Simple Summary
Pineapple residue (PR) is a potential feed for ruminants, providing a rich source of fiber, protein, and water-soluble carbohydrates. However, PR has high water content, which may make storage difficult. For ruminants, corn straw (CS) is a common source of roughage, and it is often used for silage. Mixed ensiling of PR with CS may provide a solution to the problem of PR being difficult to preserve. The aim of this study was to evaluate the chemical composition, fermentation quality, and microbial community of CS silage mixed with PR. Mixed CS with appropriate PR silage showed a lower pH value and higher lactate acid and acetic acid content. Also, the addition of PR lead to an increase in the relative abundance of Lactobacillus in mixed silage.
Abstract
The effects of pineapple residue (PR) on fermentation quality, chemical composition, and bacterial community of corn straw (CS) silage were evaluated. CS was ensiled with 0% control group (CON), 15% (P1), 30% (P2), and 45% (P3) PR on a fresh matter (FM) basis for 45 days. P3 had lower dry matter (DM) and crude protein (CP) contents but higher ammonia-N (NH3-N) content than the other three groups (p < 0.05). Compared with the other groups, P1 had lower a pH and higher lactic acid and acetic acid contents (p < 0.05). The lactic acid bacteria count in P1 was higher than in P2 and P3 (p < 0.05); the number of yeast in P2 was higher than in the other groups (p < 0.05). With the increasing proportion of PR addition, the relative abundance of Lactobacillus gradually increased, and the dominant genus in P3 was Acetobacter. In summary, the addition of PR can improve the quality of CS silage, and the optimum addition ratio for PR was 15% on a FM basis.
1. Introduction
Corn straw (CS) is a major field crop residue produced in large amounts that is rich in carbohydrates (cellulose and hemicellulose) and provides good roughage sources for ruminants [1,2]. However, large amounts of CS are discarded during the harvest season, leading to low CS utilization and a loss of a valuable feed resource. In order to preserve the quality of roughage, silage is commonly used in dairy farming. CS is one of primary crops for ensiling compared with other silage [3]. Silage of CS may prolong its storage time, increase its utilization efficiency, improve feed palatability, and enhance the production performance of animals [4]. Therefore, by incorporating corn stover into the feed system for ruminants, not only can it effectively utilize agricultural waste resources and reduce feed costs, but it is also expected to improve the production performance and quality of livestock and poultry products. In addition, this practice also helps to solve the environmental problems caused by stover burning, providing an environmentally friendly solution for a sustainable development path. The scientific utilization of corn stover is not only related to the development of agriculture and animal husbandry, but it is also an important contribution to sustainable agriculture and resource recycling.
Pineapple belongs to the Bromeliaceae family and is a high-quality and high-yield tropical fruit in tropical and subtropical regions, known for its aromatic, sweet, and crisp flavor, as well as its rich content of sugars, minerals, and vitamins [5,6,7]. In recent years, China has seen a steady increase in pineapple production, with a total output reaching 1.733 million tons in 2019 [8]. Pineapple residue (PR), which refers to the leftover pineapple peels and residual pulp after pressing juice, canning, or wine making, accounts for approximately 50–70% of the entire fresh fruit weight [9]. PR has similar nutritional content to pineapple pulp, rich in crude protein (CP), ether extract (EE), crude fiber (CF), and vitamin C, making it a good feed resource [10,11]. However, the majority of PR is discarded as waste, resulting in a severe waste of resources and serious environmental pollution [12]. If PR is scientifically and reasonably developed and utilized as animal feed, it can turn waste into treasure and reduce feed costs. Liu et al. found that PR is a high-quality feed resource for cattle with good feed intake and digestion properties [13]. Yang et al. found that the partial substitution of fermented PR for whole corn silage in the diet did not impair or affect the productive performance of goats [14]. Gowda et al. reported that fed dairy cattle with silage pineapple waste could improve lactation productivity [15]. Suksathit et al. reported that pineapple waste silage can improve nutrient digestibility in livestock compared to hay silage [16].
Several studies reported that mixed ensiling improves silage quality and promotes stability of the fermentation process compared to fermentation alone [17,18]. Denek et al. found that tomato pomace silage fermented and preserved well with the addition of wheat straw and wheat grain [19]. Ni et al. found that mixed ensiling of forage soybean with crop corn or sorghum could reduce the pH value, enhance Lactobacillus abundance, and improve the forage soybean silage quality [20]. Li et al. found that mixed silage of the banana pseudostem and fresh maize stover decreased the pH value, Enterobacteriaceae count, yeast, and mold count [21]. Thus, we hypothesized that ensiling CS and PR together could inhibit undesirable fermentation and improve silage fermentation quality. However, to our knowledge, relatively little information is available on the fermentation characteristics and microbial diversity of CS ensiled alone or in combination with PR, and they are poorly understood. These studies showed positive effects of feeding animals with fermented PR, providing strong support for the widespread use of pineapple pomace in ruminant feeding and demonstrating that PR is an ideal feed for ruminants.
