Design and Evaluation of a Polypeptide that Mimics the Integrin Binding Site for EDA Fibronectin to Block Profibrotic Cell Activity
Abstract
1. Introduction
2. Results
2.1. Molecular Docking to Predict the Integrin α4β1/β7 Receptor Biding Site for EDA-FN
2.2. Modeling and Synthesis of EDA-FN Blocking Polypeptide
2.3. Evaluation of Polypeptide Cytocompatibility and Antifibrotic Function
2.4. Evaluation of Polypeptide Binding, Blocking Function and Specificity
2.5. Evaluation of Polypeptide Inhibition of Integrin α4β1 Signaling
2.6. Evaluation of Polypeptide Inhibition of Profibrotic Cell Activity
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Generation of Integrin α4β1 Protein Model
4.3. Molecular Docking and Generation of Blocking Peptide Models
4.4. Cell Culture
4.5. Cell Viability Assay
4.6. Real-Time Quantitative Polymerase Chain Reaction (qRT-PCR)
4.7. Isothermal Calorimetry of Peptide Pairs
4.8. Labelling of Peptide with Cy5 and Epifluorescence Assay
4.9. Western Blot
4.10. Coimmunoprecipitation (Co-IP)
4.11. Immunocytochemistry
4.12. Gelatinase Zymography
4.13. Hydroxyproline Assay
4.14. Collagen Gel Contraction Assay
4.15. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| AF38Pep | Antifibrotic 38-amino-acid polypeptide |
| α-SMA | α-smooth muscle actin |
| COL | Collagen |
| Cy5 | Cyanine5 |
| ECM | Extracellular matrix |
| ERK1/2 | Extracellular signal-regulated kinases 1 and 2 |
| EDA | Extra domain A |
| EDB | Extra domain B |
| EDA-FN | EDA fibronectin |
| FAK | Focal adhesion kinase |
| FN | Fibronectin |
| MMP | Matrix metalloproteinase |
| OPN | Osteopontin |
| RGD | Arg-Gly-Asp |
| TGF-β1 | Transforming growth factor-β1 |
| VCAM1 | Vascular cell adhesion protein-1 |
References
- Wynn, T.A.; Ramalingam, T.R. Mechanisms of fibrosis: Therapeutic translation for fibrotic disease. Nat. Med. 2012, 18, 1028–1040. [Google Scholar] [CrossRef] [PubMed]
- Hinz, B. Masters and servants of the force: The role of matrix adhesions in myofibroblast force perception and transmission. Eur. J. Cell Biol. 2006, 85, 175–181. [Google Scholar] [CrossRef] [PubMed]
- Darby, I.; Skalli, O.; Gabbiani, G. Alpha-smooth muscle actin is transiently expressed by myofibroblasts during experimental wound healing. Lab. Investig. 1990, 63, 21–29. [Google Scholar]
- Gabbiani, G. The myofibroblast in wound healing and fibrocontractive diseases. J. Pathol. 2003, 200, 500–503. [Google Scholar] [CrossRef]
- Kissin, E.Y.; Korn, J.H. Fibrosis in scleroderma. Rheum. Dis. Clin. N. Am. 2003, 29, 351–369. [Google Scholar] [CrossRef]
- Yang, R.; Song, Z.; Wu, S.; Wei, Z.; Xu, Y.; Shen, X. Toll-like receptor 4 contributes to a myofibroblast phenotype in cardiac fibroblasts and is associated with autophagy after myocardial infarction in a mouse model. Atherosclerosis. 2018, 279, 23–31. [Google Scholar] [CrossRef]
- Bedossa, P.; Paradis, V. Liver extracellular matrix in health and disease. J. Pathol. 2003, 200, 504–515. [Google Scholar] [CrossRef] [PubMed]
- Chapman, H.A. Disorders of lung matrix remodeling. J. Clin. Investig. 2004, 113, 148–157. [Google Scholar] [CrossRef] [PubMed]
