The Functional Differences between the GroEL Chaperonin of Escherichia coli and the HtpB Chaperonin of Legionella pneumophila Can Be Mapped to Specific Amino Acid Residues
Abstract
1. Introduction
2. Materials and Methods
2.1. Microbial Strains and Growth Conditions
2.2. General Molecular Biology Methods
2.3. Polymerase Chain Reactions (PCR)
2.4. Yeast Molecular Biology Methods
2.5. Yeast Protein Techniques
2.6. Prediction of the 3-D Protein Structure of HtpB
2.7. Evolutionary Trace Analysis
2.8. Cloning and Mutagenesis of htpB and groEL (Baits for the Y2H Assays)
2.9. Yeast-Two-Hybrid (Y2H) Assays
2.10. Statistical Analysis
3. Results
3.1. Evolutionary Trace Analysis Identified 10 Amino Acids Potentially Involved in the Protein Folding-Independent Functions of HtpB
3.2. Validation of the HtpB-hECM29 Yeast-Two-Hybrid Interaction as a Functional Reporter Assay
3.3. Single- and Multi-Site Directed Mutations in Selected aa Positions Affect the Yeast-Two-Hybrid (Y2H) HtpB-hECM29 Interaction
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Horwich, A.L.; Fenton, W.A. Chaperonin-assisted protein folding: A chronologue. Q. Rev. Biophys. 2020, 53, e4. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pipaón, S.; Gragera, M.; Bueno-Carrasco, M.T.; García-Bernalt, J.D.; Cantero, M.; Cuéllar, J.; Fernández-Fernández, M.R.; Valpuesta, J.M. Chaperonins: Nanocarriers with biotechnological applications. Nanomaterials 2021, 11, 503. [Google Scholar] [CrossRef] [Scilit]
- Clare, D.K.; Vasishtan, D.; Stagg, S.; Quispe, J.; Farr, G.W.; Topf, M.; Horwich, A.L.; Saibil, H.R. ATP-triggered conformational changes delineate substrate-binding and folding mechanics of the GroEL chaperonin. Cell 2012, 149, 113–123. [Google Scholar] [CrossRef] [Scilit]
- Fei, X.; Ye, X.; LaRonde, N.A.; Lorimer, G.H. Formation and structures of GroEL:GroES2 chaperonin footballs, the protein-folding functional form. Proc. Natl. Acad. Sci. USA 2014, 111, 12775–12780. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Henderson, B.; Martin, A. Bacterial moonlighting proteins and bacterial virulence. Curr. Top. Microbiol. Immunol. 2013, 358, 155–213. [Google Scholar]
- Hickey, T.B.; Ziltener, H.J.; Speert, D.P.; Stokes, R.W. Mycobacterium tuberculosis employs Cpn60.2 as an adhesin that binds CD43 on the macrophage surface. Cell. Microbiol. 2010, 12, 1634–1647. [Google Scholar] [CrossRef] [Scilit]
- González-López, M.A.; Velázquez-Guadarrama, N.; Romero-Espejel, M.E.; de Olivares-Trejo, J. Helicobacter pylori secretes the chaperonin GroEL (HSP60), which binds iron. FEBS Lett. 2013, 587, 1823–1828. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Morioka, M.; Muraoka, H.; Yamamoto, K.; Ishikawa, H. An endosymbiont chaperonin is a novel type of histidine protein kinase. J. Biochem. 1994, 116, 1075–1081. [Google Scholar] [CrossRef] [Scilit]
- Hogenhout, S.A.; van der Wilk, F.; Verbeek, M.; Goldbach, R.W.; van den Heuvel, F.J.M. Potato leafroll virus binds to the equatorial domain of the aphid endosymbiotic GroEL homolog. J. Virol. 1998, 72, 358–365. [Google Scholar] [CrossRef] [Scilit]
- Goulhen, F.; Hafezi, A.; Uitto, V.J.; Hinode, D.; Nakamura, R.; Grenier, D.; Mayrand, D. Subcellular localization and cytotoxic activity of the GroEL-like protein isolated from Actinobacillus actinomycetemcomitans. Infect. Immun. 1998, 66, 5307–5313. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Pelech, S.; Uitto, V.J. Long-term effect of heat shock protein 60 from Actinobacillus actinomycetemcomitans on epithelial cell viability and mitogen-activated protein kinases. Infect. Immun. 2004, 72, 38–45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- 12 Valenzuela-Valderas, K.N.; Riveroll, A.L.; Robertson, P.; Murray, L.E.; Garduño, R.A. Legionella pneumophila chaperonin 60, an extra- and intra-cellular moonlighting virulence-related factor. In Moonlighting Proteins: Novel Virulence Factors in Bacterial Infections, 1st ed.; Henderson, B., Ed.; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2017; pp. 111–134. [Google Scholar]
- Garduño, R.A. (Dalhousie University, Halifax, NS, Canada); Faulkner, G. (Dalhousie University, Halifax, NS, Canada). Personal communication. 1999.