Therefore, this experiment aims to assess the effects of adding different ratios of PR on CS silage quality and microbial diversity and ultimately provide a scientific basis for the rational utilization of PR as ruminant feed.
2. Materials and Methods
2.1. Ensiling Materials and Silage Preparation
CS and PR were obtained from the Pasture Research Base of Guangxi Buffalo Research Institute in Nanning, China in May 2023. PR includes pineapple epidermis, leaf crown, and part of fruit pulp. Moreover, the CS refers to the residues remaining after the corn cobs are harvested. This material predominantly includes the green stem and leaves, which are typically at a late vegetative stage. The chemical compositions of CS and PR are listed in Table 1. Fresh CS and PR were cut into 1 to 2 cm pieces. Then, they were spread out flat on the ground to dry out moisture to about 70%. For silage preparation, CS was mixed with varying percentages of PR and ensiled under anaerobic conditions. Silages were prepared using a small-scale system of silage fermentation. Specifically, mixes were prepared with 0% PR (control), 15% PR (P1), 30% PR (P2), and 45% PR (P3), based on fresh matter. Samples were weighed and mixed uniformly according to the specified addition ratios, packed into polyethylene film bags (1000 g per bag), vacuum-sealed using a vacuum packaging machine (DZ500; Gzrifu Co. Ltd., Guangzhou, China), and then stored in the dark at room temperature (20–30 °C). After 45 days, the polyethylene film bag was opened for the test.
Table 1.
Chemical composition of corn straw and pineapple residue.
2.2. Chemical Analysis
The raw material and silage samples (500 g) were subjected to a consistent drying process at 65°C in an oven (LBAO-250; STIK Instrument Equipment shanghai Co., Ltd. Shanghai, China) until they reached a stable weight. Subsequently, they underwent pulverization using a pulverizer (FS200; Guangzhou Bomin Electrical and mechanical equipment Co. Ltd., Guangzhou, China), while ensuring the particles passed through a 1 mm screen for uniformity. To assess the chemical compositions, several analyses were conducted following standard protocols outlined by the AOAC. Specifically, the dry matter (DM), CP, and Ash contents were determined using methods 934.01, 976.05, and 942.05, respectively [22]. Additionally, the neutral detergent fiber (NDF) and acid detergent fiber (ADF) contents were determined according to procedures in Van Soest [23].
2.3. Fermentation Characteristics Analysis
Silage samples (20 g) were mixed with 180 mL of distilled water and stored at 4 °C for 24 h [24]. Then, filtration was carried out using two layers of gauze, and the filtrate was used for determining pH, NH3-N, microbial crude protein (MCP), and organic acid contents. The pH value was assessed using a portable pH meter (pH8180-0-00; Smart sensor Co., Ltd., Dongguan, China). Ammonia-nitrogen (NH3-N) was determined with the phenol-hypochlorite procedure [25]. MCP was determined using procedures described by Bradford [26]. The organic acid contents, including those of lactic acid (LA), acetic acid (AA), propionic acid (PA), and butyric acid (BA), were measured via high-performance liquid chromatography (1260 Infinity II; Agilent Technologies, Inc., Waldbronn, Germany) according to Xie et al. [27]. The specific methods were as follows: Shodex RSpak KC–811 (8.0 mm × 300 mm; Showa Denko K.K., Tokyo, Japan); DAD detector set at 210 nm; elution process was carried out using 3 mmol/L HClO4 as the eluent at a flow rate of 1.0 mL/min; temperature was 50 °C; and sample size was 5.0 μL.
Silage samples (10 g) were blended with 90 mL of sterilized water and serially diluted from 10−1 to 10−5 in sterilized water. Lactic acid bacteria (LAB) were measured by means of a plate count on De Man–Rogosa–Sharpe (MRS) agar (Qingdao Haibo Biotechnology Co., Ltd., Qingdao, China) and incubated at 37 °C for 48 h. Yeast were counted on potato dextrose agar (Qingdao Haibo Biotechnology Co., Ltd.) after incubation for 48 h at 37 °C. Numbers of colonies were considered to indicate the numbers of viable microorganisms (cfu g−1 of fresh matter [FM]) [28].