- Eddy, A.A. Molecular basis of renal fibrosis. Pediatr. Nephrol. 2000, 15, 290–301. [Google Scholar] [CrossRef]
- Eyden, B.P. Brief review of the fibronexus and its significance for myofibroblastic differentiation and tumor diagnosis. Ultrastruct. Pathol. 1993, 17, 611–622. [Google Scholar] [CrossRef]
- Wysocki, A.B.; Grinnell, F. Fibronectin profiles in normal and chronic wound fluid. Lab. Investig. 1990, 63, 825–831. [Google Scholar] [PubMed]
- Desmouliere, A.; Geinoz, A.; Gabbiani, F.; Gabbiani, G. Transforming growth factor-beta 1 induces alpha-smooth muscle actin expression in granulation tissue myofibroblasts and in quiescent and growing cultured fibroblasts. J. Cell Biol. 1993, 122, 103–111. [Google Scholar] [CrossRef] [PubMed]
- Rocco, M.; Infusini, E.; Daga, M.G.; Gogioso, L.; Cuniberti, C. Models of fibronectin. EMBO J. 1987, 6, 2343–2349. [Google Scholar] [CrossRef]
- Johnson, K.J.; Sage, H.; Briscoe, G.; Erickson, H.P. The compact conformation of fibronectin is determined by intramolecular ionic interactions. J. Biol. Chem. 1999, 274, 15473–15479. [Google Scholar] [CrossRef]
- Mao, Y.; Schwarzbauer, J.E. Fibronectin fibrillogenesis, a cell-mediated matrix assembly process. Matrix Biol. 2005, 24, 389–399. [Google Scholar] [CrossRef] [PubMed]
- Sens, C.; Huck, K.; Pettera, S.; Uebel, S.; Wabnitz, G.; Moser, M. Fibronectins containing extradomain A or B enhance osteoblast differentiation via distinct integrins. J. Biol. Chem. 2017, 292, 7745–7760. [Google Scholar] [CrossRef]
- Jarnagin, W.R.; Rockey, D.C.; Koteliansky, V.E.; Wang, S.S.; Bissell, D.M. Expression of variant fibronectins in wound healing: Cellular source and biological activity of the EIIIA segment in rat hepatic fibrogenesis. J. Cell Biol. 1994, 127, 2037–2048. [Google Scholar] [CrossRef]
- Muro, A.F.; Chauhan, A.K.; Gajovic, S.; Iaconcig, A.; Porro, F.; Stanta, G. Regulated splicing of the fibronectin EDA exon is essential for proper skin wound healing and normal lifespan. J. Cell Biol. 2003, 162, 149–160. [Google Scholar] [CrossRef]
- Deng, N.; Sanchez, C.G.; Lasky, J.A.; Zhu, D. Detecting splicing variants in idiopathic pulmonary fibrosis from non-differentially expressed genes. PLoS ONE. 2013, 8, e68352. [Google Scholar] [CrossRef]
- Xiang, L.; Xie, G.; Ou, J.; Wei, X.; Pan, F.; Liang, H. The extra domain A of fibronectin increases VEGF-C expression in colorectal carcinoma involving the PI3K/AKT signaling pathway. PLoS ONE 2012, 7, e35378. [Google Scholar] [CrossRef]
- Ou, J.; Deng, J.; Wei, X.; Xie, G.; Zhou, R.; Yu, L. Fibronectin extra domain A (EDA) sustains CD133(+)/CD44(+) subpopulation of colorectal cancer cells. Stem Cell Res. 2013, 11, 820–833. [Google Scholar] [CrossRef]
- Rossnagl, S.; Altrock, E.; Sens, C.; Kraft, S.; Rau, K.; Milsom, M.D. EDA-Fibronectin Originating from Osteoblasts Inhibits the Immune Response against Cancer. PLoS Biol. 2016, 14, e1002562. [Google Scholar] [CrossRef]
- Ffrench-Constant, C.; Van de Water, L.; Dvorak, H.F.; Hynes, R.O. Reappearance of an embryonic pattern of fibronectin splicing during wound healing in the adult rat. J. Cell Biol. 1989, 109, 903–914. [Google Scholar] [CrossRef]