- Garduño, R.A.; Faulkner, G.; Trevors, M.A.; Vats, N.; Hoffman, P.S. Immunolocalization of Hsp60 in Legionella pneumophila. J. Bacteriol. 1998, 180, 505–513. [Google Scholar] [CrossRef] [Scilit]
- Garduño, R.A.; Chong, A.; Nasrallah, G.K.; Allan, D.S. The Legionella pneumophila chaperonin—an unusual multifunctional protein in unusual locations. Front. Microbiol. 2011, 2, 122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Garduño, R.A.; Chong, A. The Legionella pneumophila chaperonin 60 and the art of keeping several moonlighting jobs. In Moonlighting Cell Stress Proteins in Microbial Infections; Henderson, B., Ed.; Springer Science&Business Media: Dordrecht, Germany, 2013; Heat Shock Proteins; Volume 7, pp. 143–160. [Google Scholar] [CrossRef] [Scilit]
- Garduño, R.A.; Garduño, E.; Hoffman, P.S. Surface-associated Hsp60 chaperonin of Legionella pneumophila mediates invasion in a HeLa cell model. Infect. Immun. 1998, 66, 4602–4610. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chong, A.; Lima, C.A.; Allan, D.S.; Nasrallah, G.K.; Garduño, R.A. The purified and recombinant Legionella pneumophila chaperonin alters mitochondrial trafficking and microfilament organization. Infect. Immun. 2009, 77, 4724–4739. [Google Scholar] [CrossRef] [Scilit]
- Nasrallah, G.K.; Riveroll, A.L.; Chong, A.; Murray, L.E.; Lewis, P.J.; Garduño, R.A. Legionella pneumophila requires polyamines for optimal intracellular growth. J. Bacteriol. 2011, 193, 4346–4360. [Google Scholar] [CrossRef] [Scilit]
- Allan, D.S. Secretion of Hsp60 Chaperonin (GroEL) Homologs by Legionella pneumophila. Master’s Thesis, Dalhousie University, Halifax, NS, Canada, September 2002. [Google Scholar]
- Lizama-Riveroll, A.L. The Legionella pneumophila Chaperonin—An Investigation of Virulence-Related Roles in a Yeast Model. Ph.D. Thesis, Dalhousie University, Halifax, NS, Canada, December 2005. [Google Scholar]
- Chong, A. Characterization of the virulence-related roles of the Legionella pneumophila chaperonin, HtpB, in mammalian cells. Ph.D. Thesis, Dalhousie University, Halifax, NS, Canada, March 2007. [Google Scholar]
- Nasrallah, G.K. A yeast two-hybrid screen reveals a strong interaction between the Legionella chaperonin Hsp60, and the host cell small heat shock protein Hsp10. Acta Microbiol. Immunol. Hung. 2015, 62, 121–135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Valenzuela, K. Identification of amino acids involved in the moonlighting functions of HtpB, the Legionella pneumophila chaperonin. Master’s Thesis, Dalhousie University, Halifax, NS, Canada, August 2015. [Google Scholar]
- Wang, X.; Chemmama, I.E.; Yu, C.; Huszagh, A.; Xu, Y.; Viner, R.; Block, S.A.; Cimermancic, P.; Rychnovsky, S.D.; Ye, Y.; et al. The proteasome-interacting Ecm29 protein disassembles the 26S proteasome in response to oxidative stress. J. Biol. Chem. 2017, 292, 16310–16320. [Google Scholar] [CrossRef] [Scilit]
- Bedford, L.; Paine, S.; Sheppard, P.W.; Mayer, R.J.; Roelofs, J. Assembly, structure and function of the 26S proteasome. Trends Cell Biol. 2010, 20, 391–401. [Google Scholar] [CrossRef] [Scilit]
- Olshina, M.A.; Arkind, G.; Deshmukh, F.K.; Fainer, I.; Taranavsky, M.; Hayat, D.; Ben-Dor, S.; Ben-Nissan, G.; Sharon, M. Regulation of the 20S proteasome by a novel family of inhibitory proteins. Antiox. Redox Signal. 2020, 32, 636–655. [Google Scholar] [CrossRef] [Scilit]
- Maupin-Furlow, J. Proteasomes and protein conjugation across domains of life. Nat. Rev. Microbiol. 2012, 10, 100–111. [Google Scholar] [CrossRef] [Scilit]
- Reichmann, D.; Voth, W.; Jakob, U. Maintaining a healthy proteome during oxidative stress. Mol. Cell 2018, 69, 203–213. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kajava, A.V.; Gorbea, C.; Ortega, J.; Rechsteiner, M.; Steven, A.C. New HEAT-like repeat motifs in proteins regulating proteasome structure and function. J. Struct. Biol. 2004, 146, 425–430. [Google Scholar] [CrossRef] [Scilit]
