Abstract
This study was focused on identifying the effects of single nucleotide polymorphisms (SNPs) located on an entire region of the let-7c miRNA gene with consideration of its ability to promote litter size in Markhoz goats. The Markhoz goat, the native breed in Iran, is important for its reproductive traits, such as litter size. DNA polymorphism of let-7c miRNA gene was revealed and considered for further studies for its effect on litter size in Markhoz goats. PCR-SSCP analysis investigated different band patterns for this miRNA; however, sequencing results have detected only an A to T substitution located five nucleotides downstream of the let-7c miRNA gene. The chi-squared test showed that the let-7c miRNA gene locus was out of the Hardy–Weinberg equilibrium (HWE) and has significant effect (p < 0.05). Furthermore, the least-square analysis indicated that the let-7c miRNA gene does not affect prolificacy in the Markhoz goat (p > 0.05). In sum, all loci failed to have a significant effect on the litter size trait (p > 0.05). Moreover, years of kidding and parity had no significant impact on let-7c_S (p > 0.05); however, the let-7c_B affected the litter size trait significantly (p < 0.05). Additionally, binary logistic regression and chi-square analysis revealed that allele A of the detected SNP within 3′ UTR region of the let-7c gene had a non-significant effect on litter size in the studied goats (p > 0.05).
1. Introduction
Litter size is one of the most important reproductive traits in multiparous animals; thus, prolificacy is economically crucial in small ruminants such as goats. In addition, the ovulation rate is essentially connected to the kidding rate. The heritability of reproductive traits is low; thus, using marker-assisted selection in combination with traditional methods can improve these traits in animals [1]. Moreover, it is necessary to identify candidate genes that play an important role in critical traits in animals, especially litter size traits [2].
MicroRNAs are small non-coding single-stranded RNA molecules (about 22 nucleotides long) that account for 2–5% of mammalian genes and also show an important regulatory role in up to 60% of functional genes [3]. Approximately half of the known miRNAs are located in intragenic regions. The other half are located in genes with about 40% and 10% in introns and exons, respectively [4]. In general, they will be co-expressed with their hundreds of mRNA targets [4,5]. They are involved in different biological processes, including cell proliferation, differentiation, apoptosis, tumorigenesis, hormone secretion, and metabolism [6]. New studies recommend that single-nucleotide polymorphisms (SNPs) occurring in miRNA coding genes or their binding sites on target genes can alter functions of miRNA and/or their target genes [7], resulting in increased or decreased expression of that gene.
A recent study by [8] showed that there is a significant relationship between the miR-9 gene and litter size in Markhoz goats. Another study conducted on porcine prolificacy reported that specific miRNAs, such as miR-224, miR-99a, let-7c, miR-181c, miR-214, and miR-21, may influence pig fertility. Additionally, the important role of miRNAs in regulating and increasing ovulation rate was clarified [9].
Lin-4 and let-7 are the first two known miRNAs that were discovered in Caenorhabditis elegans and regulate stem-cell division and differentiation timing [10]. Let-7 family miRNAs are conserved across invertebrates and vertebrates and consist of 11 closely related genes [11]. It is reported that let-7c has a key regulatory role in follicle-stimulating hormone secretion in mouse follicle cells [12].
Considering the importance of SNPs in altering functions of miRNAs and their target genes, and considering that miRNAs may affect animal performance throughout gene regulation the aim of the present study was to identify possible variants within the let-7 miRNA gene as well as its target genes and to investigate its effects on litter size at birth in Markhoz goats.
