Otoprotective Effects of Zingerone on Cisplatin-Induced Ototoxicity
Abstract
1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Animal Treatments
4.2. Histological Examination
4.3. Quantitative RT-PCR Analysis
4.4. Western Blot Analysis
4.5. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Langer, T.; am Zehnhoff-Dinnesen, A.; Radtke, S.; Meitert, J.; Zolk, O. Understanding platinum-induced ototoxicity. Trends Pharmacol. Sci. 2013, 34, 458–469. [Google Scholar] [CrossRef] [Scilit]
- Garcia-Alcantara, F.; Murillo-Cuesta, S.; Pulido, S.; Bermudez-Munoz, J.M.; Martinez-Vega, R.; Milo, M.; Varela-Nieto, I.; Rivera, T. The expression of oxidative stress response genes is modulated by a combination of resveratrol and N-acetylcysteine to ameliorate ototoxicity in the rat cochlea. Hear. Res. 2018, 358, 10–21. [Google Scholar] [CrossRef] [Scilit]
- Fetoni, A.R.; De Bartolo, P.; Eramo, S.L.; Rolesi, R.; Paciello, F.; Bergamini, C.; Fato, R.; Paludetti, G.; Petrosini, L.; Troiani, D. Noise-induced hearing loss (NIHL) as a target of oxidative stress-mediated damage: Cochlear and cortical responses after an increase in antioxidant defense. J. Neurosci. 2013, 33, 4011–4023. [Google Scholar] [CrossRef] [Scilit]
- Watanabe, K.; Inai, S.; Jinnouchi, K.; Bada, S.; Hess, A.; Michel, O.; Yagi, T. Nuclear-factor kappa B (NF-kappa B)-inducible nitric oxide synthase (iNOS/NOS II) pathway damages the stria vascularis in cisplatin-treated mice. Anticancer Res. 2002, 22, 4081–4085. [Google Scholar]
- Sheth, S.; Mukherjea, D.; Rybak, L.P.; Ramkumar, V. Mechanisms of Cisplatin-Induced Ototoxicity and Otoprotection. Front. Cell. Neurosci 2017, 11, 338. [Google Scholar] [CrossRef] [Scilit]
- Callejo, A.; Sedo-Cabezon, L.; Juan, I.D.; Llorens, J. Cisplatin-Induced Ototoxicity: Effects, Mechanisms and Protection Strategies. Toxics 2015, 3, 268–293. [Google Scholar] [CrossRef] [Scilit]
- So, H.; Kim, H.; Lee, J.H.; Park, C.; Kim, Y.; Kim, E.; Kim, J.K.; Yun, K.J.; Lee, K.M.; Lee, H.Y.; et al. Cisplatin cytotoxicity of auditory cells requires secretions of proinflammatory cytokines via activation of ERK and NF-kappaB. J. Assoc. Res. Otolaryngol. 2007, 8, 338–355. [Google Scholar] [CrossRef] [Scilit]
- Yang, Q.; Sun, G.; Yin, H.; Li, H.; Cao, Z.; Wang, J.; Zhou, M.; Wang, H.; Li, J. PINK1 Protects Auditory Hair Cells and Spiral Ganglion Neurons from Cisplatin-induced Ototoxicity via Inducing Autophagy and Inhibiting JNK Signaling Pathway. Free Radic. Biol. Med. 2018, 120, 342–355. [Google Scholar] [CrossRef] [Scilit]
- Anniko, M.; Sobin, A. Cisplatin: Evaluation of its ototoxic potential. Am. J. Otolaryngol. 1986, 7, 276–293. [Google Scholar] [CrossRef] [Scilit]
- Van Ruijven, M.W.; de Groot, J.C.; Klis, S.F.; Smoorenburg, G.F. The cochlear targets of cisplatin: An electrophysiological and morphological time-sequence study. Hear. Res. 2005, 205, 241–248. [Google Scholar] [CrossRef] [Scilit]
- Hartmann, J.T.; Lipp, H.P. Toxicity of platinum compounds. Expert Opin. Pharmacother. 2003, 4, 889–901. [Google Scholar] [CrossRef]
- Kim, S.J.; Park, C.; Lee, J.N.; Park, R. Protective roles of fenofibrate against cisplatin-induced ototoxicity by the rescue of peroxisomal and mitochondrial dysfunction. Toxicol. Appl. Pharmacol. 2018, 353, 43–54. [Google Scholar] [CrossRef] [Scilit]
- Youn, C.K.; Kim, J.; Jo, E.R.; Oh, J.; Do, N.Y.; Cho, S.I. Protective Effect of Tempol against Cisplatin-Induced Ototoxicity. Int. J. Mol. Sci. 2016, 17, 1931. [Google Scholar] [CrossRef] [Scilit]
- Cobanoglu, H.B.; Vuralkan, E.; Arslan, A.; Mirasoglu, B.; Toklu, A.S. Is Hyperbaric Oxygen Therapy Effective in Cisplatin-Induced Ototoxicity in Rats? Clin. Exp. Otorhinolaryngol. 2019, 12, 66–71. [Google Scholar] [CrossRef] [Scilit]