- Kelsh, R.M.; McKeown-Longo, P.J.; Clark, R.A.F. EDA Fibronectin in Keloids Create a Vicious Cycle of Fibrotic Tumor Formation. J. Investig. Dermatol. 2015, 135, 1714–1718. [Google Scholar] [CrossRef]
- Bhattacharyya, S.; Tamaki, Z.; Wang, W.; Hinchcliff, M.; Hoover, P.; Getsios, S. FibronectinEDA promotes chronic cutaneous fibrosis through Toll-like receptor signaling. Sci. Transl. Med. 2014, 6, 232ra50. [Google Scholar] [CrossRef] [PubMed]
- Muro, A.F.; Moretti, F.A.; Moore, B.B.; Yan, M.; Atrasz, R.G.; Wilke, C.A. An essential role for fibronectin extra type III domain A in pulmonary fibrosis. Am. J. Respir. Crit. Care Med. 2008, 177, 638–645. [Google Scholar] [CrossRef] [PubMed]
- Klingberg, F.; Chau, G.; Walraven, M.; Boo, S.; Koehler, A.; Chow, M.L. The fibronectin ED-A domain enhances recruitment of latent TGF-beta-binding protein-1 to the fibroblast matrix. J. Cell Sci. 2018, 131. [Google Scholar] [CrossRef] [PubMed]
- Serini, G.; Bochaton-Piallat, M.L.; Ropraz, P.; Geinoz, A.; Borsi, L.; Zardi, L. The fibronectin domain ED-A is crucial for myofibroblastic phenotype induction by transforming growth factor-beta1. J. Cell Biol. 1998, 142, 873–881. [Google Scholar] [CrossRef] [PubMed]
- Hinz, B.; Mastrangelo, D.; Iselin, C.E.; Chaponnier, C.; Gabbiani, G. Mechanical tension controls granulation tissue contractile activity and myofibroblast differentiation. Am. J. Pathol. 2001, 159, 1009–1020. [Google Scholar] [CrossRef]
- Liao, Y.F.; Gotwals, P.J.; Koteliansky, V.E.; Sheppard, D.; Van De Water, L. The EIIIA segment of fibronectin is a ligand for integrins alpha 9beta 1 and alpha 4beta 1 providing a novel mechanism for regulating cell adhesion by alternative splicing. J. Biol. Chem. 2002, 277, 14467–14474. [Google Scholar] [CrossRef]
- Shinde, A.V.; Bystroff, C.; Wang, C.; Vogelezang, M.G.; Vincent, P.A.; Hynes, R.O. Identification of the peptide sequences within the EIIIA (EDA) segment of fibronectin that mediate integrin alpha9beta1-dependent cellular activities. J. Biol. Chem. 2008, 283, 2858–2870. [Google Scholar] [CrossRef] [PubMed]
- Kohan, M.; Muro, A.F.; White, E.S.; Berkman, N. EDA-containing cellular fibronectin induces fibroblast differentiation through binding to alpha4beta7 integrin receptor and MAPK/Erk 1/2-dependent signaling. FASEB J. 2010, 24, 4503–4512. [Google Scholar] [CrossRef] [PubMed]
- Schaffner, F.; Ray, A.M.; Dontenwill, M. Integrin alpha5beta1, the Fibronectin Receptor, as a Pertinent Therapeutic Target in Solid Tumors. Cancers 2013, 5, 27–47. [Google Scholar] [CrossRef] [PubMed]
- Brown, A.C.; Dysart, M.M.; Clarke, K.C.; Stabenfeldt, S.E.; Barker, T.H. Integrin alpha3beta1 Binding to Fibronectin Is Dependent on the Ninth Type III Repeat. J. Biol. Chem. 2015, 290, 25534–25547. [Google Scholar] [CrossRef]
- Aota, S.; Nomizu, M.; Yamada, K.M. The short amino acid sequence Pro-His-Ser-Arg-Asn in human fibronectin enhances cell-adhesive function. J. Biol. Chem. 1994, 269, 24756–24761. [Google Scholar] [CrossRef]