- Neuwald, A.F.; Hirano, T. HEAT repeats associated with condensins, cohesins, and other complexes involved in chromosome-related functions. Genome Res. 2000, 10, 1445–1452. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gorbea, C.; Pratt, G.; Ustrell, V.; Bell, R.; Sahasrabudhe, S.; Hughes, R.E.; Rechsteiner, M. A protein interaction network for Ecm29 links the 26 S proteasome to molecular motors and endosomal components. J. Biol. Chem. 2010, 285, 31616–31633. Available online: http://www.jbc.org/cgi/doi/10.1074/jbc.M110.154120 (accessed on 24 December 2021). [CrossRef] [Scilit]
- Lichtarge, O.; Bourne, H.R.; Cohen, F.E. An evolutionary trace method defines binding surfaces common to protein families. J. Mol. Biol. 1996, 257, 342–358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 1989. [Google Scholar]
- Sadosky, A.B.; Wiater, L.A.; Shuman, H.A. Identification of Legionella pneumophila genes required for growth within and killing of human macrophages. Infect. Immun. 1993, 61, 5361–5373. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Willard, L.; Ranjan, A.; Zhang, H.; Monzavi, H.; Boyko, R.F.; Sykes, B.D.; Wishart, D.S. VADAR: A web server for quantitative evaluation of protein structure quality. Nucleic Acids Res. 2003, 31, 3316–3319. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wilkins, A.; Erdin, S.; Lua, R.; Lichtarge, O. Evolutionary trace for prediction and redesign of protein functional sites. Methods Mol. Biol. 2012, 819, 29–42. [Google Scholar]
- Sievers, F.; Wilm, A.; Dineen, D.; Gibson, T.J.; Karplus, K.; Li, W.; Lopez, R.; McWilliam, H.; Remmert, M.; Söding, J.; et al. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal omega. Mol. Syst. Biol. 2011, 7, 539. [Google Scholar] [CrossRef] [Scilit]
- Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 2010, 26, 2460–2461. [Google Scholar] [CrossRef] [Scilit]
- Michener, C.; Sokal, R. A quantitative approach to a problem in classification. Evolution 1957, 11, 130–162. [Google Scholar] [CrossRef] [Scilit]
- Henikoff, S.; Henikoff, J.G. Amino acid substitution matrices from protein blocks. Proc. Natl. Acad. Sci. USA 1992, 89, 10915–10919. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Braig, K.; Otwinowski, Z.; Hegde, R.; Boisvert, D.C.; Joachimiak, A.; Horwich, A.L.; Sigler, P.B. The crystal structure of the bacterial chaperonin GroEL at 2.8 Å. Nature 1994, 371, 578–586. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fenton, W.A.; Kashi, Y.; Furtak, K.; Horwich, A.L. Residues in chaperonin GroEL required for polypeptide binding and release. Nature 1994, 371, 614–619. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, Z.; Horwich, A.L. The crystal structure of the asymmetric GroEL-GroES-(ADP)7 chaperonin complex (cover story). Nature 1997, 388, 741. [Google Scholar] [CrossRef] [Scilit]
- Chen, L.; Sigler, P.B. The crystal structure of a GroEL/peptide complex: Plasticity as a basis for substrate diversity. Cell 1999, 99, 757–768. [Google Scholar] [CrossRef] [Scilit]
- Tanaka, N.; Fersht, A.R. Identification of substrate binding site of GroEL minichaperone in solution. J. Mol. Biol. 1999, 292, 173–180. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ranson, N.A.; Farr, G.W.; Roseman, A.M.; Gowen, B.; Fenton, W.A.; Horwich, A.L.; Saibil, H.R. ATP-bound states of GroEL captured by cryo-electron microscopy. Cell 2001, 107, 869–879. [Google Scholar] [CrossRef] [Scilit]
