Next Article in Journal
Construction and Application of Soil–Water Characteristic Curve Model Considering Water Mineralization Degree
Previous Article in Journal
Economics of Conventional Dairy Manure Management in North Central Texas
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agriculture
Volume 15
Issue 23
10.3390/agriculture15232473
agriculture-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Pseudomonas syringae Population Recently Isolated from Winter Wheat in Serbia

by
Renata Iličić
1,
Marco Scortichini
2,*,
Ferenc Bagi
1,
Nemanja Pavković
1,
Aleksandra Jelušić
3,
Snežana Đorđević
4 and
Tatjana Popović Milovanović
5,*
1
Faculty of Agriculture, University of Novi Sad, Trg Dositeja Obradovića 8, 21000 Novi Sad, Serbia
2
CREA-Research Centre for Olive, Fruit and Citrus Crops, Via di Fioranello, 52, I-00134 Rome, Italy
3
National Institute of the Republic of Serbia, Institute for Multidisciplinary Research, University of Belgrade, Kneza Višeslava 1, 11030 Belgrade, Serbia
4
Agrounik doo, Krnješevačka BB, 22310 Šimanovci, Serbia
5
Institute for Plant Protection and Environment, Teodora Drajzera 9, 11040 Belgrade, Serbia
*
Authors to whom correspondence should be addressed.
Agriculture 2025, 15(23), 2473; https://doi.org/10.3390/agriculture15232473 (registering DOI)
Submission received: 3 November 2025 / Revised: 24 November 2025 / Accepted: 26 November 2025 / Published: 28 November 2025
(This article belongs to the Special Issue Endemic and Emerging Bacterial Diseases in Agricultural Crops)
Browse Figures
Versions Notes

Abstract

The aim of this study was to identify the causative agent of bacterial blight and basal glume rot of winter wheat that appeared in Serbia in 2023. To characterize the isolated bacteria (eight isolates in total), their cultural, biochemical, pathogenic, and genetic characteristics were examined. Based on the results of the LOPAT test, the isolates were classified into Pseudomonas Group Ia. The syrB and syrD genes were simultaneously detected in six wheat isolates—P0123, P0223, P0323, P0423, P0523, and P0823—while two isolates, P1123 and P1323, lacked both genes. Multilocus sequence typing (MLST) of the gapA, gltA, gyrB, and rpoD genes identified six isolates (P0123, P0223, P0323, P0423, P0523, and P0823) as Pseudomonas syringae pv. atrofaciens, whereas the remaining two isolates (P1123 and P1323) were most closely related to P. poae. Phylogenetic analysis revealed three genetically heterogeneous subgroups of P. syringae pv. atrofaciens among the wheat isolates from Serbia. Pathogenicity tests demonstrated that wheat isolates are able cause disease on wheat seedlings using three different inoculation methods: spraying the entire seedling, trimming the leaves before spraying, and wounding the leaves with multiple needles followed by spraying. Overall, isolates P0123 and P0423 were identified as the most virulent, inducing pronounced blight symptoms on wheat seedlings. In contrast, isolates P1123 and P1323 were weakly virulent and are therefore considered to be secondary or accompanying factors in plants already infected with more aggressive isolates, rather than primary pathogens responsible for disease development. This study contributes to a deeper understanding of the ecology, distribution, and pathogenic potential of bacterial communities associated with wheat blight disease in Serbia.