- Kandemir, F.M.; Yildirim, S.; Caglayan, C.; Kucukler, S.; Eser, G. Protective effects of zingerone on cisplatin-induced nephrotoxicity in female rats. Environ. Sci. Pollut. Res. Int. 2019, 26, 22562–22574. [Google Scholar] [CrossRef] [Scilit]
- Wu, J.; Duan, Y.; Cui, J.; Dong, Y.; Li, H.; Wang, M.; Fan, S.; Li, D.; Li, Y. Protective effects of zingerone derivate on ionizing radiation-induced intestinal injury. J. Radiat. Res. 2019, 60, 740–746. [Google Scholar] [CrossRef] [Scilit]
- Lee, W.; Hwang, M.H.; Lee, Y.; Bae, J.S. Protective effects of zingerone on lipopolysaccharide-induced hepatic failure through the modulation of inflammatory pathways. Chem. Biol. Interact. 2018, 281, 106–110. [Google Scholar] [CrossRef] [Scilit]
- Lee, B.S.; Lee, C.; Yang, S.; Ku, S.K.; Bae, J.S. Renal protective effects of zingerone in a mouse model of sepsis. BMB Rep. 2019, 52, 271–276. [Google Scholar] [CrossRef] [Scilit]
- Alibakhshi, T.; Khodayar, M.J.; Khorsandi, L.; Rashno, M.; Zeidooni, L. Protective effects of zingerone on oxidative stress and inflammation in cisplatin-induced rat nephrotoxicity. Biomed. Pharmacother. 2018, 105, 225–232. [Google Scholar] [CrossRef] [Scilit]
- Mohamed, H.E.; Badawy, M.M.M. Modulatory effect of zingerone against cisplatin or gamma-irradiation induced hepatotoxicity by molecular targeting regulation. Appl. Radiat. Isot. 2019, 154, 108891. [Google Scholar] [CrossRef] [Scilit]
- Soliman, A.F.; Anees, L.M.; Ibrahim, D.M. Cardioprotective effect of zingerone against oxidative stress, inflammation, and apoptosis induced by cisplatin or gamma radiation in rats. Naunyn Schmiedeberg’s Arch. Pharmacol. 2018, 391, 819–832. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaygusuzoglu, E.; Caglayan, C.; Kandemir, F.M.; Yildirim, S.; Kucukler, S.; Kilinc, M.A.; Saglam, Y.S. Zingerone ameliorates cisplatin-induced ovarian and uterine toxicity via suppression of sex hormone imbalances, oxidative stress, inflammation and apoptosis in female wistar rats. Biomed. Pharmacother. 2018, 102, 517–530. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karasawa, T.; Steyger, P.S. An integrated view of cisplatin-induced nephrotoxicity and ototoxicity. Toxicol. Lett. 2015, 237, 219–227. [Google Scholar] [CrossRef] [Scilit]
- Sonawane, V.R.; Siddique, M.U.M.; Gatchie, L.; Williams, I.S.; Bharate, S.B.; Jayaprakash, V.; Sinha, B.N.; Chaudhuri, B. CYP enzymes, expressed within live human suspension cells, are superior to widely-used microsomal enzymes in identifying potent CYP1A1/CYP1B1 inhibitors: Identification of quinazolinones as CYP1A1/CYP1B1 inhibitors that efficiently reverse B[a]P toxicity and cisplatin resistance. Eur. J. Pharm. Sci. 2019, 131, 177–194. [Google Scholar]
- Soobrattee, M.A.; Neergheen, V.S.; Luximon-Ramma, A.; Aruoma, O.I.; Bahorun, T. Phenolics as potential antioxidant therapeutic agents: Mechanism and actions. Mutat. Res. 2005, 579, 200–213. [Google Scholar] [CrossRef] [Scilit]
- Aktan, F. iNOS-mediated nitric oxide production and its regulation. Life Sci. 2004, 75, 639–653. [Google Scholar] [CrossRef] [Scilit]
- Ghosh, S.; May, M.J.; Kopp, E.B. NF-kappa B and Rel proteins: Evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol. 1998, 16, 225–260. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bennouna, S.; Denkers, E.Y. Microbial antigen triggers rapid mobilization of TNF-alpha to the surface of mouse neutrophils transforming them into inducers of high-level dendritic cell TNF-alpha production. J. Immunol. 2005, 174, 4845–4851. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gibbs, B.F.; Wierecky, J.; Welker, P.; Henz, B.M.; Wolff, H.H.; Grabbe, J. Human skin mast cells rapidly release preformed and newly generated TNF-alpha and IL-8 following stimulation with anti-IgE and other secretagogues. Exp. Dermatol. 2001, 10, 312–320. [Google Scholar] [CrossRef] [Scilit]