- Chaudhry, C.; Farr, G.W.; Todd, M.J.; Rye, H.S.; Brunger, A.T.; Adams, P.D.; Horwich, A.L.; Sigler, P.B. Role of the gamma-phosphate of ATP in triggering protein folding by GroEL-GroES: Function, structure and energetics. EMBO J. 2003, 22, 4877–4887. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Boisvert, D.C. Structural basis for GroEL-assisted protein folding from the crystal structure of (GroEL-KMgATP)14 at 2.0Å resolution. J. Mol. Biol. 2003, 327, 843–855. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Chen, L. Domain motions in GroEL upon binding of an oligopeptide. J. Mol. Biol. 2003, 334, 489–499. [Google Scholar] [CrossRef] [Scilit]
- Tyagi, N.K.; Fenton, W.A.; Horwich, A.L. GroEL/GroES cycling: ATP binds to an open ring before substrate protein favoring protein binding and production of the native state. Proc. Natl. Acad. Sci. USA 2009, 106, 20264–20269. [Google Scholar] [CrossRef] [Scilit]
- Koike-Takeshita, A.; Arakawa, T.; Taguchi, H.; Shimamura, T. Crystal structure of a symmetric football-shaped GroEL:GroES2-ATP14 complex determined at 3.8 Å reveals rearrangement between two GroEL rings. J. Mol. Biol. 2014, 426, 3634–3641. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hoffman, P.S.; Butler, C.A.; Quinn, F.D. Cloning and temperature-dependent expression in Escherichia coli of a Legionella pneumophila gene coding for a genus-common 60-kilodalton antigen. Infect. Immun. 1989, 57, 1731–1739. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nasrallah, G.K.; Gagnon, E.; Orton, D.J.; Garduño, R.A. The htpAB operon of Legionella pneumophila cannot be deleted in the presence of the groE chaperonin operon of Escherichia coli. Can. J. Microbiol. 2011, 57, 943–952. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sivinski, J.; Ambrose, A.J.; Panfilenko, I.; Zerio, C.J.; Machulis, J.M.; Mollasalehi, N.; Kaneko, L.K.; Stevens, M.; Ray, A.-M.; Park, Y.; et al. Functional differences between E. coli and ESKAPE pathogen GroES/GroEL. mBio 2021, 12, e02167-20. [Google Scholar] [CrossRef] [Scilit]
- Yoshida, N.; Oeda, K.; Watanabe, E.; Mikami, T.; Fukita, Y.; Nishimura, K.; Komai, K.; Matsuda, K. Protein function. Chaperonin turned insect toxin. Nature 2001, 411, 44. [Google Scholar] [CrossRef] [Scilit]
- Portaro, F.C.; Hayashi, M.A.; De Arauz, L.J.; Palma, M.S.; Assakura, M.T.; Silva, C.L.; de Camargo, A.C. The Mycobacterium leprae hsp65 displays proteolytic activity. Mutagenesis studies indicate that the M. leprae hsp65 proteolytic activity is catalytically related to the HslVU protease. Biochemistry 2002, 41, 7400–7406. [Google Scholar] [CrossRef] [Scilit]
- Madabushi, S.; Gross, A.K.; Philippi, A.; Meng, E.C.; Wensel, T.G.; Lichtarge, O. Evolutionary trace of G protein-coupled receptors reveals clusters of residues that determine global and class-specific functions. J. Biol. Chem. 2004, 279, 8126–8132. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rajagopalan, L.; Patel, N.; Madabushi, S.; Goddard, J.A.; Anjan, V.; Lin, F.; Shope, C.; Farrell, B.; Lichtarge, O.; Davidson, A.L.; et al. Essential helix interactions in the anion transporter domain of prestin revealed by evolutionary trace analysis. J. Neurosc. 2006, 26, 12727–12734. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rajagopalan, L.; Pereira, F.A.; Lichtarge, O.; Brownell, W.E. Identification of functionally important residues/domains in membrane proteins using an evolutionary approach coupled with systematic mutational analysis. Methods Mol. Biol. 2009, 493, 287–297. [Google Scholar] [CrossRef] [Scilit]
- Bonde, M.M.; Yao, R.; Ma, J.-N.; Madabushi, S.; Haunsø, S.; Burstein, E.S.; Whistler, J.L.; Sheikh, S.P.; Lichtarge, O.; Hansen, J.L. An angiotensin II type 1 receptor activation switch patch revealed through evolutionary trace analysis. Biochem. Pharmacol. 2010, 80, 86–94. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Garduño, E. (Dalhousie University, Halifax, NS, Canada); Garduño, R.A. (Dalhousie University, Halifax, NS, Canada); Chong, A. (Dalhousie University, Halifax, NS, Canada). Personal communication. 2004.
