molecules-logo

Journal Browser

Journal Browser

Frontiers in Nucleic Acid Chemistry—in Memory of Professor Enrique Pedroso for His Outstanding Contributions to Nucleic Acid Chemistry

A special issue of Molecules (ISSN 1420-3049). This special issue belongs to the section "Chemical Biology".

Deadline for manuscript submissions: closed (30 June 2023) | Viewed by 54447

Printed Edition Available!
A printed edition of this Special Issue is available here.

Special Issue Editors


E-Mail Website
Guest Editor
Institute for Advanced Chemistry of Catalonia, IQAC-CSIC, CIBER-BBN, Jordi Girona 18-26, 08034 Barcelona, Spain
Interests: nucleic acid chemistry; DNA and RNA analogs: synthesis applications, molecular tools; RNA interference; DNA nanotechnology; G-quadruplex; Triplex, artificial DNA
Special Issues, Collections and Topics in MDPI journals

E-Mail Website
Guest Editor
Department of Chemical Sciences, University of Naples Federico II | UNINA, Naples, Italy
Interests: oligonucleotides; nucleoside analogues; unusual structures of DNA; G-quadruplex; Ru(III)-complexes; Pt(II)-complexes; metal–DNA interactions; small molecule–DNA interactions
Special Issues, Collections and Topics in MDPI journals

E-Mail Website
Guest Editor
Department of Inorganic and Organic Chemistry, Organic Chemistry Section, Faculty of Chemistry, University of Barcelona, Martí i Franquès 1-11, 08028 Barcelona, Spain
Interests: nucleosides; therapeutic oligonucleotides; solid-phase synthesis; bioconjugation; delivery; cancer

Special Issue Information

Dear Colleagues,

Nucleic Acid Chemistry started soon after the Watson–Crick model of DNA with the synthesis of the first dinucleotide was published in 1955. However, in the last decade, this field has blossomed, with the demonstration that Nucleic Acid Chemistry can provide innovative solutions to new and old health problems such as vaccination, pathogen detection, and the treatment of metabolic or genetic diseases as well as providing important tools for the interrogation of cellular mechanisms. In this special issue, we would like to offer a few examples of novel developments in Nucleic Acid Chemistry and, at the same time, honour the memory of Prof. Enrique Pedroso, one of Spain’s pioneering researchers in Nucleic Acid Chemistry. His contributions to the synthesis of modified oligonucleotides, and especially oligonucleotide conjugates and cyclic oligonucleotides, opened up new avenues in the search for novel applications of oligonucleotides. In addition, Enrique was deeply involved in the research and promotion of Nucleic Acid Chemistry, as an active member of the IRT Society as well as organizing the Spanish Nucleosides Nucleotides and Nucleic Acids meetings (RANN). This Special Issue will be a tribute to his memory and a showcase of this highly interdisciplinary discipline that combines organic chemistry, biochemistry, pharmacology, materials chemistry, and biophysics.

Prof. Dr. Ramon Eritja
Dr. Daniela Montesarchio
Dr. Montserrat Terrazas
Guest Editors

Manuscript Submission Information

Manuscripts should be submitted online at www.mdpi.com by registering and logging in to this website. Once you are registered, click here to go to the submission form. Manuscripts can be submitted until the deadline. All submissions that pass pre-check are peer-reviewed. Accepted papers will be published continuously in the journal (as soon as accepted) and will be listed together on the special issue website. Research articles, review articles as well as short communications are invited. For planned papers, a title and short abstract (about 250 words) can be sent to the Editorial Office for assessment.

Submitted manuscripts should not have been published previously, nor be under consideration for publication elsewhere (except conference proceedings papers). All manuscripts are thoroughly refereed through a single-blind peer-review process. A guide for authors and other relevant information for submission of manuscripts is available on the Instructions for Authors page. Molecules is an international peer-reviewed open access semimonthly journal published by MDPI.