2. Materials and Methods
All procedures used during the present study were approved by the Animal Care Committee of University of Kurdistan, Sanandaj, Iran (protocol number: IR.UOK.REC.1401.017; Approval date: 5 November 2022). Blood samples of Markhoz goats were obtained from the Markhoz Goat Performance Testing Station in Sanandaj, Kurdistan, Iran, during the breeding season. Ages of animals ranged from 3 to 5 years, with a history of multiple births (twin or triplet births) and single births, respectively. Samples were collected from 88 female and 32 male goats along with their litter size records for investigating possible single nucleotide polymorphism of studied genes and their associations with litter size. The Markhoz goat population is an endangered goat population, of which only 340 remain, including 156 adults (116 females and 40 males) and 184 kids under one year of age. However, only 88 does were available, and we used all females in the herd with a history of parturition. All goats were maintained in the same conditions of feeding and rearing. Venous blood (5–6 mL) was collected in vacutainer tubes containing ethylenediaminetetraacetic acid (EDTA) as an anticoagulant and immediately delivered to the lab in an ice box.
2.1. DNA Isolation and PCR
DNA samples were extracted from blood samples according to the salting out method [13]. After checking the quality and quantity, DNA was diluted to a final concentration of 50 ng/µL in deionized water and stored at −20 °C for further use. The OligoAnalyzer online tool was used to design specific primers based on the GenBank sequence (NCBI Accession No. NC_030808.1) for the let-7c miRNA gene. The sequence of forward and reverse primers was “AGTCCTTAGGTGTATGGCTG” and “CACAGAAATTGGCTCAATCA”, respectively, with an annealing temperature of 57 °C, producing a 225 bp segment. A total volume of 20 µL reaction mixture, which contained 10 µL Master Mix, 1 µL Primer, 2 µL DNA, and 7 µL H2O, was used for amplification DNA. The PCR program was performed using a Palm-cycler PCR machine (Corbett CG1-96) at 57 °C for the let-7 miRNA gene. PCR products were treated by electrophoresis on 1.5% agarose gel at 80 V for 30 min and imaged on an UV Transilluminator unit (Biostep UXFT, Saxony, Germany).
2.2. SSCP Assay
SSCP is a cost-effective method for detecting mutations and has an appropriate sensitivity if fragments from 150 to 300 bp in length are investigated. The PCR products (5 µL) were mixed with 5 µL SSCP buffer (95% formamide, 25 mM EDTA, 0.025% xylene–cyanole, and 0.025% bromophenol blue), and heated at 98 °C for 10 min, and then chilled on ice for 7 min. The denatured DNA samples (2 µL) were then subjected to 12% PAGE (polyacrylamide gel electrophoresis) in 1 × TBE (Tris-borate EDTA) buffer. The prepared acrylamide gel was electrophoresed under 140 V for 15 h at 4 °C. Subsequently, the gel (29:1, acrylamide:bisacrylamide) was stained with 0.1% silver nitrate [14]. Ultimately, the polymorphisms were detected and the PCR products of the different electrophoresis patterns were selected for sequencing. The sequences were visualized using FinchTV software v. 1.4 and blasted using the NCBI online tool (Figure 1).
Figure 1.
SSCP patterns for 3′ UTR of (a) the let-7 miRNA gene (225 bp), and the sequence chromatogram (b) for the let-7 miRNA gene. The chromatogram in the top represents the sequence having SNP, and the chromatogram in the bottom represents the sequence without SNP. A, B, C, D, E and F are different patterns of let-7 miRNA gene polymorphism.
2.3. Statistical Analysis
Data for the litter size of 88 goats were used in the present study. Least squares analysis was used for investigating the effects of different SSCP patterns/SNPs on litter size. Furthermore, the logistic model was applied to detect the effects of a single allele on litter size. The following statistical model was used to fit data for comparing difference of litter size between genotypes and alleles:
where yijlmo is the phenotypic value of litter size; µ is the population mean; Gi is the fixed effect of the genotype (in least-square analysis) or allele (in logistic regression analysis); Aj is the fixed effect of the age of the animal; Kl is the fixed effect of the kidding year; Fm is the effect of inbreeding of each animal (derived from pedigree) as a covariate; and eijlmo is random error. Estimations were achieved using the general linear model procedure (least-square and logistic models) of SAS v. 8.1 (SAS Institute Inc., Cary, NC, USA).
yijlmo = µ + Gi + Aj + Kl + Fm + eijlmo
3. Results
3.1. PCR-SSCP Analysis of the let-7 MiRNA Gene in Markhoz Goats
In the present study, we have used the method introduced by [15,16,17] for the naming of SSCP patterns. In SSCP analysis, electrophoresis of the let-7 miRNA gene revealed six band patterns, including A, B, C, D, E, and F (Figure 1).