- Dorer, M.S.; Kirton, D.; Bader, J.S.; Isberg, R.R. RNA interference analysis of Legionella in Drosophila cells: Exploitation of early secretory apparatus dynamics. PLoS Pathog. 2006, 2, e34. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Price, C.T.; Al-Khodor, S.; Al-Quadan, T.; Abu Kwaik, Y. Indispensable role for the eukaryotic-like ankyrin domains of the ankyrin B effector of Legionella pneumophila within macrophages and amoebae. Infect. Immun. 2010, 78, 2079–2088. [Google Scholar] [CrossRef] [Scilit]
- Hsu, F.; Luo, X.; Qiu, J.; Teng, Y.B.; Jin, J.; Smolka, M.B.; Luo, Z.Q.; Mao, Y. The Legionella effector SidC defines a unique family of ubiquitin ligases important for bacterial phagosomal remodeling. Proc. Natl. Acad. Sci. USA 2014, 111, 10538–10543. [Google Scholar] [CrossRef] [Scilit]
- Kubori, T.; Shinzawa, N.; Kanuka, H.; Nagai, H. Legionella metaeffector exploits host proteasome to temporally regulate cognate effector. PLoS Pathog. 2010, 6, e1001216. [Google Scholar] [CrossRef] [Scilit]
- Wickner, S.; Nguyen, T.-L.L.; Genest, O. The bacterial Hsp90 chaperone: Cellular functions and mechanism of action. Annu. Rev. Microbiol. 2021, 75, 719–739. [Google Scholar] [CrossRef] [Scilit]
- Bhattacharya, K.; Weidenauer, L.; Morán-Luengo, T.; Pieters, E.C.; Echeverría, P.C.; Bernasconi, L.; Wider, D.; Sadian, Y.; Koopman, M.B.; Villemin, M.; et al. The Hsp70-Hsp90 co-chaperone Hop/Stip1 shifts the proteostatic balance from folding towards degradation. Nat. Commun. 2020, 11, 5975. [Google Scholar] [CrossRef] [Scilit]
- Costanzo, M.; VanderSluis, B.; Koch, E.N.; Baryshnikova, A.; Pons, C.; Tan, G.; Wang, W.; Usaj, M.; Hanchard, J.; Lee, S.D.; et al. A global interaction network maps a wiring diagram of cellular function. Science 2016, 353, aaf1420. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Primer’s Name | 5′ → 3′ Sequence | Application |
|---|---|---|
| BamHI-htpB_R | ATAGGATCCTTACATCATTCCGCCCATG (BamHI) | PCR and sequencing |
| D475A_F | GGTAGCTGAGCACAAAGCCAACTACGGTTTCAACG | Mutagenesis |
| D475A_R | CGTTGAAACCGTAGTTGGCTTTGTGCTCAGCTACC | Mutagenesis |
| EcoRI-htpB_F | CCGGAATTCATGATAATGGCTAAAGAATTA CG (EcoRI) | PCR and sequencing |
| EcoRI-groEL_F | CGGGAATTCATGGCAGCTAAAGACG (EcoRI) | PCR and sequencing |
| E67M_R | CACCATCTGCGCACCCATATTCATGAACTTGTCTTCCAGTTCGAT | Mutagenesis-multi |
| E472A_F | TAGTAAACAAGGTAGCTGCGCACAAAGACAACTACGG | Mutagenesis |
| E472A_R | CCGTAGTTGTCTTTGTGCGCAGCTACCTTGTTTACTA | Mutagenesis |
| GroEL461_F | CCGACGAAACCGTAGGTAAA | Sequencing |
| GroEL470-474_F | CTGTTGTTGCTAACACCGTTGCAGCCGCCGCCGCCAACTACGGTTACAACGCAG | Mutagenesis-multi |