2.4. Microbial Analysis
Silage samples (15 g) were aseptically combined with 180 mL of sterile phosphate-buffered saline (PBS). This mixture was subsequently incubated at a constant temperature of 37 °C for 2 h under agitation at 200 r/min to ensure that the microbial population mixed into the buffer. Then, the samples were filtered through two layers of a sterile gauze to remove larger particulate matter. A volume of 70 mL of the resulting filtrate was then subjected to centrifugation at 12,000 r/min for 5 min at a temperature of 4 °C. This high-speed centrifugation facilitated the sedimentation of the microbial population, and the supernatant was discarded. Subsequently, it was washed 2 times with sterile PBS to remove any residual impurities. The precipitate was resuspended in 1–2 mL of the same buffer. Genomic DNA was extracted using the cetyltrimethy-lammonium bromide (CTAB) method [29]. DNA samples were sent to Majorbio Bio-pharm Technology Co., Ltd (Shanghai, China) for sequencing and analysis. The V3–V4 regions of the 16S rRNA gene were processed for amplification with the primers. The following primers were used: 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT). For the polymerase chain reactions, we used 4 μL of 5× FastPfu Buffer (TransGen Biotech Co., Ltd., Beijing, China), 2 μL of dNTPs (2.5 mmol·L−1), 0.8 μL of Forward Primer (5 μmol·L−1) (TransGen Biotech Co., Ltd., Beijing, China), 0.8 μL of Reverse Primer (5 μmol·L−1)(TransGen Biotech Co., Ltd., Beijing, China), 0.4 μL of FastPfu Polymerase (TransGen Biotech Co., Ltd., Beijing, China), 0.2 μL of BSA (TransGen Biotech Co., Ltd., Beijing, China), 10 ng of Template DNA (TransGen Biotech Co., Ltd., Beijing, China), and added ddH2O to obtain 20 μL of total volume. The steps included initialization at 95 °C for 3 min, 27 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 45 s, and a final elongation at 72 °C for 10 min. The PCR amplification products were detected via 2% agarose gel electrophoresis [30]. Purified DNA was sequenced on an Illumina MiSeq platform (Illumina, Inc., San Diego, CA, USA) at Majorbio Bio-pharm Technology Co., Ltd. (Shanghai, China). The sequences obtained from the MiSeq platform were processed using QIIME software (version 1.9.1). The sequence data reported in this study were archived in the Sequence Read Archive (SRA) under the accession number PRJNA1060478.
2.5. Statistical Analysis
Data on the fermentative characteristics were analyzed with one-way ANOVA using SPSS (SPSS 26.0 program, SPSS Inc., Chicago, IL, USA). The Alpha diversity index was calculated using Mothur software (version v.1.30.2). The histogram and heatmap were analyzed using R software (version v.3.3.1). There were significant differences only when the probability level was lower than 0.05 (p < 0.05).
3. Results
3.1. Chemical Compositions
The lowest DM content was found in P3, flowed by P2, P1, and CON (p < 0.05) (Table 2). The CP content in P3 was lower than those in CON and P1 (p < 0.05). The differences in NDF and ADF content among all silages were not significant (p > 0.05). The Ash content in P1 was lower than that in P2 and P3 (p < 0.05). The Ca content in P1 was lower than that in CON and P2 (p < 0.05).
Table 2.
The effects of adding pineapple residue on the chemical compositions of corn straw silage.
3.2. Fermentation Quality
P1 had a lower pH value but higher LA and AA content compare with the other group (p < 0.05) (Table 3). PA was not detected in any of the other three groups, except for P3. BA was not detected in any silages. NH3-N content in P3 was higher than in the other groups (p < 0.05). NH3-N content of all silage mixtures tended to increase after the addition of PR, resulting in CON silage having lower NH3-N content than the other silages. The number of LAB in P1 was higher than in P2 and P3 (p < 0.05). The number of yeast in P2 was higher than the other groups (p < 0.05), followed by that in the P3, CON, and P1 silages.
Table 3.
The effects of adding pineapple residue on the fermentation quality of corn straw silage.
3.3. Microbial Analysis
The Shannon index and Simpson index were not significant among the four groups (p > 0.05) (Table 4). The Chao1 index in P3 was higher than in P2 (p < 0.05).
Table 4.
The effects of adding pineapple residue on the microbial analysis of corn straw silage.
At the order level, Lactobacillales and Enterobacterales were the top two dominant genera in terms of relative abundance in the CON, P1, and P2 silages (Figure 1). However, the dominant genus in P3 was Acetobacterales.
Figure 1.
Effects of adding pineapple residue on the order level of microorganisms in corn straw silage. Abbreviations: CON, 100% CS silage; P1, 85% CS + 15% PR silage; P2, 70% CS + 30% PR silage; P3 55% CS + 45% PR silage.
At the genus level, the top two genera in terms of relative abundance in CON, P1, and P2 were Lactobacillus and Pediococcus (Figure 2). The relative abundance of Lactobacillus in CON, P1, and P2 as a proportion of all genera was 87.47%, 90.75%, and 96.21%, respectively.
Figure 2.
Effects of adding pineapple residue on the genus level of microorganisms in corn straw silage. Abbreviations: CON, 100% CS silage; P1, 85% CS + 15% PR silage; P2, 70% CS + 30% PR silage; P3 55% CS + 45% PR silage.