Please visit the Instructions for Authors page before submitting a manuscript. The Article Processing Charge (APC) for publication in this open access journal is 2700 CHF (Swiss Francs). Submitted papers should be well formatted and use good English. Authors may use MDPI's English editing service prior to publication or during author revisions.

Keywords

  • siRNA
  • G-quadruplex
  • DNA nanotechnology
  • gene silencing
  • aptamers
  • drug delivery
  • DNA
  • RNA
  • oligonucleotide synthesis

Benefits of Publishing in a Special Issue

  • Ease of navigation: Grouping papers by topic helps scholars navigate broad scope journals more efficiently.
  • Greater discoverability: Special Issues support the reach and impact of scientific research. Articles in Special Issues are more discoverable and cited more frequently.
  • Expansion of research network: Special Issues facilitate connections among authors, fostering scientific collaborations.
  • External promotion: Articles in Special Issues are often promoted through the journal's social media, increasing their visibility.
  • Reprint: MDPI Books provides the opportunity to republish successful Special Issues in book format, both online and in print.

Further information on MDPI's Special Issue policies can be found here.

Published Papers (14 papers)

Order results
Result details
Select all
Export citation of selected articles as:

Editorial

Jump to: Research, Review, Other

5 pages, 211 KB  
Editorial
Special Issue “Frontiers in Nucleic Acid Chemistry—In Memory of Professor Enrique Pedroso for His Outstanding Contributions to Nucleic Acid Chemistry”
by Montserrat Terrazas, Ramon Eritja and Daniela Montesarchio
Molecules 2023, 28(21), 7278; https://doi.org/10.3390/molecules28217278 - 26 Oct 2023
Viewed by 1544
Abstract
This Special issue is dedicated to the memory of Enrique Pedroso, Professor Emeritus of Organic Chemistry at University of Barcelona, who passed away at the age of 72 in September 2020 [...] Full article

Research

Jump to: Editorial, Review, Other

13 pages, 1732 KB  
Article
Convenient Solid-Phase Attachment of Small-Molecule Ligands to Oligonucleotides via a Biodegradable Acid-Labile P-N-Bond
by Nadezhda O. Kropacheva, Arseniy A. Golyshkin, Mariya A. Vorobyeva and Mariya I. Meschaninova
Molecules 2023, 28(4), 1904; https://doi.org/10.3390/molecules28041904 - 16 Feb 2023
Cited by 5 | Viewed by 3274
Abstract
One of the key problems in the design of therapeutic and diagnostic oligonucleotides is the attachment of small-molecule ligands for targeted deliveries in such a manner that provides the controlled release of the oligonucleotide at a certain moment. Here, we propose a novel, [...] Read more.
One of the key problems in the design of therapeutic and diagnostic oligonucleotides is the attachment of small-molecule ligands for targeted deliveries in such a manner that provides the controlled release of the oligonucleotide at a certain moment. Here, we propose a novel, convenient approach for attaching ligands to the 5′-end of the oligonucleotide via biodegradable, acid-labile phosphoramide linkage. The method includes the activation of the 5′-terminal phosphate of the fully protected, support-bound oligonucleotide, followed by interaction with a ligand bearing the primary amino group. This technique is simple to perform, allows for forcing the reaction to completion by adding excess soluble reactant, eliminates the problem of the limited solubility of reagents, and affords the possibility of using different solvents, including water/organic media. We demonstrated the advantages of this approach by synthesizing and characterizing a wide variety of oligonucleotide 5′-conjugates with different ligands, such as cholesterol, aliphatic oleylamine, and p-anisic acid. The developed method suits different types of oligonucleotides (deoxyribo-, 2′-O-methylribo-, ribo-, and others). Full article
Show Figures