| GroEL470-474_R | CTGCGTTGTAACCGTAGTTGGCGGCGGCGGCTGCAACGGTGTTAGCAACAACAG | Mutagenesis-multi |
| GroEL1154_R | TAGCAGCACCCACTTTGATAA | Sequencing |
| G211M_R | TTCCAGTTCTACTGCCATAGTTTCCGGCTTGTTGATGAAGTAAGG | Mutagenesis-multi |
| G297K_R | GATCTCTTCAGAGATCACGGTTTTGCCAGTCAGGGTTGCGATATC | Mutagenesis-multi |
| HtpB419_F | AAGACAGCAAAGCCATTG | Sequencing |
| HtpB1200_R | AGCATCTTCAACACGAGC | Sequencing |
| H473A_F | GTAGTAAACAAGGTAGCTGAGGCCAAAGACAACTACGGTTTCAA | Mutagenesis |
| H473A_R | TTGAAACCGTAGTTGTCTTTGGCCTCAGCTACCTTGTTTACTAC | Mutagenesis |
| K298A_F | AGCGATGTTGCAAGACATTGCTATTTTGACTGCGGGTCAAGTTATTTCT | Mutagenesis |
| K298A_R | AGAAATAACTTGACCCGCAGTCAAAATAGCAATGTCTTGCAACATCGCT | Mutagenesis |
| K298G_R | AGAAATAACTTGACCCCCAGTCAAAATAGCAATGTCTTGCAACATCGCT | Mutagenesis-multi |
| K474A_F | TAAACAAGGTAGCTGAGCACGCAGACAACTACGGTTTCAACG | Mutagenesis |
| K474A_R | CGTTGAAACCGTAGTTGTCTGCGTGCTCAGCTACCTTGTTTA | Mutagenesis |
| MMBD_F | TCATCGGAAGAGAGTAGTAAC | Sequencing |
| MMBD_R | CCTAAGAGTCACTTTAAAATTTGTATAC | Sequencing |
| M68A_F | TGAGTTTGAGCATCGTTTCGCGAACATGGGCGCTCAAATG | Mutagenesis |
| M68A_R | CATTTGAGCGCCCATGTTCGCGAAACGATGCTCAAACTCA | Mutagenesis |
| M68E_R | CATTTGAGCGCCCATGTTCTCGAAACGATGCTCAAACTCA | Mutagenesis-multi |
| M212A_F | TTTATCAACAACCAGCAAAACGCGAGCTGTGAACTTGAGCATCC | Mutagenesis |
| M212A_R | GGATGCTCAAGTTCACAGCTCGCGTTTTGCTGGTTGTTGATAAA | Mutagenesis |
| M212G | GGATGCTCAAGTTCACAGCTCCCGTTTTGCTGGTTGTTGATAAA | Mutagenesis-multi |
| N507A_F | CAAAGTAACCCGTATGGCTCTGCAAGCTGCAGCTTCTGTA | Mutagenesis |
| N507A_R | TACAGAAGCTGCAGCTTGCAGAGCCATACGGGTTACTTTG | Mutagenesis |
| N507Y_R | CTACAGAAGCTGCATATTGCAGAGCCATACGGG | Mutagenesis-multi |
| P235S_R | AGCTTCCAGAACCGACAGCATTTCGCGGAT | Mutagenesis-multi |
| SalI-groEL_R | AGTCGTCGACTTACATCATGCCGCCCA (SalI) | PCR and sequencing |
| S236A_F | CAGTATTCGTGAAATGTTGGCCGTATTGGAAGGTGTTGC | Mutagenesis |
| S236A_R | GCAACACCTTCCAATACGGCCAACATTTCACGAATACTG | Mutagenesis |
| S236P | GCAACACCTTCCAATACGGGCAACATTTCACGAATACTG | Mutagenesis-multi |
| Y506N_R | CACAGAAGCTGCGTTCTGCAGAGCAGAACG | Mutagenesis-multi |
| 1411-12-13-15_F | ATGAAGCTTCTGTTGTAGTAAACAAGGTAAAAGGGCACAAAGACAACTACGGTTTCAAC | Mutagenesis-multi |
| 1411-12-13-15_R | GTTGAAACCGTAGTTGTCTTTGTGCCCTTTTACCTTGTTTACTACAACAGAAGCTTCAT | Mutagenesis-multi |
| 1415-17-18-20-21-24_F | CTTCTGTTGTAGTAAACAAGGTAGCTGCGGCCGCAGCCAACTACGGTTTCAACGCTGCAACTGG | Mutagenesis-multi |
| 1415-17-18-20-21-24_R | CCAGTTGCAGCGTTGAAACCGTAGTTGGCTGCGGCCGCAGCTACCTTGTTTACTACAACAGAAG | Mutagenesis multi |
| 1417-18-20-22-24_F | CTGTTGTAGTAAACAAGGTAAAAGGGGGCGATGGCAACTACGGTTTCAACGCTGCAACTG | Mutagenesis-multi |