3.2. DNA Sequence Analysis
In the let-7c miRNA gene, amplified fragments with different PCR-SSCP patterns were sequenced. After sequencing, the comparison between the sequenced data and the GenBank reference sequence of let-7c (NC_030808.1) was performed. An A to T substitution located five nucleotides downstream of the let-7c miRNA gene was identified.
3.3. Hardy–Weinberg Equilibrium
Detailed information of sample size (32 males and 88 females), genotypic and allelic frequencies, HWE p-value, polymorphic information content (PIC), and heterozygosity (He) of detected SNP in the Markhoz goat population is presented in Table 1. The chi-squared test showed that the let-7c miRNA gene locus was not in HWE (p < 0.05). The PIC value of the let-7c miRNA gene was 0.278, representing a low genetic diversity regarding discovered SNP in the studied population. The observed heterozygosity was 0.042 in let-7c miRNA gene.
Table 1.
Results of Markhoz goat population genetic analysis for identified locus.
3.4. Association Analysis of Polymorphisms of let-7 MiRNA Gene with Litter Size
The least-square analysis for the litter size of five identified genotypes showed no significant effect between patterns of the let-7c miRNA gene (p > 0.05). In let-7c_S, the year of kidding and age of animal have not shown any significant effect (p > 0.05). However, in let-7c_B analysis, the litter size was significantly affected by year of kidding and age of animal (p < 0.05). The LS-Means of all genotypes of each gene are contrasted with each other according to reported p-value in Table 2.
Table 2.
Least square means and standard errors for litter size of different genotypes of detected SNPs in Markhoz goats.
Because goats can have multiple genotype patterns, the sample size and number of goats were different.
For studying the effects of each allele on litter size, the data were analyzed, and results are presented in Table 3.
Table 3.
The parameters of logistic analysis of identified SNP allele effects in Markhoz goats.
We used binary logistic regression for investigating the effects of a single pattern/allele of detected SNPs (Table 4). The result revealed that allele A of the detected SNP on the downstream region of the let-7c miRNA gene did not significantly affect the litter size of goats (p > 0.05), and chi-square analysis confirmed it at a level of 0.05. The results failed to show significant effects of all identified patterns in the let-7c miRNA gene (p > 0.05).
Table 4.
Results of logistic analysis of identified SNP allele effects in Markhoz goats.
4. Discussion
To the best of our knowledge, this is the first study that investigated the effects of possible variants within 3′ UTR region of the let-7c miRNA gene on litter size in Markhoz goats. Because of the small population size of the Markhoz goat, we had to use a small sample size of only 88 adult females for this research. This valuable goat breed has been maintained in the Agricultural Organization of Kurdistan, and their reproductive information was regularly recorded there. For this reason, the sampling situation was difficult, and only 88 goats with 222 records of kidding were available for conducting this study.
In the goat genome, the let-7c miRNA gene is located on chromosome 1. Mammalian ovaries play a key role in the performance of reproduction traits. For example, two miRNAs that may affect litter size regulation are mir-181 and let-7c [9].
Research on characterization and expression analysis of microRNAs in sheep ovaries indicated that specific members of let-7 influence mammalian reproduction, development, cell proliferation, and apoptosis [18].
Another research [19] reported that let-7 miRNA is important for embryo implantation. In addition, work on proliferation of human cells showed that let-7 miRNA is one of the master regulators of the cell proliferation pathway [11]. Results of identification of miRNAs associated with the follicular–luteal transition in the ruminant ovary has been shown; this miRNA family is critical for angiogenesis in the developing process [20]. Specifically, let-7c miRNA can regulates follicle stimulating hormone secretion in mouse follicle cells and follicular development [6,9].