1. Introduction

Wheat (Triticum aestivum L.) is one of the most important cereals globally, playing a crucial role in human survival and food security. It is widely utilized in a variety of products, including bread, pasta, flour, and livestock feed [1]. Shewry and Hey [2] have highlighted that wheat is a significant source of protein, B vitamins, dietary fiber, starch, and energy. The global area dedicated to wheat cultivation spans 220.4 million hectares, yielding an average of 3.63 tons per hectare. With an annual harvest exceeding 798 million tonnes, wheat ranks third in production, following maize and rice. The leading wheat-producing countries—India, Russia, China, and the USA—account for over two-thirds of the world’s total wheat output [3].
Like many other crops, wheat is susceptible to various bacterial diseases that can disrupt normal leaf development, reduce yields, and affect global wheat prices [4]. Notable bacterial diseases affecting wheat include xanthomonad bacteria such as Xanthomonas translucens pvs. (undulosa, translucens, and cerealis); as well as pseudomonads, such as Pseudomonas syringae pvs. (japonica, syringae, atrofaciens, coronafaciens), P. cichorii, and P. fuscovaginae [4,5,6,7,8,9,10,11]. Recent genomic analyses have reclassified the bacterial leaf streak X. translucens complex into three distinct species: X. translucens sensu stricto (encompassing undulosa and translucens), X. cerealis sp. nov. (including cerealis), and X. graminis sp. nov. [12]. It is classified as a high-risk (A2 category) quarantine pathogen by the European and Mediterranean Plant Protection Organisation (EPPO) and is therefore regulated under strict quarantine measures in several countries [8,13]. Annual wheat production may decline by approximately 10% due to bacterial infections, with losses potentially reaching up to 40% during severe infections [7,14].
Infection caused by P. syringae pv. atrofaciens is characterized by brown–black discoloration on the lower part of the glume, which can extend to the grain and alter the color of the germ [7]. P. syringae pv. japonica is identified by the presence of stripes on the internodes and dark brown lesions on the nodes [5]. In contrast, P. syringae pv. syringae is characterized by small, water-soaked spots that expand into larger lesions under rainy and humid conditions. These lesions merge, creating extensive areas of necrosis on the upper leaves, while the spikes and lower leaves typically remain symptom-free [7,15]. Environmental conditions are crucial for the disease development and pathogen spread, as they typically arise in humid conditions during the spring seasons. Contaminated wheat seeds facilitate the transmission and spread of these pathogens; however, such seeds are not suitable for sowing [4,6,16]. Furthermore, epiphytic pathogen populations act as the main source of inoculum for plant infections and lead to severe plant damage under favorable weather conditions [17].
In Europe, Serbia plays a significant role in wheat production, with 682,000 hectares cultivated and an average yield of 5 tons per hectare [3]. At present, there has been no systematic identification of the pathogen species and pathogenic characteristics of wheat glume blight and leaf blight in the Vojvodina province of Serbia. The lack of relevant basic data has restricted the formulation of disease prevention and control plans. Recent research indicates a greater diversity of bacteria than previously anticipated, including pathovars that resemble known wheat pathovars [18]. Considering the significance of wheat for Serbian agriculture production, the present study aimed to identify and characterize the causal agent(s) of basal glume rot and leaf blight on wheat occurring in the Vojvodina province (north region of Serbia) during May 2023, using phenotypical and molecular tests.

2. Materials and Methods

2.1. Symptoms, Sample Collections, and Pathogen Isolation

The survey was conducted on winter wheat during May 2023 in the localities of Srbobran and Subotica within the Bačka District, Vojvodina Province, northern Serbia. The symptoms on both fields included bacterial wheat leaf blight, which began as water-soaked leaf spots, and then turned into greenish-gray necrosis and, finally, a straw color (Figure 1a). In addition, the bases of wheat chaffs showed blackish-brown watery spots (Figure 1b). The observed symptoms indicate the presence of bacterial infection. Three samples, each consisting of two symptomatic wheat plants, were collected from each locality. Diseased wheat plants, including stems and leaves, were first rinsed under tap water, dried, treated with 70% ethanol, and gently blotted dry on filter paper. Tissues taken from the margins of the spots were macerated in sterile distilled water (SDW), and after 20 min they were plated onto Nutrient Agar supplemented with 5% w/v sucrose (NSA) [19]. After three days of incubation at 26 °C, bacterial colonies with unique morphologies (levan-positive) were purified by transferring them into new plates and stored at −20 °C in Luria–Bertani (LB) broth containing 20% (v/v) glycerol.
Meteorological data were taken from the nearest meteorological station [20], distanced 20 km from the sampling location Srbobran (Figure 2) and 7.5 km from the location Subotica (Figure 3).