Figure 1

18 pages, 2813 KB  
Article
DNA Base Excision Repair Intermediates Influence Duplex–Quadruplex Equilibrium
by Mark L. Sowers, James W. Conrad, Bruce Chang-Gu, Ellie Cherryhomes, Linda C. Hackfeld and Lawrence C. Sowers
Molecules 2023, 28(3), 970; https://doi.org/10.3390/molecules28030970 - 18 Jan 2023
Cited by 4 | Viewed by 3479
Abstract
Although genomic DNA is predominantly duplex under physiological conditions, particular sequence motifs can favor the formation of alternative secondary structures, including the G-quadruplex. These structures can exist within gene promoters, telomeric DNA, and regions of the genome frequently found altered in human cancers. [...] Read more.
Although genomic DNA is predominantly duplex under physiological conditions, particular sequence motifs can favor the formation of alternative secondary structures, including the G-quadruplex. These structures can exist within gene promoters, telomeric DNA, and regions of the genome frequently found altered in human cancers. DNA is also subject to hydrolytic and oxidative damage, and its local structure can influence the type of damage and its magnitude. Although the repair of endogenous DNA damage by the base excision repair (BER) pathway has been extensively studied in duplex DNA, substantially less is known about repair in non-duplex DNA structures. Therefore, we wanted to better understand the effect of DNA damage and repair on quadruplex structure. We first examined the effect of placing pyrimidine damage products uracil, 5-hydroxymethyluracil, the chemotherapy agent 5-fluorouracil, and an abasic site into the loop region of a 22-base telomeric repeat sequence known to form a G-quadruplex. Quadruplex formation was unaffected by these analogs. However, the activity of the BER enzymes were negatively impacted. Uracil DNA glycosylase (UDG) and single-strand selective monofunctional uracil DNA glycosylase (SMUG1) were inhibited, and apurinic/apyrimidinic endonuclease 1 (APE1) activity was completely blocked. Interestingly, when we performed studies placing DNA repair intermediates into the strand opposite the quadruplex, we found that they destabilized the duplex and promoted quadruplex formation. We propose that while duplex is the preferred configuration, there is kinetic conversion between duplex and quadruplex. This is supported by our studies using a quadruplex stabilizing molecule, pyridostatin, that is able to promote quadruplex formation starting from duplex DNA. Our results suggest how DNA damage and repair intermediates can alter duplex-quadruplex equilibrium. Full article
Show Figures

Figure 1

21 pages, 10835 KB  
Article
Factors Impacting Invader-Mediated Recognition of Double-Stranded DNA
by Caroline P. Shepard, Raymond G. Emehiser, Saswata Karmakar and Patrick J. Hrdlicka
Molecules 2023, 28(1), 127; https://doi.org/10.3390/molecules28010127 - 23 Dec 2022
Cited by 5 | Viewed by 3521
Abstract
The development of chemically modified oligonucleotides enabling robust, sequence-unrestricted recognition of complementary chromosomal DNA regions has been an aspirational goal for scientists for many decades. While several groove-binding or strand-invading probes have been developed towards this end, most enable recognition of DNA only [...] Read more.
The development of chemically modified oligonucleotides enabling robust, sequence-unrestricted recognition of complementary chromosomal DNA regions has been an aspirational goal for scientists for many decades. While several groove-binding or strand-invading probes have been developed towards this end, most enable recognition of DNA only under limited conditions (e.g., homopurine or short mixed-sequence targets, low ionic strength, fully modified probe strands). Invader probes, i.e., DNA duplexes modified with +1 interstrand zippers of intercalator-functionalized nucleotides, are predisposed to recognize DNA targets due to their labile nature and high affinity towards complementary DNA. Here, we set out to gain further insight into the design parameters that impact the thermal denaturation properties and binding affinities of Invader probes. Towards this end, ten Invader probes were designed, and their biophysical properties and binding to model DNA hairpins and chromosomal DNA targets were studied. A Spearman’s rank-order correlation analysis of various parameters was then performed. Densely modified Invader probes were found to result in efficient recognition of chromosomal DNA targets with excellent binding specificity in the context of denaturing or non-denaturing fluorescence in situ hybridization (FISH) experiments. The insight gained from the initial phase of this study informed subsequent probe optimization, which yielded constructs displaying improved recognition of chromosomal DNA targets. The findings from this study will facilitate the design of efficient Invader probes for applications in the life sciences. Full article
Show Figures