- Vanterpool, F.A.; Cantini, M.; Seib, F.P.; Salmeron-Sanchez, M. A material-based platform to modulate fibronectin activity and focal adhesion assembly. Biores. Open Access 2014, 3, 286–296. [Google Scholar] [CrossRef]
- Bachman, H.; Nicosia, J.; Dysart, M.; Barker, T.H. Utilizing Fibronectin Integrin-Binding Specificity to Control Cellular Responses. Adv. Wound Care 2015, 4, 501–511. [Google Scholar] [CrossRef]
- Shinde, A.V.; Kelsh, R.; Peters, J.H.; Sekiguchi, K.; Van De Water, L.; McKeown-Longo, P.J. The alpha4beta1 integrin and the EDA domain of fibronectin regulate a profibrotic phenotype in dermal fibroblasts. Matrix Biol. 2015, 41, 26–35. [Google Scholar] [CrossRef]
- Villa, A.; Trachsel, E.; Kaspar, M.; Schliemann, C.; Sommavilla, R.; Rybak, J.N. A high-affinity human monoclonal antibody specific to the alternatively spliced EDA domain of fibronectin efficiently targets tumor neo-vasculature in vivo. Int. J. Cancer 2008, 122, 2405–2413. [Google Scholar] [CrossRef]
- Ziffels, B.; Grotsch, A.; Al-Bayati, L.; Neri, D. Targeted delivery of calreticulin to ED-A fibronectin leads to tumor-growth retardation. J. Biotechnol. 2019, 290, 53–58. [Google Scholar] [CrossRef]
- Femel, J.; Huijbers, E.J.; Saupe, F.; Cedervall, J.; Zhang, L.; Roswall, P. Therapeutic vaccination against fibronectin ED-A attenuates progression of metastatic breast cancer. Oncotarget 2014, 5, 12418–12427. [Google Scholar] [CrossRef]
- Sens, C.; Altrock, E.; Rau, K.; Klemis, V.; von Au, A.; Pettera, S. An O-Glycosylation of Fibronectin Mediates Hepatic Osteodystrophy Through α4β1 Integrin. J. Bone Miner Res. 2017, 32, 70–81. [Google Scholar] [CrossRef]
- Zhao, X.-K.; Cheng, Y.; Cheng, M.L.; Yu, L.; Mu, M.; Li, H.; Liu, Y.; Zhang, B.; Yao, Y.; Guo, H.; et al. Focal Adhesion Kinase Regulates Fibroblast Migration via Integrin beta-1 and Plays a Central Role in Fibrosis. Sci. Rep. 2016, 6, 19276. [Google Scholar] [CrossRef]
- Hsia, D.A.; Lim, S.T.; Bernard-Trifilo, J.A.; Mitra, S.K.; Tanaka, S.; den Hertog, J. Integrin alpha4beta1 promotes focal adhesion kinase-independent cell motility via alpha4 cytoplasmic domain-specific activation of c-Src. Mol. Cell Biol. 2005, 25, 9700–9712. [Google Scholar] [CrossRef]
- Clark, E.A.; Hynes, R.O. Ras activation is necessary for integrin-mediated activation of extracellular signal-regulated kinase 2 and cytosolic phospholipase A2 but not for cytoskeletal organization. J. Biol. Chem. 1996, 271, 14814–14818. [Google Scholar] [CrossRef] [PubMed]
- Midgley, A.C.; Rogers, M.; Hallett, M.B.; Clayton, A.; Bowen, T.; Phillips, A.O. Transforming growth factor-beta1 (TGF-beta1)-stimulated fibroblast to myofibroblast differentiation is mediated by hyaluronan (HA)-facilitated epidermal growth factor receptor (EGFR) and CD44 co-localization in lipid rafts. J. Biol. Chem. 2013, 288, 14824–14838. [Google Scholar] [CrossRef] [PubMed]
- Yan, Y.; Jiang, F.; Lai, Y.; Wang, H.; Liu, A.; Wang, C. Effect of Thyrotropin on Osteopontin, Integrin alphavbeta3, and VCAM-1 in the Endothelium via Activation of Akt. Int. J. Mol. Sci. 2016, 17, 1484. [Google Scholar] [CrossRef] [PubMed]