2.2. Phenotypic Characterization

All Pseudomonas wheat isolates were analyzed for the following biochemical characteristics: Gram reaction, presence of catalase, production of fluorescent pigment on King B medium, oxidative–fermentative metabolism of glucose, and LOPAT tests (L—production of levan on NSA, O—the presence of oxidase, P—potato soft rot, A—the presence of arginine dihydrolase, T—hypersensitivity reaction HR on tobacco leaves) [19].
Pathogenicity testing was performed on three-week-old wheat seedlings (cv. Simonida; local wheat cultivar, commonly found under Serbian fields; susceptibility to bacterial diseases remains unknown) using the three methods of artificial inoculation: (a) spraying the entire seedling; (b) trimming the leaves a few centimeters from the top with scissors before spraying; (c) wounding the leaves with multiple needles, followed by spraying [6,21]. In all methods, a bacterial suspension adjusted to 108 CFU mL−1 obtained from culture grown for 48 h on NSA at 26 °C was applied. Seedlings treated with SDW served as negative controls. Assays were performed in three replications, with 12 seedlings per replication. Inoculated and control wheat seedlings were kept in a climate chamber with 85–90% relative humidity, at 21 ± 1 °C, and with a photoperiod of 12 h light/12 h darkness.
The severity of leaf blight was assessed according to the scale of leaf area showing 1%, 5%, 10%, 25%, 50%, and 75% infection, as proposed by Duveiller et al. [22], 14 days after the inoculation. The results were subjected to analysis of variance (ANOVA) and were compared by Fisher’s LSD test, with p < 0.05 considered statistically significant (Statistica Inc. software, Version 14.0.1.25). Re-isolations were performed on NSA medium as soon as symptoms developed, and the congruence of the re-isolates with the original wheat isolates was assessed by LOPAT tests and sequencing of the gyrB gene.

2.3. Genetic Identification

Total bacterial DNA was extracted from 48-h-old pure cultures grown on NSA medium, using a genomic DNA isolation kit (DNeasy Plant Mini Kit, Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The obtained DNA was stored at −20 °C until use.

2.3.1. Detection of Genes syrB (Syringomycin Synthesis) and syrD (Syringomycin Secretion)

Two sets of primers were simultaneously used in m-PCR—B1 (CTTTCCGTGGTCTTGATGAGG) and B2 (TCGATTTTGCCGTGATGAGTC), specific to the syrB gene (syringomycin synthesis); and SyD1 (CAGCGGCGTTGCGTCCATTGC) and SyD2 (TGCCGCCGACGATGTAGACCAGC), specific to the syrD gene (syringomycin secretion)—according to the protocol of Iličić et al. [23]. PCR amplification was carried out in a 30 µL reaction volume using GreenTaq Dream Master Mix (Thermo Scientific, Vilnius, Lithuania) with 1.2 µL of template DNA and 50 pmol of each primer (B1/B2 and SyD1/SyD2) (Metabion, International AG, Planegg, Germany). The program consisted of 5 min of initial denaturation at 94 °C, followed by 35 cycles of 1.25 min at 94 °C, 1.25 min at 61 °C, and 2 min at 72 °C; and a 7 min final extension at 72 °C. Amplified DNA products were separated by electrophoresis in 1.5% (w/v) agarose gel in 0.5X Tris-borate-EDTA buffer, stained with Midori Green Advance, and visualized using UV light. Fragment sizes were estimated via comparison with the GeneRuler Low Range DNA Ladder (Thermo Scientific, Lithuania). In all reactions, the reference strain P. syringae pv. syringae (CFBP1582; known to possess syrB and syrD genes) was used as the positive control, while the negative control contained only DNA-free water.

2.3.2. Multilocus Sequence Analysis (MLSA)

Identification was performed based on the amplification of the isolate’s DNA with four primer pairs—i.e., gapA-F/R, gyrB-F/R, and rpoD-F/R, according to Sarkar & Guttman [24]; and gltA174p/gltA1192p, according to Hwang et al. [25]—targeting the amplification of four housekeeping genes: gapA (glyceraldehyde-3-phosphate dehydrogenase), gyrB (DNA gyrase subunit B), rpoD (RNA polymerase sigma factor RpoD), and gltA (citrate synthase), respectively. PCR amplifications were performed in a total reaction volume of 25 µL consisting of FastGeneTaq 2 × Ready Mix (Nippon Genetics Europe GmbH, Düren, Germany) (12.5 μL), PCR-grade water (9.5 μL), 10 μM primers (1 μL each), and sample DNA (1 μL). Amplifications were performed using the programs briefly described in the work of Popović Milovanović et al. [26]. Amplified products were sent for commercial sequencing to Macrogen Europe (Amsterdam, The Netherlands). The obtained sequences were assessed for quality and preliminarily identified through nucleotide BLAST (Basic Local Alignment Search Tool) analysis of the National Center for Biotechnology Information (NCBI) database. Final identification was performed based on phylogenetic analysis of the concatenated sequences of all four genes (2327 nt). Before the construction of the neighbor-joining (NJ) phylogenetic tree, sequences of all genes for the eight tested (P0123, P0223, P0323, P0423, P0523, P0823, P1123, and P1323) and 16 comparative strains of P. syringae pv. atrofaciens, P. syringae pv. syringae, and P. poae from the NCBI database (Table 1) were aligned using the ClustalW function of BioEdit v.7.0 and trimmed to the same size (gapA-651 nt, gltA-618 nt, gyrB-546 nt, and rpoD-512 nt). DNA sequences of the gapA, gltA, gyrB, and rpoD genes for the eight isolates analyzed in this study were deposited in the NCBI database and made publicly available.
The NJ tree was constructed in MEGA7 using the bootstrap method with 1000 replications and the Kimura 2-parameter model [27].