The pH value and NH3-N content were negatively correlated with un-classified_f__Enterobacteriaceae, Weissella, Klebsiella, and Pediococcus (p < 0.05), and positively correlated unclassified_f__Clostridiaceae, Caproiciproducens, and Lysinibacillus (p < 0.05) (Figure 3). MCP content was positively correlated with unclassified_f__Clostridiaceae and Bacillus (p < 0.05). LA and AA contents were positively correlated with unclassified__f__Enterobacteriaceae, Weissella, Klebsiella, and Pediococcus (p < 0.05), and negatively correlated with unclassified__f__Clostridiaceae, Caproiciproducens, and Lysinibacillus (p < 0.05).
Figure 3.
Correlation between relative abundance of bacteria and fermentation parameters at the genus level. Note: Columns in different colors indicate different subgroups; p-values are on the far right; “*” indicates p ≤ 0.05, “**” indicates p ≤ 0.01, and “***” indicates p ≤ 0.001. Abbreviations: CON, 100% CS silage; P1, 85% CS + 15% PR silage; P2, 70% CS + 30% PR silage; P3 55% CS + 45% PR silage.
4. Discussion
Raw materials essential for producing high-quality silage should possess specific characteristics, including appropriate moisture levels and an environment that supports anaerobic conditions [27,28]. In this experiment, we observed that the lowest DM content occurred in P3, with sequentially higher levels in P2, P1, and CON, respectively; additionally, the CP content in P3 was noted to be lower than that in CON and P1. The reason for this result is due to the different chemical composition of the two feedstocks, with PR having lower DM content and CP content compared to CS. Consequently, an increase in the addition of PR to the silage mixture led to a decrease in both DM and CP contents. This is consistent with the findings of Muller et al., who reported that pineapple exhibits elevated levels of fiber and starch but a comparatively low content of CP [31]. According to research by Wang et al., CS can serve as a water absorbent in silage, mitigating the challenge posed by excessive water content in other materials [4]. As a result, the content of DM and CP declined concomitantly with the reduction in the proportion of CS and the increase in the proportion of the PR ratio in the silage. In the current study, the Ash content in P1 was lower than the P2 and P3, indicating that CS silage with 15% PR had the highest organic matter content. Ensiling CS with a certain proportion of PR can be modulated to produce a more nutritionally balanced feed.
Silage, an important nutritional source for herbivores, effectively guarantees a balanced supply of roughage throughout the year [32], which is the most commonly used technology for preserving forage [33]. The principle of silage fermentation is that the LAB attached to the materials, under the right temperature, moisture, and anaerobic conditions, ferments water-soluble carbohydrates into LA and other short-chain volatile fatty acids; as a result, the pH decreases, the growth of harmful microorganisms is inhibited, and the silage is preserved as long as it is not exposed to air [34,35,36,37]. The pH level of silage serves as a critical indicator for assessing its fermentation quality, where lower pH values are indicative of better fermentation quality and enhanced aerobic stability [38]. The value of pH is determined by organic acids, such as LA and AA, which are produced during the silage process. Research has shown that the content of LA is positively correlated with the overall quality of silage; similarly, AA also improves the aerobic stability of silage [39]. In this experiment, P1 exhibited a lower pH value but higher LA content and AA content compared to the other groups. This might be due to the fact that 15% PR creates a suitable environment for the growth and reproduction of benefit microorganisms, which utilize water-soluble carbohydrates to produce substantial amounts of LA under favorable conditions, causing the pH to drop. It indicates that ensiling CS with 15% PR can achieve the best fermentation quality. In this experiment, P3 had the highest pH value, the lowest lactic acid content, and poor fermentation quality, indicating that too much pineapple pomace should not be added to silage. NH3-N content reflects the breakdown of proteins in the silage, with higher values indicating greater protein and amino acid breakdown and lower fermentation quality [40]. In this experiment, as the percentage of PR increased, the content of NH3-N in silage increased, and P3 had the highest NH3-N content. This is possibly due to the bromelain in PR, leading to protein breakdown and the production of NH3-N [41].
LAB, recognized as beneficial bacteria, have the capacity to produce LA during the fermentation process. This production of LA leads to a decrease in the pH value, which effectively inhibits the growth of harmful bacteria [42]. Generally speaking, when the number of LAB reaches at least 105 (cfu/g FM), silage is considered to be well preserved [43]. In this experiment, the detected number of LAB in all groups reached 106 (cfu/g FM), which clearly indicates a successful and good fermentation process in all groups. The addition of an appropriate amount of PR enables the effective preservation of CS silage. Microorganisms play a pivotal role in silage fermentation and can affect silage fermentation through a series of metabolites [44]. Consequently, the structural composition and the abundance of different species of microorganisms present during the fermentation process are intricately linked to the overall quality of silage [45]. The Chao1 index and the Ace index are utilized to measure species richness, indicating the quantity of species [46]. In this experiment, P3 exhibited the highest values for both the Chao1 index and the ACE index. This is possible due to the higher abundance of miscellaneous bacteria in PR, suggesting that an excessive addition (45%) of PR may have adverse effects on fermentation. Furthermore, the Shannon index and the Simpson index were employed to assess species diversity within the microbial community of the silage. These indices are influenced by both the richness and evenness of species within the community. Typically, larger values of these indices indicate a higher diversity of species [47]. In this experiment, the Shannon index and Simpson index were not different among the four groups, indicating that the addition of PR did not widely change the species’ diversity in CS silage.