Figure 1

14 pages, 4067 KB  
Article
Enzymatic Synthesis of Vancomycin-Modified DNA
by Chiara Figazzolo, Frédéric Bonhomme, Saidbakhrom Saidjalolov, Mélanie Ethève-Quelquejeu and Marcel Hollenstein
Molecules 2022, 27(24), 8927; https://doi.org/10.3390/molecules27248927 - 15 Dec 2022
Cited by 10 | Viewed by 4223
Abstract
Many potent antibiotics fail to treat bacterial infections due to emergence of drug-resistant strains. This surge of antimicrobial resistance (AMR) calls in for the development of alternative strategies and methods for the development of drugs with restored bactericidal activities. In this context, we [...] Read more.
Many potent antibiotics fail to treat bacterial infections due to emergence of drug-resistant strains. This surge of antimicrobial resistance (AMR) calls in for the development of alternative strategies and methods for the development of drugs with restored bactericidal activities. In this context, we surmised that identifying aptamers using nucleotides connected to antibiotics will lead to chemically modified aptameric species capable of restoring the original binding activity of the drugs and hence produce active antibiotic species that could be used to combat AMR. Here, we report the synthesis of a modified nucleoside triphosphate equipped with a vancomycin moiety on the nucleobase. We demonstrate that this nucleotide analogue is suitable for polymerase-mediated synthesis of modified DNA and, importantly, highlight its compatibility with the SELEX methodology. These results pave the way for bacterial-SELEX for the identification of vancomycin-modified aptamers. Full article
Show Figures

Graphical abstract

9 pages, 2635 KB  
Article
Using the Intrinsic Fluorescence of DNA to Characterize Aptamer Binding
by Chang Lu, Anand Lopez, Jinkai Zheng and Juewen Liu
Molecules 2022, 27(22), 7809; https://doi.org/10.3390/molecules27227809 - 12 Nov 2022
Cited by 6 | Viewed by 4205
Abstract
The reliable, readily accessible and label-free measurement of aptamer binding remains a challenge in the field. Recent reports have shown large changes in the intrinsic fluorescence of DNA upon the formation of G-quadruplex and i-motif structures. In this work, we examined whether DNA [...] Read more.
The reliable, readily accessible and label-free measurement of aptamer binding remains a challenge in the field. Recent reports have shown large changes in the intrinsic fluorescence of DNA upon the formation of G-quadruplex and i-motif structures. In this work, we examined whether DNA intrinsic fluorescence can be used for studying aptamer binding. First, DNA hybridization resulted in a drop in the fluorescence, which was observed for A30/T30 and a 24-mer random DNA sequence. Next, a series of DNA aptamers were studied. Cortisol and Hg2+ induced fluorescence increases for their respective aptamers. For the cortisol aptamer, the length of the terminal stem needs to be short to produce a fluorescence change. However, caffeine and adenosine failed to produce a fluorescence change, regardless of the stem length. Overall, using the intrinsic fluorescence of DNA may be a reliable and accessible method to study a limited number of aptamers that can produce fluorescence changes. Full article
Show Figures