3. Results

From all collected wheat samples (leaves and glumes), isolations on NSA resulted in the formation of bacterial colonies, among which whitish, mucoid, convex, shiny, and levan positives dominated after three days of incubation at 26 °C. A total of eight bacterial isolates (coded as P0123, P0223, P0323, P0423, P0523, P0823, P1123 and P1323) were purified on Nutrient Agar (NA) and were used for further testing.
All wheat isolates were Gram-negative, catalase-positive, and HR-positive, but oxidase, pectolytic activity, and arginine dihydrolase negative, producing fluorescent pigment on King B medium under UV light, showing oxidative metabolism of glucose, and corresponding to fluorescent Pseudomonas Group Ia, LOPAT (+ − − − +).
Pathogenicity tests performed with all three used methods of inoculation resulted in the formation of symptoms of wheat blight (Figure 4).
Conducting the pathogenicity test by spraying the whole seedlings resulted in the appearance of symptoms after five days post-inoculation only for the isolates P0123 and P0423. By 14 days after inoculation in isolates P0123, P0223, P0323, P0423, P0523, P0823, the spots generally merged, leading to yellowing of leaves and loss of turgor, with disease severity ranging from 8.75% to 17.81%. Among the tested isolates, the statistical differences were determined, forming the four groups (Figure 5).
When using the other two inoculation methods (trimming the leaves before spraying; and wounding the leaves with multiple needles, followed by spraying), isolates (P0123, P0223, P0323, P0423, P0523, P0823) showed irregular necrotic spots with dark margins and a thin layer of chlorosis, mainly along the leaf edges or at wound sites. The lesions became visible six days post-inoculation, except for isolates P1123 and P1323, which showed some symptoms after ten days, with low disease severity. By the end of the experiment, isolates P0123, P0223, P0323, P0423, P0523, and P0823 showed disease severity ranging from 23.75% to 42.39%. Using the method of leaf trimming, the isolates formed three groups based on statistical analyses (Figure 5). In the method of wounding the leaves with multiple needles followed by spraying, four groups were formed (Figure 5). By 14 days after inoculation, isolates P0123, P0223, P0323, P0423, P0523, and P0823 showed disease severity ranging from 14.47% to 26.72%.
In general, the most virulent isolates showed to be P0123, then P0423, followed by P0223, P0323, P0523, and P0823, while P1123 and P1323 exhibited the lowest virulence using all three inoculation methods (Figure 5). By fourteen days post-inoculation, the negative control wheat seedlings—those treated with sterile water—remained symptomless.
Re-isolation was conducted for all isolates on NSA medium, and the LOPAT results and partial gyrB gene sequences matched those of the original isolates.
The genes syrB (involved in syringomycin synthesis) and syrD (responsible for syringomycin secretion), both specific to P. syringae pv. atrofaciens, were simultaneously detected in wheat isolates P0123, P0223, P0323, P0423, P0523, and P0823, along with the reference strain CFBP1582, producing DNA fragments of 752 bp and 1040 bp, respectively. In contrast, isolates P1123 and P1323 lacked both the syrB and syrD genes.
The results of preliminary identification of eight tested wheat isolates based on nucleotide BLAST analysis of the partial gapA, gltA, gyrB, and rpoD gene sequences are shown in Table 2. Based on the currently available deposited strains in the NCBI database, BLASTn analysis of the single genes could not clearly distinguish isolates P0123, P0223, P0323, P0423, P0523, and P0823 between P. syringae pv. atrofaciens and P. syringae pv. syringae. For these isolates, the percent identity with deposited strains varied from 99.54 to 100% for gapA, from 99.83 to 100% for gyrB, and from 99.41 to 100% for rpoD, depending on the isolate, while all isolates showed 100% identity with certain strains from the NCBI database based on the gltA gene. Isolates P1123 and P1323 showed the highest percent identity—99.70% (gapA), 99.68–100% (gltA), 98.72–99.63% (gyrB), and 99.03–99.22% (rpoD)—with strains in the NCBI database deposited as P. poae or Pseudomonas sp. Better resolution was obtained after performing phylogenetic analysis based on the concatenated sequences of all four genes.
The NJ phylogenetic tree, allowing identification of the eight tested isolates from this study (P0123, P0223, P0323, P0423, P0523, P0823, P1123, and P1323), is presented in Figure 6.
Three distinct clusters were clearly separated on the constructed tree, corresponding to isolates/strains of P. syringae pv. atrofaciens, P. syringae pv. syringae, and P. poae. Six isolates from this study (P0123, P0223, P0323, P0423, P0523, and P0823) were identified as P. syringae pv. atrofaciens. The isolates were genetically heterogeneous, forming three subgroups: the first comprised four isolates (P0123, P0423, P0523, and P0823), showing the highest similarity to P. syringae pv. atrofaciens strain GM 2231; the second included strain P0223, which was most closely related to P. syringae pv. atrofaciens strain ARGTr 9-1; and the third consisted of strain P0323, which was most closely related to P. syringae pv. atrofaciens strain LMG5095. The tested isolates, P1123 and P1323, were grouped in the same cluster as comparative P. poae strains, showing the highest similarity to strains RE*1-1-14 and Z9_6 (for P1323), and B116, B123, and B28 (for P1123).
DNA sequences of P. syringae pv. atrofaciens (P0123, P0223, P0323, P0423, P0523, and P0823) and P. poae (P1123 and P1323) isolates from this study have been deposited to the NCBI database under the following accession numbers for gapA (PX516133–PX516140), gltA (PX516141–PX516148), gyrB (PX516149–PX51615), and rpoD (PX619603–PX619608, PX516157 and PX516158), respectively.

