.
Sclerotium cepivorum Berk is the etiological agent of white rot disease that affects plants of the genus Allium. This fungus produces resistance structures called sclerotia that are formed by a rolled mycelium with a thick layer of melanin and it can remain dormant for many years in the soil. Current interest in S. cepivorum has arisen from economic losses in Allium crops in the agricultural sector. Melanin is a component that protects the sclerotia from adverse environmental conditions In many organisms, it plays an important role in the infectious process; in S. cepivorum, the pathway by which this component is synthetized is not fully described. By using infrared spectrophotometric assays applied direct to the sclerotia and a melanin extract followed by an NMR analysis and a tricyclazole melanin inhibition experiment, it allowed us to determine the dihydroxynaphthalene (DHN)-melanin pathway by which S. cepivorum performs its melanin synthesis. Moreover, we focused on studying scytalone dehydratase (SDH) as a key enzyme of the DHN-melanin synthesis. We obtained the recombinant SDH enzyme and tested its activity by a zymogram assay. Thereby, the S. cepivorum melanogenic route was established as a DHN pathway. Full article
Show Figures

Figure 1

Previous Issue
Back to TopTop