The most common genera of LAB in silage include Lactobacillus, Streptococcus, Pediococcus, Enterococcus, Lactococcus, Leuconostoc, and Weissella [48]. Lactobacillus can increase LA content, thereby inhibiting the growth and reproduction of harmful microorganism to ensure that the quality of silage is adequate. In this experiment, the relative abundance of Lactobacillus in the CON group was 87.47%, the relative abundance of Lactobacillus increased with the addition of 15% PR to a proportion of 90.75%, and the relative abundance of Lactobacillus reached 96.21% with the addition of 30% PR. This indicates that the addition of an appropriate amount of PR can increase the relative abundance of Lactobacillus and ensure that the quality of silage is adequate. Enterobacterales comprises Gram-negative, facultative anaerobic bacteria that are mainly found in poor silage, and it competes with LAB for the nutrients to grow and reproduce [49]. In this experiment, the relative abundance of Enterobacterales in P1 and P2 was reduced compared with CON. This suggests that the addition of moderate amounts of PR can reduce the relative abundance of harmful bacteria, such as Enterobacterales. In general, the surface of silage materials usually has a high number of microorganisms, such as aerobic bacteria, enterobacteria, yeast, and molds, attached to it. At the beginning, there is still oxygen present in the silage environment when aerobic bacteria grow vigorously. At the same time, Streptococcus, Leuconostoc, and Pediococcus are also active. After lactic acid fermentation, lactic acid bacteria begin to proliferate in large quantities and produce lactic acid; subsequently, with the formation of anaerobic and acidic environments, aerobic- and acid-intolerant microorganisms are gradually reduced, and they are steadily replaced by Lactobacillus and Streptococcus lamellaris together, which are the dominant bacteria in malolactic fermentation. In this experiment, Acetobacter was identified as a major genus in the P3 fermentation process, despite the anaerobic vacuum conditions typically being unsuitable for aerobic bacteria, such as Acetobacter. It is plausible that the presence of Acetobacter in P3 silage could be attributed to residual oxygen trapped within the biomass at the time of sealing. Additionally, the addition of high amounts of PR, which naturally carries Acetobacter as part of its flora, especially from the skin of the fruit, may introduce and support a larger population of these bacteria, even under less-than-ideal conditions. Because of the presence of Acetobacter and a high proportion of PR in P3 silage, the PR surface carries a high number of Acetobacter, which grows and multiplies in large quantities during the initial aerobic fermentation phase of silage fermentation, resulting in a large relative abundance of Acetobacter, which in turn affects the quality of the silage.
Change of the microbial genus and its abundance will affect the generation of fermentation products during ensiling [45]. In this experiment, LA and AA contents were positively correlated with unclassified_f__Enterobacteriaceae, Weissella, Klebsiella, and Pediococcus. However, the pH value and NH3-N content were negatively correlated with unclassified_f__Enterobacteriaceae, Weissella, Klebsiella, and Pediococcus. This suggests that LA, AA, NH3-N content, and pH value are simultaneously affected by them and that increasing their abundance improves fermentation quality.
5. Conclusions
Mixed CS with appropriate PR silage showed a lower pH value and higher LA and AA contents. Also, the addition of PR lead to an increase in the relative abundance of Lactobacillus in mixed silage. Consequently, the addition of PR could enhance CS silage quality, and the optimum addition ratio for PR was 15% on a FM basis.
Author Contributions
Conceptualization, C.Y. and X.W.; methodology, H.X. and F.Z.; software, D.L.; validation, L.P., C.Y. and D.L.; formal analysis, D.L. and X.L.; investigation, C.Y.; resources, C.Y.; data curation, D.L.; writing—original draft preparation, D.L. and X.S.; writing—review and editing, D.L. and H.X.; visualization, F.Z.; supervision, C.Y.; project administration, C.Y.; funding acquisition, C.Y. All authors have read and agreed to the published version of the manuscript.
Funding
This work was financially supported by the Guangxi Natural Science Foundation (Grant No. 2023JJA130137), the National Natural Science Foundation of China (Grant No. 32361143788), the Xinjiang Production and Construction Corps. Key Areas of Technological Research and Development (2023AB008), the Guangxi Dairy Buffalo Innovation Team of National Modern Agricultural Industry Technology System (Grant No. nycytxgxcxtd-2021-21), the Guangxi Science and Technology Major Project (Grant No. GuiKe AA22068099), the 8th Group Key Areas of Technological Research and Development (2023NY03), and the Scientific Research Project of Shihezi University (KJTP202316).
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
The sequence data reported in this study were archived in the Sequence Read Archive (SRA) under the accession number PRJNA1060478.
Conflicts of Interest
The authors declare no conflicts of interest.
