ijms-logo

Journal Browser

Journal Browser

Research on Transcriptional Regulation in Reproductive Biology

A special issue of International Journal of Molecular Sciences (ISSN 1422-0067). This special issue belongs to the section "Molecular Biology".

Deadline for manuscript submissions: closed (20 August 2025) | Viewed by 5461

Special Issue Editor

Department of Animal Anatomy and Physiology, Faculty of Biology and Biotechnology, University of Warmia and Mazury in Olsztyn, Oczapowskiego St. 1A, 10-719 Olsztyn, Poland
Interests: reproductive biology; molecular biology; signaling pathways; cell biology; cell culture; biotech-nology; cancer biology; pharmacology; genetic engineering; signal transduction; omics techniques
Special Issues, Collections and Topics in MDPI journals

Special Issue Information

Dear Colleagues,

We are pleased to announce that we have launched a new Special Issue entitled “Research on Transcriptional Regulation in Reproductive Biology”. Knowledge of molecular mechanisms underlying reproductive processes is fundamental for the progress in the approaches constituting the groundwork for future research in reproductive biology. Transcriptional regulation is a crucial biological process that enables cellular response to a variety of intra- and extra-cellular signals, to maintain the proper functioning of the cell throughout its lifetime. This Special Issue welcomes any submissions that push forward our understanding of transcriptional regulations in female and male reproduction in both model organisms and human studies. We welcome studies presenting results at the molecular level that shed light on the molecular mechanisms of ovarian, uterine and testicular biology, control of reproduction, gametogenesis, fertilization, embryo development, embryo-uterus interaction, reproductive development, reproductive immunology and medicine etc. Research areas may include studies concerning both physiology as well as pathology of reproductive processes. Original research articles (in vitro and in vivo studies) and reviews are welcome. We look forward to receiving your contributions.

Dr. Anna Nynca
Guest Editor

Manuscript Submission Information

Manuscripts should be submitted online at www.mdpi.com by registering and logging in to this website. Once you are registered, click here to go to the submission form. Manuscripts can be submitted until the deadline. All submissions that pass pre-check are peer-reviewed. Accepted papers will be published continuously in the journal (as soon as accepted) and will be listed together on the special issue website. Research articles, review articles as well as short communications are invited. For planned papers, a title and short abstract (about 250 words) can be sent to the Editorial Office for assessment.

Submitted manuscripts should not have been published previously, nor be under consideration for publication elsewhere (except conference proceedings papers). All manuscripts are thoroughly refereed through a single-blind peer-review process. A guide for authors and other relevant information for submission of manuscripts is available on the Instructions for Authors page. International Journal of Molecular Sciences is an international peer-reviewed open access semimonthly journal published by MDPI.

Please visit the Instructions for Authors page before submitting a manuscript. There is an Article Processing Charge (APC) for publication in this open access journal. For details about the APC please see here. Submitted papers should be well formatted and use good English. Authors may use MDPI's English editing service prior to publication or during author revisions.

Keywords

  • reproductive biology
  • molecular research
  • transcriptional regulations
  • signaling pathways
  • gene expression
  • cell biology

Benefits of Publishing in a Special Issue

  • Ease of navigation: Grouping papers by topic helps scholars navigate broad scope journals more efficiently.
  • Greater discoverability: Special Issues support the reach and impact of scientific research. Articles in Special Issues are more discoverable and cited more frequently.
  • Expansion of research network: Special Issues facilitate connections among authors, fostering scientific collaborations.
  • External promotion: Articles in Special Issues are often promoted through the journal's social media, increasing their visibility.
  • Reprint: MDPI Books provides the opportunity to republish successful Special Issues in book format, both online and in print.

Further information on MDPI's Special Issue policies can be found here.

Published Papers (3 papers)

Order results
Result details
Select all
Export citation of selected articles as:

Research

23 pages, 2877 KB  
Article
Analysis of Transcript Expression and Core Promoter DNA Sequences of Brain, Adipose Tissues and Testis in Human and Fruit Fly
by Viktor Vedelek, Peter Juma Ochieng, Anna Vágvölgyi, Olga Nagy, János Zádori and Rita Sinka
Int. J. Mol. Sci. 2025, 26(22), 11114; https://doi.org/10.3390/ijms262211114 - 17 Nov 2025
Cited by 1 | Viewed by 922
Abstract
Gene expression plays a fundamental role in defining the characteristics of living organisms. To deepen our understanding of tissue-specific gene expression, we analyzed transcript variant enrichment across different tissues in human and Drosophila melanogaster. Datasets are widely accessible for both of these [...] Read more.
Gene expression plays a fundamental role in defining the characteristics of living organisms. To deepen our understanding of tissue-specific gene expression, we analyzed transcript variant enrichment across different tissues in human and Drosophila melanogaster. Datasets are widely accessible for both of these organisms. Given the substantial volume of available information, we have focused our interest on three fundamentally distinct tissues: the brain, where both neuronal and glial cells exhibit a relatively high cellular surface area, thus requiring a large amount of lipids; the adipose tissue, which is well-known for lipid storage; and the testis, which contains a massive number of developing spermatids with high membrane requirement. These three organs have fundamental differences in their structure and function yet share some common features; they all have lipid-rich cells and have special metabolic pathways. Most studies focus on gene expression, and transcript level analyses are less common; therefore, we aimed to characterize the transcript profiles of these tissues and examine evolutionarily conserved pathways between humans and Drosophila. Additionally, we analyzed the flanking sequences of transcriptional start sites of tissue-enriched transcripts. Our findings suggest that Drosophila tissues exhibit more distinct regulation of gene expression in individual tissues (weaker correlation in expression and variable nucleotide content in core promoter), whereas human gene expression is more generalized, likely relying more heavily on distal regulatory elements for tissue-specific expression. Through network analysis, summarizing tissue specificity, physical interactions, and orthologue data, we identified shared central pathways among these tissues. A relatively large network was observable in the testis, where the ubiquitin proteasome system, various kinases and transcription factors showed central position in both organisms. Additionally, we highlighted the evolutionary potential of highly enriched testis-specific transcripts. This work provides valuable insights into the mechanisms underlying tissue-specific gene expression and evolutionary conservation. Full article
(This article belongs to the Special Issue Research on Transcriptional Regulation in Reproductive Biology)
Show Figures