- Maity, G.; Fahreen, S.; Banerji, A.; Roy Choudhury, P.; Sen, T.; Dutta, A. Fibronectin-integrin mediated signaling in human cervical cancer cells (SiHa). Mol. Cell. Biochem. 2010, 336, 65–74. [Google Scholar] [CrossRef] [PubMed]
- Moore, C.; Shen, X.D.; Gao, F.; Busuttil, R.W.; Coito, A.J. Fibronectin-alpha4beta1 integrin interactions regulate metalloproteinase-9 expression in steatotic liver ischemia and reperfusion injury. Am. J. Pathol. 2007, 170, 567–577. [Google Scholar] [CrossRef] [PubMed]
- Pal, S.; Ganguly, K.K.; Moulik, S.; Chatterjee, A. Modulation of MMPs by cell surface integrin receptor alpha5beta1. Anticancer Agents Med. Chem. 2012, 12, 726–732. [Google Scholar] [CrossRef] [PubMed]
- Avery, D.; Govindaraju, P.; Jacob, M.; Todd, L.; Monslow, J.; Pure, E. Extracellular matrix directs phenotypic heterogeneity of activated fibroblasts. Matrix Biol. 2018, 67, 90–106. [Google Scholar] [CrossRef] [PubMed]
- Midgley, A.C.; Duggal, L.; Jenkins, R.; Hascall, V.; Steadman, R.; Phillips, A.O. Hyaluronan regulates bone morphogenetic protein-7-dependent prevention and reversal of myofibroblast phenotype. J. Biol. Chem. 2015, 290, 11218–11234. [Google Scholar] [CrossRef]
- Matthijs Blankesteijn, W. Has the search for a marker of activated fibroblasts finally come to an end? J. Mol. Cell Cardiol. 2015, 88, 120–123. [Google Scholar] [CrossRef]
- Sun, X.; Fa, P.; Cui, Z.; Xia, Y.; Sun, L.; Li, Z. The EDA-containing cellular fibronectin induces epithelial-mesenchymal transition in lung cancer cells through integrin alpha9beta1-mediated activation of PI3-K/AKT and Erk1/2. Carcinogenesis 2014, 35, 184–191. [Google Scholar] [PubMed]
- Menon, M.C.; Ross, M.J. Epithelial-to-mesenchymal transition of tubular epithelial cells in renal fibrosis: A new twist on an old tale. Kidney Int. 2016, 89, 263–266. [Google Scholar] [CrossRef]
- Julier, Z.; Martino, M.M.; de Titta, A.; Jeanbart, L.; Hubbell, J.A. The TLR4 agonist fibronectin extra domain A is cryptic, exposed by elastase-2; use in a fibrin matrix cancer vaccine. Sci. Rep. 2015, 5, 8569. [Google Scholar] [CrossRef]
- Kelsh-Lasher, R.M.; Ambesi, A.; Bertram, C.; McKeown-Longo, P.J. Integrin alpha4beta1 and TLR4 Cooperate to Induce Fibrotic Gene Expression in Response to Fibronectin’s EDA Domain. J. Investig. Dermatol. 2017, 137, 2505–2512. [Google Scholar] [CrossRef]
- Ou, J.J.; Wu, F.; Liang, H.J. Colorectal tumor derived fibronectin alternatively spliced EDA domain exserts lymphangiogenic effect on human lymphatic endothelial cells. Cancer Biol. Ther. 2010, 9, 186–191. [Google Scholar] [CrossRef][Green Version]
- Olsen, A.L.; Sackey, B.K.; Marcinkiewicz, C.; Boettiger, D.; Wells, R.G. Fibronectin extra domain-A promotes hepatic stellate cell motility but not differentiation into myofibroblasts. Gastroenterology 2012, 142, 928–937.e3. [Google Scholar] [CrossRef]
- Kawelke, N.; Vasel, M.; Sens, C.; von Au, A.; Dooley, S.; Nakchbandi, I.A. Fibronectin protects from excessive liver fibrosis by modulating the availability of and responsiveness of stellate cells to active TGF-β. PLoS ONE 2011, 6, e28181. [Google Scholar] [CrossRef] [PubMed]