References
- Okoye, C.O.; Wu, Y.; Wang, Y.; Gao, L.; Li, X.; Jiang, J. Fermentation profile, aerobic stability, and microbial community dynamics of corn straw ensiled with Lactobacillus buchneri PC-C1 and Lactobacillus plantarum PC1-1. Microbiol. Res. 2023, 270, 127329. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, X.; Wang, F.; Fang, Y.; Zhou, D.; Wang, S.; Wu, D.; Wang, L.; Zhong, R. High-potency white-rot fungal strains and duration of fermentation to optimize corn straw as ruminant feed. Bioresour. Technol. 2020, 312, 123512. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, J.; Fan, X.; Ma, Z.; Huang, X.; Tang, M.; Yin, F.; Zhao, Z.; Gan, S. Silage additives improve fermentation quality, aerobic stability and rumen degradation in mixed silage composed of amaranth and corn straw. Front. Plant Sci. 2023, 14, 1189747. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Song, J.; Liu, Z.; Zhang, G.; Zhang, Y. Fermentation Quality and Microbial Community of Corn Stover or Rice Straw Silage Mixed with Soybean Curd Residue. Animals 2022, 12, 919. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mohd Ali, M.; Hashim, N.; Abd Aziz, S.; Lasekan, O. Pineapple (Ananas comosus): A comprehensive review of nutritional values, volatile compounds, health benefits, and potential food products. Food Res. Int. 2020, 137, 109675. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cascante-Marín, A.; Núñez-Hidalgo, S. A Review of Breeding Systems in the Pineapple Family (Bromeliaceae, Poales). Bot. Rev. 2023, 89, 308–329. [Google Scholar] [CrossRef] [Scilit]
- Li, D.; Jing, M.; Dai, X.; Chen, Z.; Ma, C.; Chen, J. Current status of pineapple breeding, industrial development, and genetics in China. Euphytica 2022, 218, 85. [Google Scholar] [CrossRef] [Scilit]
- NBS. China Statistical Year Book; China Statistics Press: Beijing, China, 2020. Available online: http://www.stats.gov.cn/ (accessed on 22 December 2023).
- Rahma Wulan, I.; Mukh, A.; Endang, P.; Agung, P. Utilization of Pineapple Waste as a Roughage Source Diets for Ruminant: A Review. In Proceedings of the International Conference on Improving Tropical Animal Production for Food Security (ITAPS 2021); Atlantis Press: Paris, France, 2022; pp. 123–130. [Google Scholar]
- Assumi, S.; Jha, S.; Kaur, C. Valorization of pineapple waste for development of animal feed block. Int. J. Curr. Microbiol. Appl. Sci. 2018, 7, 3787–3795. [Google Scholar] [CrossRef] [Scilit]
- Mello, B.L.B.; Fernandes, A.M.; de Oliveira, T.S.; Leonel, F.P.; Glória, L.S.; Silva, R.S.T. Feed intake, digestibility, and energy contents in growing bull fed pineapple crop waste silage in different planes of nutrition. Trop. Anim. Health Prod. 2021, 53, 188. [Google Scholar] [CrossRef] [Scilit]
- Buliah, N.; Jamek, S.; Ajit, A.; Abu, R. Production of dairy cow pellets from pineapple leaf waste. AIP Conf. Proc. 2019, 2124, 020048. [Google Scholar]
- Liu, C.; Asano, S.; Ogata, H.; Ito, S.; Nakase, T.; Takeda, S.; Miyoshi, K.; Numata, Y.; Takahashi, K.; Kajikawa, H. Digestive, fermentative, and physical properties of pineapple residue as a feed for cattle. Anim. Sci. J. 2021, 92, e13535. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, C.; Zhao, W.; Tian, H.; Wang, M.; Gao, C.; Guo, Y.; Sun, B. A preliminary study on the possibility of fermented pineapple peel residue partially replacing whole corn silage in feeding Chuanzhong black goats. Front. Microbiol. 2022, 13, 959857. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gowda, N.K.; Vallesha, N.C.; Awachat, V.B.; Anandan, S.; Pal, D.T.; Prasad, C.S. Study on evaluation of silage from pineapple (Ananas comosus) fruit residue as livestock feed. Trop. Anim. Health Prod. 2015, 47, 557–561. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Suksathit, S.; Wachirapakorn, C.; Opatpatanakit, Y. Effects of levels of ensiled pineapple waste and pangola hay fed as roughage sources on feed intake, nutrient digestibility and ruminal fermentation of Southern Thai native cattle. Songklanakarin J. Sci. Technol. 2011, 33, 281–289. [Google Scholar]