Graphical abstract

21 pages, 3834 KB  
Article
Identification of Novel 58-5p and SREBF1 Interaction and Effects on Apoptosis of Ovine Ovarian Granulosa Cell
by Ruochen Yang, Yong Wang, Sicong Yue, Yueqin Liu, Yingjie Zhang and Chunhui Duan
Int. J. Mol. Sci. 2025, 26(2), 576; https://doi.org/10.3390/ijms26020576 - 11 Jan 2025
Cited by 4 | Viewed by 1413
Abstract
High concentrations of prolactin (PRL)-induced ovine ovarian granulosa cell (GCs) apoptosis and MAPK12 could aggravate the induced effect. However, the molecular mechanisms that MAPK12-induced GC apoptosis and repressed steroid hormone secretion remain unclear. In this study, GCs in the P group (GCs [...] Read more.
High concentrations of prolactin (PRL)-induced ovine ovarian granulosa cell (GCs) apoptosis and MAPK12 could aggravate the induced effect. However, the molecular mechanisms that MAPK12-induced GC apoptosis and repressed steroid hormone secretion remain unclear. In this study, GCs in the P group (GCs with high PRL concentration: 500 ng/mL PRL) and P-10 group (GCs with 500 ng/mL PRL infected by lentiviruses carrying overexpressed sequences of MAPK12) were collected for whole-transcriptome analysis. Then, we applied the miRNA mimics combined with a dual-luciferase reporter gene assay to explore the molecular mechanisms through which MAPK12 affected GC apoptosis and steroid hormones secretion. The whole-transcriptome analysis indicated that MAPK12 regulated high PRL concentration GC apoptosis and steroid hormone secretion mainly through novel 58. The expression of pro-apoptotic proteins Caspase 3 and Bax was increased, while the expression of anti-apoptotic protein BCL-2 declined by novel 58-5p in high PRL concentration GCs (p < 0.05); The secretion of steroid hormones and genes associated with steroid secretion (CYP11A1, 3β-HSD and CYP19A1) decreased (p < 0.05), while the protein expression of the target gene, SREBF1 of novel 58, was repressed by novel 58-5p in high PRL concentration GCs (p < 0.05). Dual-luciferase reporter gene analysis showed that SREBF1 was confirmed as a target gene of novel 58-5p and the negative feedback interaction was established between novel 58-5p and SREBF1. The ggccggctgggggattgccg sequence may be the target site of SREBF1, targeted by novel 58-5p. In addition, steroid hormone secretion was reduced and GC apoptosis was suppressed after the interference of SREBF1 in ovine ovarian GCs with high PRL concentration. In conclusion, novel 58-5p regulated ovine ovarian GC apoptosis and steroid hormone secretion by targeting SREBF1. Full article
(This article belongs to the Special Issue Research on Transcriptional Regulation in Reproductive Biology)
Show Figures

Figure 1

14 pages, 2840 KB  
Article
Regulation of Bone Morphogenetic Protein Receptor Type II Expression by FMR1/Fragile X Mental Retardation Protein in Human Granulosa Cells in the Context of Poor Ovarian Response
by Xuan Phuoc Nguyen, Adriana Vilkaite, Ulrike Bender, Jens E. Dietrich, Katrin Hinderhofer, Thomas Strowitzki and Julia Rehnitz
Int. J. Mol. Sci. 2024, 25(19), 10643; https://doi.org/10.3390/ijms251910643 - 3 Oct 2024
Cited by 3 | Viewed by 2272
Abstract
Fragile X mental retardation protein (FMRP) is a translational repressor encoded by FMR1. It targets bone morphogenetic protein receptor type II (BMPR2), which regulates granulosa cell (GC) function and follicle development. However, whether this interaction affects folliculogenesis remains unclear. Therefore, this study [...] Read more.
Fragile X mental retardation protein (FMRP) is a translational repressor encoded by FMR1. It targets bone morphogenetic protein receptor type II (BMPR2), which regulates granulosa cell (GC) function and follicle development. However, whether this interaction affects folliculogenesis remains unclear. Therefore, this study investigated the potential effect of FMRP-BMPR2 dysregulation in ovarian reserves and infertility. COV434 cells and patient-derived GCs were used to evaluate FMRP and BMPR2 expression. Similarly, FMR1, BMPR2, LIMK1, and SMAD expression were evaluated in GCs with normal (NOR) and poor (POR) ovarian responses. FMRP and BMPR2 were expressed in both cell types. They were co-localized to the nuclear membrane of COV434 cells and cytoplasm of primary GCs. FMR1 silencing increased the mRNA and protein levels of BMPR2. However, the mRNA levels of FMR1 and BMPR2 were significantly lower in the POR group. FMR1 and BMPR2 levels were strongly positively correlated in the NOR group but weakly correlated in the POR group. Additionally, SMAD9 expression was significantly reduced in the POR group. This study highlights the crucial role of FMR1/FMRP in the regulation of BMPR2 expression and its impact on ovarian function. These findings indicate that the disruption of FMRP-BMPR2 interactions may cause poor ovarian responses and infertility. Full article
(This article belongs to the Special Issue Research on Transcriptional Regulation in Reproductive Biology)
Show Figures

Figure 1

Back to TopTop