Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
4.7
3.5
Journals
Processes
Special Issues
Application of Metal-Based Nanoparticles in Electrochemical Systems
share announcement

Application of Metal-Based Nanoparticles in Electrochemical Systems

A special issue of Processes (ISSN 2227-9717). This special issue belongs to the section "Materials Processes".

Deadline for manuscript submissions: closed (25 September 2022) | Viewed by 8908

Special Issue Editors

Dr. Adina ARVINTE

E-Mail Website
Guest Editor
“Petru Poni” Institute of Macromolecular Chemistry, Centre of Advanced Research in Bionanoconjugates and Biopolymers, 700487 Iasi, Romania
Interests: electrochemistry; electroanalysis; spectroelectrochemistry; electrosynthesis of metal nanoparticles and polymers; electrodeposition; electropolymerization; composite materials; electrochemical sensors and biosensors; electronic transfer
Dr. Laura Micheli

E-Mail Website
Guest Editor
Department of Chemical Science and Technologies, University of Rome Tor Vergata, 00133 Rome, Italy
Interests: electrochemistry; screen printed electrode; immune/biosensor; flow injection assay; liquid chromatography; cultural heritage; food; paper artworks
Special Issues, Collections and Topics in MDPI journals

Special Issue Information

Dear Colleagues,

A wide variety of metal-based nanoparticles, oxide nanoparticles, semiconductor nanoparticles, and even composite nanoparticles have been extensively used in electrochemical applications. Based on their unique properties, metal nanoparticles can play various roles in different electrochemical sensing systems, mainly classified as follows: (i) immobilization of biomolecules; (ii) catalysis of electrochemical reactions; (iii) enhancement of electron transfer; (iv) labeling biomolecules; and (v) acting as reactant. The special physical or chemical properties of nanoparticles have paved the way for improved electrochemical systems that exhibit attractive and promising analytical behaviors.

This Special Issue, "Application of Metal-Based Nanoparticles in Electrochemical Systems”, seeks high-quality works focusing on novel advances in the synthesis, properties, and application of metal-based nanoparticles related to electrochemistry. Topics include, but are not limited to:

  • Electrosynthesis, green synthesis, and characterization of metal nanoparticles;
  • Surface functionalization of electrodes;
  • Electrode/electrolyte interfaces;
  • Redox properties of metal-based nanoparticles;
  • Electrochemical performance of metal-based nanoparticles.

Dr. Adina ARVINTE
Prof. Dr. Laura Micheli
Guest Editors

Manuscript Submission Information

Manuscripts should be submitted online at www.mdpi.com by registering and logging in to this website. Once you are registered, click here to go to the submission form. Manuscripts can be submitted until the deadline. All submissions that pass pre-check are peer-reviewed. Accepted papers will be published continuously in the journal (as soon as accepted) and will be listed together on the special issue website. Research articles, review articles as well as short communications are invited. For planned papers, a title and short abstract (about 100 words) can be sent to the Editorial Office for announcement on this website.

Submitted manuscripts should not have been published previously, nor be under consideration for publication elsewhere (except conference proceedings papers). All manuscripts are thoroughly refereed through a single-blind peer-review process. A guide for authors and other relevant information for submission of manuscripts is available on the Instructions for Authors page. Processes is an international peer-reviewed open access monthly journal published by MDPI.

Please visit the Instructions for Authors page before submitting a manuscript. The Article Processing Charge (APC) for publication in this open access journal is 2400 CHF (Swiss Francs). Submitted papers should be well formatted and use good English. Authors may use MDPI's English editing service prior to publication or during author revisions.

Keywords

  • electrosynthesis and functionalization of nanoparticles
  • electrochemical characterization
  • immobilization techniques
  • functionalization of electrode surfaces
  • electrochemistry of nanostructured materials
  • redox properties

Published Papers (4 papers)

Download All Papers
Order results
Result details
Show export options expand_more Show export options expand_less
Select all
Export citation of selected articles as:

Research

12 pages, 4864 KiB  
Article
Boosting Electrochemical Performance of Hematite Nanorods via Quenching-Induced Alkaline Earth Metal Ion Doping
by Qin Chen, Yanan Chong, Mumin Rao, Ming Su and Yongcai Qiu
Processes 2021, 9(7), 1102; https://doi.org/10.3390/pr9071102 - 24 Jun 2021
Cited by 2 | Viewed by 1411
Abstract
Ion doping in transition metal oxides is always considered to be one of the most effective methods to obtain high-performance electrochemical supercapacitors because of the introduction of defective surfaces as well as the enhancement of electrical conductivity. Inspired by the smelting process, an [...] Read more.
Ion doping in transition metal oxides is always considered to be one of the most effective methods to obtain high-performance electrochemical supercapacitors because of the introduction of defective surfaces as well as the enhancement of electrical conductivity. Inspired by the smelting process, an ancient method, quenching is introduced for doping metal ions into transition metal oxides with intriguing physicochemical properties. Herein, as a proof of concept, α-Fe2O3 nanorods grown on carbon cloths (α-Fe2O3@CC) heated at 400 °C are rapidly put into different aqueous solutions of alkaline earth metal salts at 4 °C to obtain electrodes doped with different alkaline earth metal ions (M-Fe2O3@CC). Among them, Sr-Fe2O3@CC shows the best electrochemical capacitance, reaching 77.81 mF cm−2 at the current of 0.5 mA cm−2, which is 2.5 times that of α-Fe2O3@CC. The results demonstrate that quenching is a feasible new idea for improving the electrochemical performances of nanostructured materials. Full article
(This article belongs to the Special Issue Application of Metal-Based Nanoparticles in Electrochemical Systems)
►▼ Show Figures