- Iwasaki, A.; Sakai, K.; Moriya, K.; Sasaki, T.; Keene, D.R.; Akhtar, R. Molecular Mechanism Responsible for Fibronectin-controlled Alterations in Matrix Stiffness in Advanced Chronic Liver Fibrogenesis. J. Biol. Chem. 2016, 291, 72–88. [Google Scholar] [CrossRef] [PubMed]
- Hinz, B.; McCulloch, C.A.; Coelho, N.M. Mechanical regulation of myofibroblast phenoconversion and collagen contraction. Exp. Cell Res. 2019, 379, 119–128. [Google Scholar] [CrossRef] [PubMed]
- Dally, J.; Khan, J.S.; Voisey, A.; Charalambous, C.; John, H.L.; Woods, E.L. Hepatocyte Growth Factor Mediates Enhanced Wound Healing Responses and Resistance to Transforming Growth Factor-beta(1)-Driven Myofibroblast Differentiation in Oral Mucosal Fibroblasts. Int. J. Mol. Sci. 2017, 18, 1843. [Google Scholar] [CrossRef] [PubMed]
- Midgley, A.C.; Oltean, S.; Hascall, V.; Woods, E.L.; Steadman, R.; Phillips, A.O. Nuclear hyaluronidase 2 drives alternative splicing of CD44 pre-mRNA to determine profibrotic or antifibrotic cell phenotype. Sci. Signal. 2017, 10. [Google Scholar] [CrossRef] [PubMed]
- Saladin, A.; Rey, J.; Thevenet, P.; Zacharias, M.; Moroy, G.; Tuffery, P. PEP-SiteFinder: A tool for the blind identification of peptide binding sites on protein surfaces. Nucleic Acids Res. 2014, 42, W221–W226. [Google Scholar] [CrossRef]
- Thevenet, P.; Shen, Y.; Maupetit, J.; Guyon, F.; Derreumaux, P.; Tuffery, P. PEP-FOLD: An updated de novo structure prediction server for both linear and disulfide bonded cyclic peptides. Nucleic Acids Res. 2012, 40, W288–W293. [Google Scholar] [CrossRef]
- Shen, Y.; Maupetit, J.; Derreumaux, P.; Tuffery, P. Improved PEP-FOLD Approach for Peptide and Miniprotein Structure Prediction. J. Chem. Theory Comput. 2014, 10, 4745–4758. [Google Scholar] [CrossRef]
- Lamiable, A.; Thevenet, P.; Rey, J.; Vavrusa, M.; Derreumaux, P.; Tuffery, P. PEP-FOLD3: Faster de novo structure prediction for linear peptides in solution and in complex. Nucleic Acids Res. 2016, 44, W449–W454. [Google Scholar] [CrossRef]










| Mode | Score | Subunit | Integrin Amino Acid in Contact (≤3 Å) |
|---|---|---|---|
| 1 | −5.0 | α4 | E121, D123, *N124, *K149, I154, K155, *N156, E157, *N158, *K159, F191, G192 |
| β1 | V192, M193, I196, S197, T198, T199, P200, *A201, *K202, L203, P206, C207, T208, S209, N244, L245, *G291, H312 | ||
| β7 | V201, P203, V205, S206, T207, V208, P209, S210, *K211, L212, P215, C216, P217, T218, *N254, L255, *G301 | ||
| 2 | −4.4 | α4 | E121, D123, *N124, R147, *K149, I154, K155, *N156, *K159, Y220 |
| β1 | Y153, V192, M193, T199, P200, A201, *K202, L203, P206, C207, T208, G243, *N244 | ||
| β7 | V201, P203, P209, S210, *K211, L212, P215, C216, P217, T218, *N254, L255 | ||
| 3 | −3.3 | α4 | I154, K155, *N156, E157, N158, K159, K190, F191, G192 |
| β1 | Y153, T199, P200, *A201, *K202, *R204, *N205, P206, C207, T208, L245 | ||
| β7 | V201, P203, P209, S210, *K211, L212, *R213, P215, C216, T218, L255 | ||
| 4 | −3.1 | α4 | I154, N156, E157, K159, K190, F191, Y220, W221 |
| β1 | S197, T198, P200, A201, *K202, *R204, P206, C207, T208, S209, *N244, L245 | ||