Figure 1

15 pages, 3919 KB  
Article
Exploring the Interaction of G-quadruplex Binders with a (3 + 1) Hybrid G-quadruplex Forming Sequence within the PARP1 Gene Promoter Region
by Stefania Mazzini, Salvatore Princiotto, Roberto Artali, Loana Musso, Anna Aviñó, Ramon Eritja, Raimundo Gargallo and Sabrina Dallavalle
Molecules 2022, 27(15), 4792; https://doi.org/10.3390/molecules27154792 - 26 Jul 2022
Cited by 3 | Viewed by 3224
Abstract
The enzyme PARP1 is an attractive target for cancer therapy, as it is involved in DNA repair processes. Several PARP1 inhibitors have been approved for clinical treatments. However, the rapid outbreak of resistance is seriously threatening the efficacy of these compounds, and alternative [...] Read more.
The enzyme PARP1 is an attractive target for cancer therapy, as it is involved in DNA repair processes. Several PARP1 inhibitors have been approved for clinical treatments. However, the rapid outbreak of resistance is seriously threatening the efficacy of these compounds, and alternative strategies are required to selectively regulate PARP1 activity. A noncanonical G-quadruplex-forming sequence within the PARP1 promoter was recently identified. In this study, we explore the interaction of known G-quadruplex binders with the G-quadruplex structure found in the PARP gene promoter region. The results obtained by NMR, CD, and fluorescence titration, also confirmed by molecular modeling studies, demonstrate a variety of different binding modes with small stabilization of the G-quadruplex sequence located at the PARP1 promoter. Surprisingly, only pyridostatin produces a strong stabilization of the G-quadruplex-forming sequence. This evidence makes the identification of a proper (3+1) stabilizing ligand a challenging goal for further investigation. Full article
Show Figures

Graphical abstract

12 pages, 1467 KB  
Article
Sustainable Protocol for the Synthesis of 2′,3′-Dideoxynucleoside and 2′,3′-Didehydro-2′,3′-dideoxynucleoside Derivatives
by Virginia Martín-Nieves, Yogesh S. Sanghvi, Susana Fernández and Miguel Ferrero
Molecules 2022, 27(13), 3993; https://doi.org/10.3390/molecules27133993 - 21 Jun 2022
Cited by 2 | Viewed by 3305
Abstract
An improved protocol for the transformation of ribonucleosides into 2′,3′-dideoxynucleoside and 2′,3′-didehydro-2′,3′-dideoxynucleoside derivatives, including the anti-HIV drugs stavudine (d4T), zalcitabine (ddC) and didanosine (ddI), was established. The process involves radical deoxygenation of xanthate using environmentally friendly and low-cost reagents. Bromoethane or 3-bromopropanenitrile was [...] Read more.
An improved protocol for the transformation of ribonucleosides into 2′,3′-dideoxynucleoside and 2′,3′-didehydro-2′,3′-dideoxynucleoside derivatives, including the anti-HIV drugs stavudine (d4T), zalcitabine (ddC) and didanosine (ddI), was established. The process involves radical deoxygenation of xanthate using environmentally friendly and low-cost reagents. Bromoethane or 3-bromopropanenitrile was the alkylating agent of choice to prepare the ribonucleoside 2′,3′-bisxanthates. In the subsequent radical deoxygenation reaction, tris(trimethylsilyl)silane and 1,1′-azobis(cyclohexanecarbonitrile) were used to replace hazardous Bu3SnH and AIBN, respectively. In addition, TBAF was substituted for camphorsulfonic acid in the deprotection step of the 5′-O-silyl ether group, and an enzyme (adenosine deaminase) was used to transform 2′,3′-dideoxyadenosine into 2′,3′-dideoxyinosine (ddI) in excellent yield. Full article
Show Figures