- Dempsey, P.W.; Doyle, S.E.; He, J.Q.; Cheng, G. The signaling adaptors and pathways activated by TNF superfamily. Cytokine Growth Factor Rev. 2003, 14, 193–209. [Google Scholar] [CrossRef] [Scilit]
- Yang, C.; Kaushal, V.; Shah, S.V.; Kaushal, G.P. Autophagy is associated with apoptosis in cisplatin injury to renal tubular epithelial cells. Am. J. Physiol. Renal. Physiol. 2008, 294, F777–F787. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mukherjea, D.; Jajoo, S.; Whitworth, C.; Bunch, J.R.; Turner, J.G.; Rybak, L.P.; Ramkumar, V. Short interfering RNA against transient receptor potential vanilloid 1 attenuates cisplatin-induced hearing loss in the rat. J. Neurosci. 2008, 28, 13056–13065. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, S.Y.; Jung, G.; Shim, Y.J.; Koo, J.W. The Novel Peptide Vaccine GV1001 Protects Hearing in a Kanamycin-induced Ototoxicity Mouse Model. Otol. Neurotol. 2018, 39, e731–e737. [Google Scholar] [CrossRef] [Scilit]
- Chang, A.; Li, C.; Huang, J.; Pan, W.; Tian, Y.; Tang, J. Auditory Brainstem Response and Outer Hair Cell Whole-cell Patch Clamp Recording in Postnatal Rats. J. Vis. Exp. 2018, 135, e56678. [Google Scholar] [CrossRef] [Scilit]
- Manji, S.S.; Miller, K.A.; Williams, L.H.; Dahl, H.H. Identification of three novel hearing loss mouse strains with mutations in the Tmc1 gene. Am. J. Pathol. 2012, 180, 1560–1569. [Google Scholar] [CrossRef] [Scilit]
- Lee, C.H.; Park, S.S.; Lee, D.H.; Lee, S.M.; Kim, M.Y.; Choi, B.Y.; Kim, S.Y. Tauroursodeoxycholic acid attenuates cisplatin-induced hearing loss in rats. Neurosci. Lett. 2020, 722, 134838. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.Y.; Kim, J.K.; Park, S.H.; Kim, B.G.; Jang, A.S.; Oh, S.H.; Lee, J.H.; Suh, M.W.; Park, M.K. Effects of inhaled particulate matter on the central nervous system in mice. Neurotoxicology 2018, 67, 169–177. [Google Scholar] [CrossRef] [Scilit]





| Gene | Primer Sequence (Forward) | Primer Sequence (Reverse) | Annealing Temperature (°C) | Product Size (bp) | RefSeq Number |
|---|---|---|---|---|---|
| CYP1A1 | 5’- CATCCCCCACAGCACCATAA -3’ | 5’- TTCGCTTGCCCAAACCAAAG -3’ | 60 | 212 | NM_012540.2 |
| CYP1B1 | 5’- TGCTACTCGTTTCGGTCCTG -3’ | 5’- CAAGGCGAGCGAAGTACAAG -3’ | 60 | 162 | NM_012940.2 |
| iNOS | 5’- AGGCCACCTCGGATATCTCT -3’ | 5’- TCTCTGGGTCCTCTGGTCAA -3’ | 60 | 85 | NM_012611.3 |
| NFκB | 5’- TGTCTGCACCTGTTCCAAAGA-3’ | 5’- TGCCAGGTCTGTGAACACTC-3’ | 60 | 143 | NM_199267.2 |
| IL6 | 5’- AGAGACTTCCAGCCAGTTGC-3’ | 5’- TGAAGTCTCCTCTCCGGACT-3’ | 60 | 88 | NM_012589.2 |
| TNFα | 5’- CGTCAGCCGATTTGCCATTT -3’ | 5’- TCCCTCAGGGGTGTCCTTAG -3’ | 60 | 88 | NM_012675.3 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, C.H.; Lee, D.-h.; Lee, S.M.; Kim, S.Y. Otoprotective Effects of Zingerone on Cisplatin-Induced Ototoxicity. Int. J. Mol. Sci. 2020, 21, 3503. https://doi.org/10.3390/ijms21103503
Lee CH, Lee D-h, Lee SM, Kim SY. Otoprotective Effects of Zingerone on Cisplatin-Induced Ototoxicity. International Journal of Molecular Sciences. 2020; 21(10):3503. https://doi.org/10.3390/ijms21103503
Chicago/Turabian StyleLee, Chang Ho, Da-hye Lee, So Min Lee, and So Young Kim. 2020. "Otoprotective Effects of Zingerone on Cisplatin-Induced Ototoxicity" International Journal of Molecular Sciences 21, no. 10: 3503. https://doi.org/10.3390/ijms21103503
APA StyleLee, C. H., Lee, D.-h., Lee, S. M., & Kim, S. Y. (2020). Otoprotective Effects of Zingerone on Cisplatin-Induced Ototoxicity. International Journal of Molecular Sciences, 21(10), 3503. https://doi.org/10.3390/ijms21103503