| β7 | V201, P203, P209, S210, *K211, L212, *R213, P215, C216, P217, T218, G253, *N254, L255 | ||
| 5 | −2.6 | α4 | E121, D123, N124, I154, K155, *N156, E157, N158, K159, K190, F191, G192, Y220, W221 |
| β1 | Y153, *S197, T199, P200, *A201, *K202, R204, N205, P206, C207, T208, G243, N244 | ||
| β7 | P209, S210, *K211, L212, *R213, P215, C216, T218, G253, N254 | ||
| 6 | −2.2 | α4 | E121, *N124, R147, I154, K155, *N156, *E157, *N158, *K159 |
| β1 | T191, V192, T198, *T199, P200, A201, K202, L203, T208, G291, G292, H312 | ||
| β7 | T200, V201, L202, *T207, V208, P209, S210, K211, L212, T218, G301 | ||
| 7 | +3.3 | α4 | I154, K155, *N156, N158, *K159, F191 |
| β1 | *T191, V192, *S197, *T198, T199, P200, *A201, K202, L203 | ||
| β7 | *T200, V201, *S206, *T207, V208, P209, S210, *K211, L212 |
| Primer Target | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
|---|---|---|
| hsa_ACTA2 | CCGGGACTAAGACGGGAATC | TTGTCACACACCAAGGCAGT |
| hsa_GAPDH | TCGGAGTCAACGGATTTGGT | TGAAGGGGTCATTGATGGCA |
| mmu_Acta2 | CTGACAGAGGCACCACTGAA | ACAATACCAGTTGTACGTCCAGAG |
| mmu_Col1a1 | CTGGTGAACAGGGTGTTCCT | AAACCTCTCTCGCCTCTTGC |
| mmu_Col3a1 | TGGACCTCCTGGAAAAGATG | GAGCCCTCAGATCCTCTTTCA |
| mmu_Fn1 | ACGGTTTCCCATTACGCCAT | GGCACCATTTAGATGAATCGCA |
| mmu_Eda-Fn1 | GAATCCAGTCCACAGCCATT | TGAACACTGGGTGCTATCCA |
| mmu_Mmp9 | GACTTTTGTGGTCTTCCCCA | AGCGGTACAAGTATGCCTCTG |
| mmu_Tgfb1 | GGCAGCTGTACATTGACTT | CCTTGCTGTACTGTGTGTCC |
| mmu_Ltbp1 | GGGTGTGTGGATGTGAACGA | GCTGACGATCCACACCTGAA |
| mmu_Hic5 | CTATAGCTGGGCAAGTGGTTA | CAAAAGGGAGCCCCATCCTT |
| mmu_Mrtfa | GCACAGGCATGAGACTGAATTG | AGCTTCAACTGCAGCACTGAC |
| mmu_Gapdh | AAGAGGGATGCTGCCCTTAC | TACGGCCAAATCCGTTCACA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, L.; Yan, H.; Tai, Y.; Xue, Y.; Wei, Y.; Wang, K.; Zhao, Q.; Wang, S.; Kong, D.; Midgley, A.C. Design and Evaluation of a Polypeptide that Mimics the Integrin Binding Site for EDA Fibronectin to Block Profibrotic Cell Activity. Int. J. Mol. Sci. 2021, 22, 1575. https://doi.org/10.3390/ijms22041575
Zhang L, Yan H, Tai Y, Xue Y, Wei Y, Wang K, Zhao Q, Wang S, Kong D, Midgley AC. Design and Evaluation of a Polypeptide that Mimics the Integrin Binding Site for EDA Fibronectin to Block Profibrotic Cell Activity. International Journal of Molecular Sciences. 2021; 22(4):1575. https://doi.org/10.3390/ijms22041575
Chicago/Turabian StyleZhang, Lin, Hongyu Yan, Yifan Tai, Yueming Xue, Yongzhen Wei, Kai Wang, Qiang Zhao, Shufang Wang, Deling Kong, and Adam C. Midgley. 2021. "Design and Evaluation of a Polypeptide that Mimics the Integrin Binding Site for EDA Fibronectin to Block Profibrotic Cell Activity" International Journal of Molecular Sciences 22, no. 4: 1575. https://doi.org/10.3390/ijms22041575
APA StyleZhang, L., Yan, H., Tai, Y., Xue, Y., Wei, Y., Wang, K., Zhao, Q., Wang, S., Kong, D., & Midgley, A. C. (2021). Design and Evaluation of a Polypeptide that Mimics the Integrin Binding Site for EDA Fibronectin to Block Profibrotic Cell Activity. International Journal of Molecular Sciences, 22(4), 1575. https://doi.org/10.3390/ijms22041575