Graphical abstract

20 pages, 3320 KB  
Article
Properties of Parallel Tetramolecular G-Quadruplex Carrying N-Acetylgalactosamine as Potential Enhancer for Oligonucleotide Delivery to Hepatocytes
by Anna Clua, Santiago Grijalvo, Namrata Erande, Swati Gupta, Kristina Yucius, Raimundo Gargallo, Stefania Mazzini, Muthiah Manoharan and Ramon Eritja
Molecules 2022, 27(12), 3944; https://doi.org/10.3390/molecules27123944 - 20 Jun 2022
Cited by 5 | Viewed by 4789 | Correction
Abstract
The development of oligonucleotide conjugates for in vivo targeting is one of the most exciting areas for oligonucleotide therapeutics. A major breakthrough in this field was the development of multifunctional GalNAc-oligonucleotides with high affinity to asialoglycoprotein receptors (ASGPR) that directed therapeutic oligonucleotides to [...] Read more.
The development of oligonucleotide conjugates for in vivo targeting is one of the most exciting areas for oligonucleotide therapeutics. A major breakthrough in this field was the development of multifunctional GalNAc-oligonucleotides with high affinity to asialoglycoprotein receptors (ASGPR) that directed therapeutic oligonucleotides to hepatocytes. In the present study, we explore the use of G-rich sequences functionalized with one unit of GalNAc at the 3′-end for the formation of tetrameric GalNAc nanostructures upon formation of a parallel G-quadruplex. These compounds are expected to facilitate the synthetic protocols by providing the multifunctionality needed for the binding to ASGPR. To this end, several G-rich oligonucleotides carrying a TGGGGGGT sequence at the 3′-end functionalized with one molecule of N-acetylgalactosamine (GalNAc) were synthesized together with appropriate control sequences. The formation of a self-assembled parallel G-quadruplex was confirmed through various biophysical techniques such as circular dichroism, nuclear magnetic resonance, polyacrylamide electrophoresis and denaturation curves. Binding experiments to ASGPR show that the size and the relative position of the therapeutic cargo are critical for the binding of these nanostructures. The biological properties of the resulting parallel G-quadruplex were evaluated demonstrating the absence of the toxicity in cell lines. The internalization preferences of GalNAc-quadruplexes to hepatic cells were also demonstrated as well as the enhancement of the luciferase inhibition using the luciferase assay in HepG2 cell lines versus HeLa cells. All together, we demonstrate that tetramerization of G-rich oligonucleotide is a novel and simple route to obtain the beneficial effects of multivalent N-acetylgalactosamine functionalization. Full article
Show Figures

Graphical abstract

14 pages, 3016 KB  
Article
Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin
by Francesca Greco, Domenica Musumeci, Nicola Borbone, Andrea Patrizia Falanga, Stefano D’Errico, Monica Terracciano, Ilaria Piccialli, Giovanni Nicola Roviello and Giorgia Oliviero
Molecules 2022, 27(9), 2997; https://doi.org/10.3390/molecules27092997 - 7 May 2022
Cited by 20 | Viewed by 3985
Abstract
Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the [...] Read more.
Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations. Full article
Show Figures

Figure 1

Review

Jump to: Editorial, Research, Other

19 pages, 3941 KB  
Review
Advances in the Structure of GGGGCC Repeat RNA Sequence and Its Interaction with Small Molecules and Protein Partners
by Xiaole Liu, Xinyue Zhao, Jinhan He, Sishi Wang, Xinfei Shen, Qingfeng Liu and Shenlin Wang
Molecules 2023, 28(15), 5801; https://doi.org/10.3390/molecules28155801 - 1 Aug 2023
Cited by 4 | Viewed by 4294
Abstract
The aberrant expansion of GGGGCC hexanucleotide repeats within the first intron of the C9orf72 gene represent the predominant genetic etiology underlying amyotrophic lateral sclerosis (ALS) and frontal temporal dementia (FTD). The transcribed r(GGGGCC)n RNA repeats form RNA foci, which recruit RNA binding [...] Read more.
The aberrant expansion of GGGGCC hexanucleotide repeats within the first intron of the C9orf72 gene represent the predominant genetic etiology underlying amyotrophic lateral sclerosis (ALS) and frontal temporal dementia (FTD). The transcribed r(GGGGCC)n RNA repeats form RNA foci, which recruit RNA binding proteins and impede their normal cellular functions, ultimately resulting in fatal neurodegenerative disorders. Furthermore, the non-canonical translation of the r(GGGGCC)n sequence can generate dipeptide repeats, which have been postulated as pathological causes. Comprehensive structural analyses of r(GGGGCC)n have unveiled its polymorphic nature, exhibiting the propensity to adopt dimeric, hairpin, or G-quadruplex conformations, all of which possess the capacity to interact with RNA binding proteins. Small molecules capable of binding to r(GGGGCC)n have been discovered and proposed as potential lead compounds for the treatment of ALS and FTD. Some of these molecules function in preventing RNA–protein interactions or impeding the phase transition of r(GGGGCC)n. In this review, we present a comprehensive summary of the recent advancements in the structural characterization of r(GGGGCC)n, its propensity to form RNA foci, and its interactions with small molecules and proteins. Specifically, we emphasize the structural diversity of r(GGGGCC)n and its influence on partner binding. Given the crucial role of r(GGGGCC)n in the pathogenesis of ALS and FTD, the primary objective of this review is to facilitate the development of therapeutic interventions targeting r(GGGGCC)n RNA. Full article
Show Figures