| 1417-18-20-22-24_R | CAGTTGCAGCGTTGAAACCGTAGTTGCCATCGCCCCCTTTTACCTTGTTTACTACAACAG | Mutagenesis-multi |
| Protein Folding-Related Function | |||
|---|---|---|---|
| Intra-Ring Contacts (Formation of Heptameric Rings) | ATP-Binding | Polypeptide Substrate Recognition | Inter-Ring Contacts (Formation of 14-mer Barrel) |
| L7(47.14) [V] | R14(6.33) | Y200(10.29) | D12(133.91) |
| A23(125.52) [V] | T31(1) | S202(6.66) | L15(113.12) [V] |
| R37(9.63) | M32(16.1) [L] | Y204(1.65) | K106(36) |
| N38(9.8) | G33(1) | F205(14.17) | A109(48.43) |
| V39(5.59) | P34(1) | R232(32.97) | A110(24.42) |
| V40(44.13) | K52(6.27) | L235(31.35) | G111(2.21) |
| L41(39.88) | D53(1) | L238(3.42) | M112(49.9) |
| E42(62.78) [D] | G54(1) | E239(9.22) | D435(146.41) [E] |
| K81(21.07) | D88(1) | A242(46.79) | R446(79.93) |
| D84(9.44) | T92(1.64) | L260(7.37) | R453(48.94) |
| N113(22.45) | I151(29.03) | T262(14.39) | E462(32.73) |
| M115(68.31) | S152(4.14) | V264(19.47) | S464(50.97) |
| N182(43.17) [T] | A153(23.45) | V265(32.63) | V465(42.35) |
| L184(66.68) | A384(8.56) | N266(1.49) | N468(101.41) |
| R198(10.2) | D399(1.72) | R269(10.8) | |
| N208(47.69) [K] | A407(3.87) | I271(54.8) | |
| E217(117.15) | G416(1) | ||
| K227(3.43) | I455(8.15) | ||
| R232(32.97) | N480(41.39) | ||
| R246(79.05) [K] | A481(13.62) | ||
| E253(14.91) | A482(88.43) | ||
| E256(41.75) | I494(30.94) | ||
| E258(12.87) | D496(1.4) | ||
| K273(74.67) | |||
| F282(7.64) | |||
| D284(16.16) | |||
| R285(3.19) | |||
| R286(2) | |||
| Y361(9.78) | |||
| A385(35.43) | |||
| E387(4.19) | |||
| M390(22.23) | |||
| A459(37.54) [C] | |||
| T517(4.29) | |||
| E519(25.31) | |||
| C520(50.52) | |||
| M521(64.93) | |||
| V522(68.71) | |||
| A523(69.18) [T] | |||
| Aligment Position | HtpB (aa) | GroEL (aa) | Variability (N°) a | Variability (aa) b | rvET Rank | Blosum Score |
|---|---|---|---|---|---|---|
| 3 | M | A | 10 | AMVTSPGKLD | 46.31 | −1 |
| 19 | A | R | 15 | RKEASVQDNHTILMY | 130.61 | −1 |
| 65 | H | D | 10 | DCNHESQAKG | 46.08 | −1 |
| 68 | M | E | 13 | ERKAQMIPLNHSV | 29.84 | −2 |
| 105 | H | L | 14 | LINAHMVCSFYTQR | 66.77 | −3 |
| 126 | L | T | 15 | TEAKINVDQLSGRHY | 210.52 | −1 |
| 137 | K | V | 13 | VKIQSRHETNDLA | 93.13 | −2 |
| 161 | A | K | 15 | KDNERQSLTAHGVXI | 201.68 | −1 |
| 209 | Q | P | 14 | PSANTRQKGVHLMD | 120.55 | −1 |
| 212 | M | G | 7 | GQMLARS | 21.73 | −3 |
| 214 | C | V | 7 | VACITSG | 76.14 | −1 |
| 218 | H | S | 11 | SDKENRQTHGA | 115.53 | −1 |
| 236 | S | P | 8 | PHSTNGAQ | 22.91 | −1 |
| 295 | I | T | 7 | TIVANCM | 113.27 | −1 |
| 298 | K | G | 10 | GAKNDSQHRE | 38.33 | −2 |
| 300 | Q | T | 14 | TQEIVLSKHRMNDA | 112.40 | −1 |
| 308 | K | M | 17 | MLRISFYKGANVTHCDQ | 85.41 | −1 |