The sequencing of PCR products of all different patterns revealed only an A to T substitution located five nucleotides downstream of the let-7c miRNA gene. The least-square analysis for this variant detected no significant effect on litter size in Markhoz goats.
In let-7c_B, six different genotypes at an identified mutated locus revealed no significant difference at the level of 0.05. Other detected patterns on studied genes in this research failed to have a significant effect on litter size. One possible reason behind the non-significant effect of identified polymorphisms could be the related animals used for the study caused by the small size of the population. According to previous studies, two of five effective ovine miRNAs contributed at four stages of follicular and luteal development [17]. These results led to important information that the let-7c is one of the most influential miRNA on litter size in goats.
5. Conclusions
For investigating the effect of a single allele on litter size, we categorized the data in two low and high litter sizes based on the obtained mean: low if mean of litter size was less than 1.5 and high if mean of litter size was greater than 1.5. Subsequently, the data were used to fit logistic regression analysis to investigate the effect of each allele on litter size. The results of logistic regression confirmed that pattern A of the let-7c miRNA gene did not significantly affect litter size in Markhoz goats.
On the other hand, using binary logistic regression for investigating the effect of each allele on litter size, an A to T substitution was detected in sequencing analysis within 3′ UTR region of the let-7c miRNA gene; however, this study did not reveal a significant effect of this SNP on litter size in Markhoz goats.
Author Contributions
Formal analysis, E.Z.; Writing—Original Draft Preparation, E.Z.; Methodology, A.R. and J.R.; Writing—Review and Editing, M.R. and J.T. All authors have read and agreed to the published version of the manuscript.
Funding
This research received no external funding.
Institutional Review Board Statement
The animals used in the present research were cared for in accordance to the ethical principles and the national norms and standards for conducting medical research in department of Animal Science, University of Kurdistan, Sanandaj, Iran (Protocol code: IR.UOK.REC.1401.017, 7 November 2022).
Informed Consent Statement
Not applicable.
Data Availability Statement
Not applicable.
Acknowledgments
We would like to thank the managers of the Markhoz Goat Performance Testing Station, Shahryar Rashidi and Jamal Kakakhani, who provided us the opportunity for blood sampling from Markhoz goats.
Conflicts of Interest
The authors declare no conflict of interest.
References
- Naicy, T.; Venkatachalapathy, R.; Aravindakshan, T.V.; Raghavan, K.C.; Mini, M.; Shyama, K. Relative abundance of tissue mRNA and association of the single nucleotide polymorphism of the goat NGF gene with prolificacy. Anim. Reprod. Sci. 2016, 173, 42–48. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, G.A.; An, X.P.; Hou, J.X.; Li, L.; Han, D.; Yang, M.M.; Wang, Y.N.; Zhu, G.Q.; Wang, J.G.; Song, Y.X.; et al. Study on polymerization effect of polyembryony genes by SSCP marker and family trees in Chinese goats. Mol. Biol. Rep. 2011, 38, 739–744. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vasudevan, S. Posttranscriptional upregulation by microRNAs. Wiley Interdiscip. Rev. RNA 2012, 3, 311–330. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rodriguez, A.; Griffiths-Jones, S.; Ashurst, J.L.; Bradley, A. Identification of mammalian microRNA host genes and transcription units. Genome Res. 2004, 14, 1902–1910. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, V.N.; Han, J.; Siomi, M.C. Biogenesis of small RNAs in animals. Nat. Rev. Mol. Cell Biol. 2009, 10, 126–139. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zi, X.D.; Lu, J.Y.; Li, M. Identification and comparative analysis of the ovarian microRNAs of prolific and non-prolific goats during the follicular phase using high-throughput sequencing. Sci. Rep. 2017, 7, 1921. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, Y.; Nie, Y.; Zhao, J.; Chen, X.; Ye, M.; Li, Y.; Du, Y.; Cao, J.; Shen, B.; Li, Y. Genetic polymorphism at miR-181a binding site contributes to gastric cancer susceptibility. Carcinogenesis 2012, 33, 2377–2383. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mahmoudi, P.; Rashidi, A.; Rostamzadeh, J.; Razmkabir, M. A novel variant in the promoter region of miR-9 gene strongly affects litter size in Markhoz goats. Theriogenology 2020, 158, 50–57. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, L.; Yin, Z.J.; Feng, Y.F.; Zhang, X.D.; Wu, T.; Ding, Y.Y.; Ye, P.F.; Fu, K.; Zhang, M.Q. Identification and differential expression of microRNAs in the ovaries of pigs (Sus scrofa) with high and low litter sizes. Anim. Genet. 2016, 47, 543–551. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Smits, K.M.; Paranjape, T.; Nallur, S.; Wouters, K.A.D.; Weijenberg, M.P.; Schouten, L.J.; van den Brandt, P.A.; Bosman, F.T.; Weidhaas, J.B.; Engeland, M.V. A Let-7 MicroRNA SNP in the KRAS 3’UTR Is Prognostic in Early-Stage Colorectal Cancer. Clin. Cancer Res. 2011, 17, 723–731. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Johnson, C.D.; Esquela-Kerscher, A.; Stefani, G.; Byrom, M.; Kelnar, K.; Ovcharenko, D.; Wilson, M.; Wang, X.; Shelton, J.; Shingara, J.; et al. The let-7 microRNA represses cell proliferation pathways in human cells. Cancer Res. 2007, 67, 7713–7722. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yao, N.; Lu, C.L.; Zhao, J.J.; Xia, H.F.; Sun, D.G.; Shi, X.Q.; Wang, C.; Li, D.; Cui, Y.; Ma, X. A network of miRNAs expressed in the ovary are regulated by FSH. Front. Biosci. 2009, 14, 3239–3245. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ji, Y.T.; Cao, B.Y. An optimal method of DNA silver staining in polyacrylamide gels. Electrophoresis 2007, 28, 1173–1175. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miller, S.A.; Dykes, D.D.; Polesky, H.F. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1988, 16, 1215. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lan, X.Y.; Chen, H.; Pan, C.Y.; Ming, L.J.; Lei, C.Z.; Hua, L.S.; Zhang, C.L.; Hu, S.R. Polymorphism in growth hormone gene and its association with production traits in goats. J. Appl. Anim. Res. 2007, 32, 55–60. [Google Scholar] [CrossRef] [Scilit]
- Hu, X.C.; Lu, A.J.; Chen, H.; Gao, X.Y.; Xu, H.X.; Zhang, C.L.; Fang, X.T.; Lei, C.H. Preliminary evidence for association of prolactin and prolactin receptor genes with milk production traits in Chinese Holsteins. J. Appl. Anim. Res. 2009, 36, 213–217. [Google Scholar] [CrossRef] [Scilit]
- Bhattacharya, T.K.; Chatterjee, R.N.; Sharm, R.P.; Rajkumar, U.; Niranjan, M. Genetic polymorphism at 5′ flanking region of the prolactin gene and its effect on egg quality traits in naked neck chickens. J. Appl. Anim. Res. 2011, 39, 72–76. [Google Scholar] [CrossRef] [Scilit]
- Shen, H.; Chen, H.Y.; Jia, B.; Han, G.H.; Zhang, Y.S.; Zeng, X.C. Characterization and expression analysis of microRNAs in Qira black sheep and Hetian sheep ovaries using Solexa sequencing. Genet. Mol. Res. 2015, 14, 7356–7367. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chu, B.; Zhong, L.; Dou, S.; Wang, J.; Li, J.; Wang, M.; Shi, Q.; Mei, Y.; Wu, M. miRNA-181 regulates embryo implantation in mice through targeting leukemia inhibitory factor. JMCB 2015, 7, 12–22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McBride, D.; Carre, W.; Sontakke, S.D.; Hogg, C.O.; Law, A.; Donadeu, F.X.; Clinton, M. Identification of miRNAs associated with the follicular-luteal transition in the ruminant ovary. Reproduction 2012, 144, 221–233. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