Figure 1

12 pages, 4306 KiB  
Article
The Zinc-Air Battery Performance with Ni-Doped MnO2 Electrodes
by Anuradha Chowdhury, Kuan-Ching Lee, Mitchell Shyan Wei Lim, Kuan-Lun Pan, Jyy Ning Chen, Siewhui Chong, Chao-Ming Huang, Guan-Ting Pan and Thomas Chung-Kuang Yang
Processes 2021, 9(7), 1087; https://doi.org/10.3390/pr9071087 - 23 Jun 2021
Cited by 8 | Viewed by 2326
Abstract
A rechargeable zinc-air battery shows great promise because of its high energy density, low cost, greater safety, and its environment-friendly properties. However, rechargeable zinc-air battery development has been hindered by the lack of a satisfactory bi-functional electrode. In this research, we report on [...] Read more.
A rechargeable zinc-air battery shows great promise because of its high energy density, low cost, greater safety, and its environment-friendly properties. However, rechargeable zinc-air battery development has been hindered by the lack of a satisfactory bi-functional electrode. In this research, we report on a solution which uses electro-deposition to dope nickel into manganese on the stainless-steel mesh. The result shows the hydroxyl group on the prepared samples improving its oxygen reduction reaction and oxygen evolution reaction performance, as well as boosting the ion diffusion rate and stabilizing the zinc-air battery charge-discharge performance (overall potential gap dropped from 0.84 V to 0.82 V after 1000 cycles). This study contributes to our understanding of a new method for the improvement of bi-functional electrodes. Full article
(This article belongs to the Special Issue Application of Metal-Based Nanoparticles in Electrochemical Systems)
►▼ Show Figures

Figure 1

16 pages, 5127 KiB  
Article
Impedimetric Microcystin-LR Aptasensor Prepared with Sulfonated Poly(2,5-dimethoxyaniline)–Silver Nanocomposite
by Mawethu Pascoe Bilibana, Usisipho Feleni, Avril Rae Williams and Emmanuel Iwuoha
Processes 2021, 9(1), 179; https://doi.org/10.3390/pr9010179 - 19 Jan 2021
Cited by 9 | Viewed by 2483
Abstract
This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine; R, l-arginine) (MC-LR) containing a 5′ thiolated 60-mer DNA aptamer (i.e., 5′-SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3′). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle [...] Read more.
This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine; R, l-arginine) (MC-LR) containing a 5′ thiolated 60-mer DNA aptamer (i.e., 5′-SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3′). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle (Ag0) on a glassy carbon electrode (GCE), i.e., (GCE/PDMA–PVS–Ag0) was used in the biosensor development. Small-angle X-ray scattering (SAXS) spectroscopic analysis revealed that the PDMA–PVS–Ag0 nanocomposites were polydispersed and contained embedded Ag0. Electrochemical impedance spectroscopy (EIS) responses of the aptasensor gave a dynamic linear range (DLR) and limit of detection (LOD) values of 0.01–0.1 ng L−1 MC-LR and 0.003 ng L−1 MC-LR, respectively. The cross-reactivity studies, which was validated with enzyme-linked immunosorbent assay (ELISA), showed that the aptasensor possesses excellent selectivity for MC-LR. Full article
(This article belongs to the Special Issue Application of Metal-Based Nanoparticles in Electrochemical Systems)
►▼ Show Figures

Figure 1

13 pages, 3145 KiB  
Article
Sequential Photodamage Driven by Chaotic Systems in NiO Thin Films and Fluorescent Human Cells
by Hilario Martines-Arano, Mónica Araceli Vidales-Hurtado, Samara Palacios-Barreto, Martín Trejo-Valdez, Blanca Estela García-Pérez and Carlos Torres-Torres
Processes 2020, 8(11), 1377; https://doi.org/10.3390/pr8111377 - 29 Oct 2020
Cited by 4 | Viewed by 1940
Abstract
A laser ablation process assisted by the feedback of a sensor with chaotic electronic modulation is reported. A synchronous bistable logic circuit was analyzed for switching optical signals in a laser-processing technique. The output of a T-type flip-flop configuration was employed in the [...] Read more.
A laser ablation process assisted by the feedback of a sensor with chaotic electronic modulation is reported. A synchronous bistable logic circuit was analyzed for switching optical signals in a laser-processing technique. The output of a T-type flip-flop configuration was employed in the photodamage of NiO films. Multiphotonic effects involved in the ablation threshold were evaluated by a vectorial two-wave mixing method. A photoinduced thermal phenomenon was identified as the main physical mechanism responsible for the nonlinearity of index under nanosecond irradiation at 532 nm wavelength. Comparative experiments for destroying highly transparent human cells were carried out. Potential applications for developing hierarchical functions yielding laser-induced controlled explosions with immediate applications for biomedical photothermal processes can be contemplated. Full article
(This article belongs to the Special Issue Application of Metal-Based Nanoparticles in Electrochemical Systems)
►▼ Show Figures

Graphical abstract

Show export options expand_more Show export options expand_less
Select all
Export citation of selected articles as:
 
Displaying articles 1-4
Back to TopTop