- Larsen, S.U.; Hjort-Gregersen, K.; Vazifehkhoran, A.H.; Triolo, J.M. Co-ensiling of straw with sugar beet leaves increases the methane yield from straw. Bioresour. Technol. 2017, 245, 106–115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, Y.H.; Ahmadi, F.; Kim, Y.I.; Oh, Y.K.; Kwak, W.S. Co-ensiling garlic stalk with citrus pulp improves the fermentation quality and feed-nutritional value. Asian-Australas J. Anim. Sci. 2020, 33, 436–445. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Denek, N.; Can, A. Feeding value of wet tomato pomace ensiled with wheat straw and wheat grain for Awassi sheep. Small Rumin. Res. 2006, 65, 260–265. [Google Scholar] [CrossRef] [Scilit]
- Ni, K.; Zhao, J.; Zhu, B.; Su, R.; Pan, Y.; Ma, J.; Zhou, G.; Tao, Y.; Liu, X.; Zhong, J. Assessing the fermentation quality and microbial community of the mixed silage of forage soybean with crop corn or sorghum. Bioresour. Technol. 2018, 265, 563–567. [Google Scholar] [CrossRef] [Scilit]
- Mitiku, A.A.; Vandeweyer, D.; Adriaens, I.; Kechero, Y.; Van Campenhout, L.; Aernouts, B.J.A. Mixed Silage of Banana Pseudostem and Maize Stover on Ethiopian Smallholder Farms: Effect of Fermentation Package and Location on Microbiological and Nutritional Evaluation. Agriculture 2023, 13, 2152. [Google Scholar] [CrossRef] [Scilit]
- Official methods of analysis of the association of official analytical chemists: Kenneth Helrich, 15th ed., AOAC, Arlington, VA, 1990. Vol. I: xxiv + 684 + 62 (index) pp. Vol. II: xviii + 614 + 62 (index) pp. Anal. Chim. Acta 1991, 242, 302. [CrossRef] [Scilit]
- Van Soest, P.J.; Robertson, J.B.; Lewis, B.A. Methods for Dietary Fiber, Neutral Detergent Fiber, and Nonstarch Polysaccharides in Relation to Animal Nutrition. J. Dairy Sci. 1991, 74, 3583–3597. [Google Scholar] [CrossRef] [Scilit]
- Cai, Y. Analysis method for silage. In Field and Laboratory Methods for Grassland Science; Japanese Society of Grassland Science, Ed.; Tosho Printing: Tokyo, Japan, 2004; pp. 279–282. [Google Scholar]
- Broderick, G.A.; Kang, J.H. Automated Simultaneous Determination of Ammonia and Total Amino Acids in Ruminal Fluid and In Vitro Media1. J. Dairy Sci. 1980, 63, 64–75. [Google Scholar] [CrossRef] [Scilit]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef] [PubMed]
- Xie, H.; Xie, F.; Guo, Y.; Liang, X.; Peng, L.; Li, M.; Tang, Z.; Peng, K.; Yang, C. Fermentation quality, nutritive value and in vitro ruminal digestion of Napier grass, sugarcane top and their mixed silages prepared using lactic acid bacteria and formic acid. Grassl. Sci. 2023, 69, 23–32. [Google Scholar] [CrossRef] [Scilit]
- Cao, Y.; Cai, Y.; Takahashi, T.; Yoshida, N.; Tohno, M.; Uegaki, R.; Nonaka, K.; Terada, F. Effect of lactic acid bacteria inoculant and beet pulp addition on fermentation characteristics and in vitro ruminal digestion of vegetable residue silage. J. Dairy Sci. 2011, 94, 3902–3912. [Google Scholar] [CrossRef] [Scilit]
- Denman, S.E.; McSweeney, C.S. Development of a real-time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within the rumen. FEMS Microbiol. Ecol. 2006, 58, 572–582. [Google Scholar] [CrossRef] [Scilit]
- Ren, Y.; Yu, G.; Shi, C.; Liu, L.; Guo, Q.; Han, C.; Zhang, D.; Zhang, L.; Liu, B.; Gao, H.; et al. Majorbio Cloud: A one-stop, comprehensive bioinformatic platform for multiomics analyses. IMeta 2022, 1, e12. [Google Scholar] [CrossRef] [Scilit]
- Muller, Z.O. Feeding potential of pineapple waste for cattle. World Anim. Rev. 1978, 25, 25–29. [Google Scholar]
- Ren, H.; Feng, Y.; Liu, T.; Li, J.; Wang, Z.; Fu, S.; Zheng, Y.; Peng, Z. Effects of different simulated seasonal temperatures on the fermentation characteristics and microbial community diversities of the maize straw and cabbage waste co-ensiling system. Sci. Total Environ. 2020, 708, 135113. [Google Scholar] [CrossRef] [Scilit]
- Wilkinson, J.M.; Bolsen, K.K.; Lin, C.J. History of Silage. Silage Sci. Technol. 2003, 42, 1–30. [Google Scholar] [CrossRef] [Scilit]
- Mugabe, W.; Shao, T.; Li, J.; Dong, Z.; Yuan, X. Effect of hexanoic acid, Lactobacillus plantarum and their combination on the aerobic stability of napier grass silage. J. Appl. Microbiol. 2020, 129, 823–831. [Google Scholar] [CrossRef] [Scilit]