Figure 1

12 pages, 1654 KB  
Review
Synthesis of Backbone-Modified Morpholino Oligonucleotides Using Phosphoramidite Chemistry
by Sibasish Paul and Marvin H. Caruthers
Molecules 2023, 28(14), 5380; https://doi.org/10.3390/molecules28145380 - 13 Jul 2023
Cited by 14 | Viewed by 6814
Abstract
Phosphorodiamidate morpholinos (PMOs) are known as premier gene knockdown tools in developmental biology. PMOs are usually 25 nucleo-base-long morpholino subunits with a neutral phosphorodiamidate linkage. PMOs work via a steric blocking mechanism and are stable towards nucleases’ inside cells. PMOs are usually synthesized [...] Read more.
Phosphorodiamidate morpholinos (PMOs) are known as premier gene knockdown tools in developmental biology. PMOs are usually 25 nucleo-base-long morpholino subunits with a neutral phosphorodiamidate linkage. PMOs work via a steric blocking mechanism and are stable towards nucleases’ inside cells. PMOs are usually synthesized using phosphoramidate P(V) chemistry. In this review, we will discuss the synthesis of PMOs, phosphoroamidate morpholinos (MO), and thiophosphoramidate morpholinos (TMO). Full article
Show Figures

Figure 1

14 pages, 1125 KB  
Review
Non-G Base Tetrads
by Núria Escaja, Bartomeu Mir, Miguel Garavís and Carlos González
Molecules 2022, 27(16), 5287; https://doi.org/10.3390/molecules27165287 - 19 Aug 2022
Cited by 16 | Viewed by 3604
Abstract
Tetrads (or quartets) are arrangements of four nucleobases commonly involved in the stability of four-stranded nucleic acids structures. Four-stranded or quadruplex structures have attracted enormous attention in the last few years, being the most extensively studied guanine quadruplex (G-quadruplex). Consequently, the G-tetrad is [...] Read more.
Tetrads (or quartets) are arrangements of four nucleobases commonly involved in the stability of four-stranded nucleic acids structures. Four-stranded or quadruplex structures have attracted enormous attention in the last few years, being the most extensively studied guanine quadruplex (G-quadruplex). Consequently, the G-tetrad is the most common and well-known tetrad. However, this is not the only possible arrangement of four nucleobases. A number of tetrads formed by the different nucleobases have been observed in experimental structures. In most cases, these tetrads occur in the context of G-quadruplex structures, either inserted between G-quartets, or as capping elements at the sides of the G-quadruplex core. In other cases, however, non-G tetrads are found in more unusual four stranded structures, such as i-motifs, or different types of peculiar fold-back structures. In this report, we review the diversity of these non-canonical tetrads, and the structural context in which they have been found. Full article
Show Figures

Figure 1

Other

3 pages, 1391 KB  
Correction
Correction: Clua et al. Properties of Parallel Tetramolecular G-Quadruplex Carrying N-Acetylgalactosamine as Potential Enhancer for Oligonucleotide Delivery to Hepatocytes. Molecules 2022, 27, 3944
by Anna Clua, Santiago Grijalvo, Namrata Erande, Swati Gupta, Kristina Yucius, Raimundo Gargallo, Stefania Mazzini, Muthiah Manoharan and Ramon Eritja
Molecules 2023, 28(1), 98; https://doi.org/10.3390/molecules28010098 - 23 Dec 2022
Viewed by 1826
Abstract
In the original article [...] Full article
Show Figures

Scheme 1

Back to TopTop