| 312 | G | K | 12 | KNTDSAQGEHRM | 116.02 | −2 |
| 337 | E | V | 20 | VALDNGMSKI.EFTRQHYCP | 157.89 | −2 |
| 340 | A | E | 17 | ETSKPAQGDNVCRH.YL | 169.34 | −1 |
| 342 | E | A | 18 | AQDSNEVKTRHMIGLPFY | 187.52 | −1 |
| 352 | A | Q | 14 | QAKSVTGNRHMILE | 151.18 | −1 |
| 424 | Q | A | 17 | AYISTVLKQREGMFHCN | 149.47 | −1 |
| 426 | A | K | 19 | KPTASVQDYEIGCLNRHMF | 173.35 | −1 |
| 428 | D | A | 18 | ALESTKHDQVGFRN.ICP | 191.20 | −2 |
| 444 | L | A | 7 | AVILFMT | 64.13 | −1 |
| 445 | R | L | 16 | LKIFRMEQVAYTSCGN | 122.42 | −2 |
| 457 | T | L | 18 | LFHAVEIKTYNQSDRGCM | 194.97 | −1 |
| 461 | Y | E | 19 | ELKFYIDQAVGSMTHWRCN | 142.12 | −2 |
| 463 | A | P | 10 | PGASENDTRK | 46.27 | −1 |
| 469 | K | T | 14 | TKRQANESHMIYDG | 126.50 | −1 |
| 471 | A | K | 14 | KRLMAIQESVTGHY | 115.70 | −1 |
| 472 | E | G | 17 | GNHSAE.KQTDRLMCVI | 185.86 | −2 |
| 473 | H | G | 17 | G.RAKSNTEVHDQPLMC | 109.10 | −2 |
| 474 | K | D | 15 | DPASEKQ.TVGNCRH | 183.88 | −1 |
| 475 | D | G | 20 | GAVSLPKERYITDQFNHW.M | 184.40 | −1 |
| 484 | G | E | 12 | EGDNMKLFHRSA | 82.24 | −2 |
| 503 | M | S | 14 | SCTIVMNAYLFQHG | 65.83 | −1 |
| 507 | N | Y | 11 | YNSHDKAFGLT | 29.53 | −2 |
| 530 | E | A | 15 | AKGS.PENDTVQIMH | 219.66 | −1 |
| 536 | D | G | 15 | G.ADQSEMNPYHVTI | 118.38 | −1 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Valenzuela-Valderas, K.N.; Moreno-Hagelsieb, G.; Rohde, J.R.; Garduño, R.A. The Functional Differences between the GroEL Chaperonin of Escherichia coli and the HtpB Chaperonin of Legionella pneumophila Can Be Mapped to Specific Amino Acid Residues. Biomolecules 2022, 12, 59. https://doi.org/10.3390/biom12010059
Valenzuela-Valderas KN, Moreno-Hagelsieb G, Rohde JR, Garduño RA. The Functional Differences between the GroEL Chaperonin of Escherichia coli and the HtpB Chaperonin of Legionella pneumophila Can Be Mapped to Specific Amino Acid Residues. Biomolecules. 2022; 12(1):59. https://doi.org/10.3390/biom12010059
Chicago/Turabian StyleValenzuela-Valderas, Karla N., Gabriel Moreno-Hagelsieb, John R. Rohde, and Rafael A. Garduño. 2022. "The Functional Differences between the GroEL Chaperonin of Escherichia coli and the HtpB Chaperonin of Legionella pneumophila Can Be Mapped to Specific Amino Acid Residues" Biomolecules 12, no. 1: 59. https://doi.org/10.3390/biom12010059
APA StyleValenzuela-Valderas, K. N., Moreno-Hagelsieb, G., Rohde, J. R., & Garduño, R. A. (2022). The Functional Differences between the GroEL Chaperonin of Escherichia coli and the HtpB Chaperonin of Legionella pneumophila Can Be Mapped to Specific Amino Acid Residues. Biomolecules, 12(1), 59. https://doi.org/10.3390/biom12010059