- Javed, A.; Ajmal, M.; Hanif, N.Q.; Akram, A. Effects of inoculation of corn silage with Saccharomyces cerevisiae on silage fermentation characteristics, nutrient digestibility, mycoflora and aflatoxin production. Nat. Prod. Res. 2023, 32, 1–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ridwan, R.; Abdelbagi, M.; Sofyan, A.; Fidriyanto, R.; Astuti, W.D.; Fitri, A.; Sholikin, M.M.; Rohmatussolihat; Sarwono, K.A.; Jayanegara, A.; et al. A meta-analysis to observe silage microbiome differentiated by the use of inoculant and type of raw material. Front. Microbiol. 2023, 14, 1063333. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, D.H.; Lee, K.D.; Choi, K.C. Role of LAB in silage fermentation: Effect on nutritional quality and organic acid production—An overview. AIMS Agric. Food 2021, 6, 216–234. [Google Scholar] [CrossRef] [Scilit]
- He, L.; Zhou, W.; Wang, Y.; Wang, C.; Chen, X.; Zhang, Q. Effect of applying lactic acid bacteria and cellulase on the fermentation quality, nutritive value, tannins profile and in vitro digestibility of Neolamarckia cadamba leaves silage. J. Anim. Physiol. Anim. Nutr. 2018, 102, 1429–1436. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lara, E.C.; Basso, F.C.; de Assis, F.B.; Souza, F.A.; Berchielli, T.T.; Reis, R.A. Changes in the nutritive value and aerobic stability of corn silages inoculated with Bacillus subtilis alone or combined with Lactobacillus plantarum. Anim. Prod. Sci. 2016, 56, 1867–1874. [Google Scholar] [CrossRef] [Scilit]
- Zhao, G.; Wu, H.; Li, L.; He, J.; Hu, Z.; Yang, X.; Xie, X. Effects of applying cellulase and starch on the fermentation characteristics and microbial communities of Napier grass (Pennisetum purpureum Schum.) silage. J. Anim. Sci. Technol. 2021, 63, 1301–1313. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Upadhyay, A.; Lama, J.P.; Tawata, S. Utilization of pineapple waste: A review. J. Food Sci. Technol. 2010, 6, 10–18. [Google Scholar] [CrossRef] [Scilit]
- Soundharrajan, I.; Park, H.S.; Rengasamy, S.; Sivanesan, R.; Choi, K.C. Application and Future Prospective of Lactic Acid Bacteria as Natural Additives for Silage Production—A Review. Appl. Sci. 2021, 11, 8127. [Google Scholar] [CrossRef] [Scilit]
- Cai, Y.; Benno, Y.; Ogawa, M.; Kumai, S. Effect of Applying Lactic Acid Bacteria Isolated from Forage Crops on Fermentation Characteristics and Aerobic Deterioration of Silage. J. Dairy Sci. 1999, 82, 520–526. [Google Scholar] [CrossRef] [Scilit]
- Cai, Y.; Du, Z.; Yamasaki, S.; Nguluve, D.; Tinga, B.; Macome, F.; Oya, T. Community of natural lactic acid bacteria and silage fermentation of corn stover and sugarcane tops in Africa. Asian-Australas. J. Anim. Sci. 2020, 33, 1252–1264. [Google Scholar] [CrossRef] [Scilit]
- Du, Z.; Yamasaki, S.; Oya, T.; Nguluve, D.; Euridse, D.; Tinga, B.; Macome, F.; Cai, Y. Microbial Co-occurrence Network and Fermentation Information of Natural Woody-Plant Silage Prepared with Grass and Crop By-Product in Southern Africa. Front. Microbiol. 2022, 13, 756209. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, B.; Zhang, X.; Guo, F.; Wu, W.; Zhang, T. Characterization of tetracycline resistant bacterial community in saline activated sludge using batch stress incubation with high-throughput sequencing analysis. Water Res. 2013, 47, 4207–4216. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Wang, J.; Zhu, Y.; Zhu, X.; Qin, H.; Bian, K.; Tang, X. Comparison in structure and predicted function of epiphytic bacteria on Neopyropia yezoensis and Neopyropia katadae. J. Oceanol. Limnol. 2023, 41, 2232–2248. [Google Scholar] [CrossRef] [Scilit]
- Santos, A.O.; Ávila, C.L.S.; Schwan, R.F. Selection of tropical lactic acid bacteria for enhancing the quality of maize silage. J. Dairy Sci. 2013, 96, 7777–7789. [Google Scholar] [CrossRef] [Scilit]
- Ogunade, I.M.; Martinez-Tuppia, C.; Queiroz, O.C.M.; Jiang, Y.; Drouin, P.; Wu, F.; Vyas, D.; Adesogan, A.T. Silage review: Mycotoxins in silage: Occurrence, effects, prevention, and mitigation. J. Dairy Sci. 2018, 101, 4034–4059. [Google Scholar] [CrossRef] [Scilit]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).