4. Discussion

The current study aims to identify and describe the causal agent(s) of unusual leaf blight and basal glume rot that occurred on wheat in the Vojvodina Province (Serbia) in May 2023. Here, we report the presence of P. syringae pv. atrofaciens as the pathogen affecting winter wheat, based on findings from both conventional and molecular analyses. The occurrence of bacterial pathogens in wheat in Serbia has been generally sporadic and strongly influenced by environmental conditions. In this regard, the spring weather in May 2023 was cool, rainy, and humid (Figure 2 and Figure 3). Given the known biology of P. syringae, which thrives under such conditions for epiphytic growth, infection, and disease progression, these factors likely contributed to the development of bacterial disease on wheat. In general, losses caused by P. syringae depend on several factors, such as the incidence and severity of the disease, the pathogen’s aggressiveness, environmental conditions (particularly temperature and humidity), the host’s level of resistance or susceptibility, and the crop’s developmental stage at the time of infection [6,28,29]. Epiphytic populations of P. syringae found on leaf surfaces of numerous hosts, in combination with favorable weather conditions, also play a significant role in the disease’s epidemiology [30,31]. Furthermore, wheat seed contamination has been recognized as an important factor influencing the disease’s epidemiology [29].
All Serbian wheat isolates corresponded to fluorescent Pseudomonas Group Ia. The genes syrB (involved in syringomycin synthesis) and syrD (responsible for its secretion), both specific to P. syringae pvs. syringae and atrofaciens, were simultaneously detected in six wheat isolates, coded as P0123, P0223, P0323, P0423, P0523, and P0823. Those isolates were able to induce blight symptoms in wheat seedlings using the three different inoculation methods. In contrast, isolates P1123 and P1323 did not contain either the syrB or syrD genes and were weakly virulent on wheat seedlings. Therefore, it could be concluded that these two isolates are not of interest for disease development but, rather, represent secondary or accompanying factors in plants already infected with more aggressive isolates. The findings showed that the P. syringae pv. atrofaciens isolates (P0123, P0223, P0323, P0423, P0523, and P0823) displayed considerable variability in their virulence against the wheat cv. Simonida under laboratory conditions. Similarly, Matveeva et al. [10] demonstrated a wide range of virulence of P. syringae pv. atrofaciens isolates across 60 wheat varieties using several inoculation methods.
Multilocus sequence typing (MLST) of the individual genes gapA, gltA, gyrB, and rpoD did not allow for a clear distinction of isolates P0123, P0223, P0323, P0423, P0523, and P0823 between P. syringae pv. atrofaciens and P. syringae pv. syringae, nor did it allow for a precise identification between P. poae and Pseudomonas sp. for isolates P1123 and P1323. In contrast, MLSA using the same genes provided better resolution and clearly separated strains of the two species—P. syringae pv. atrofaciens and P. syringae pv. Syringae—into distinct tree clusters, allowing for the final identification of isolates P0123, P0223, P0323, P0423, P0523, and P0823 as P. syringae pv. atrofaciens. Isolates P1123 and P1323 were the most closely related to P. poae. Phylogenetic analysis revealed three genetically heterogeneous groups of P. syringae pv. atrofaciens among wheat isolates from Serbia: group I (P0123, P0423, P0523, and P0823) showed the highest similarity to reference strain GM 2231 (from wheat), group II (P0223) to ARGTr9-1 (from wheat, Argentina), and group III (P0323) to pathotype strain LMG 5095 (from wheat, New Zealand). The use of a single gene may lead to misinterpretation of results and incorrect identification during BLAST analysis due to the prevalence of partial sequences in the database, rather than complete genomes, which provide more accurate and reliable taxonomic identification. Consequently, when relying on BLAST analysis of a single gene or a small number of loci, closely related species may occasionally be masked or misidentified. Hwang et al. [25] highlighted that typing of four housekeeping genes (gapA, gltA, gyrB, and rpoD), instead of the seven (acnB, pfk, gyrB, rpoD, pgi, gapA, and cts/gltA) initially proposed by Sarkar and Guttman [24], allows for discrimination between closely related strains while still enabling the tracking of global clonal dynamics within the P. syringae species complex, without any significant loss in phylogenetic resolution.
In conclusion, the results clearly demonstrate that the bacterial population on wheat in Serbia is heterogeneous among the Pseudomonas syringae group. Since these bacteria are transmitted by seeds, this highlights the importance of ensuring that wheat seeds are free of bacteria, as a primary control strategy. The findings of this research provide valuable insights into the bacterial pathogen’s population structure on wheat, support the use of relevant identification methods, enhance understanding of different virulence levels of P. syringae pv. atrofaciens on wheat, and assist in monitoring changes in population structure.

Author Contributions

Conceptualization, R.I., M.S. and T.P.M.; methodology, R.I., N.P., A.J. and T.P.M.; data curation, R.I. and T.P.M.; writing—original draft preparation, R.I., M.S., N.P., A.J. and T.P.M.; writing—review and editing, R.I., M.S., F.B., S.Đ. and T.P.M.; visualization, R.I., M.S., F.B., S.Đ., and T.P.M.; supervision, M.S.; funding acquisition, R.I. and T.P.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

DNA sequences of P. syringae pv. atrofaciens (P0123, P0223, P0323, P0423, P0523, and P0823) and P. poae (P1123 and P1323) isolates from this study have been deposited to the NCBI database and made publically available. The accession numbers are listed in the Results section. The remaining data supporting this study will be shared upon request to the corresponding author.

Acknowledgments

This work was supported by the Ministry of Science, Technological Development, and Innovation of the Republic of Serbia [contract numbers 451-03-136/2025-03/200117, 451-03-136/2025-03/200053, 451-03-136/2025-03/200010].

Conflicts of Interest

Author Snežana Đorđević was employed by the company Agrounik doo. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Pandey, M.; Shrestha, J.; Subedi, S.; Shah, K.K. Role of Nutrients in Wheat: A Review. Trop. Agrobiodivers. 2020, 1, 18–23. [Google Scholar] [CrossRef]
  2. Shewry, P.R.; Hey, S.J. The Contribution of Wheat to Human Diet and Health. Food Energy Secur. 2015, 4, 178–202. [Google Scholar] [CrossRef] [PubMed]
  3. FAOSTAT. FAO Statistics Database. 2023. Available online: https://www.fao.org/faostat/en/#data/QCL (accessed on 23 September 2025).
  4. Mehmood, A.; Amin, A.; Ullah, S.; Fayyaz, M.; Fateh, F.S. A Comprehensive Review of Significant Bacterial Diseases Affecting Wheat. Pak. J. Phytopathol. 2023, 35, 191–199. [Google Scholar] [CrossRef]
  5. Maraite, H.; Bragard, C.; Duveiller, E. The Status of Resistance to Bacterial Diseases of Wheat. In Wheat Production in Stressed Environments: Proceedings of the 7th International Wheat Conference, Mar del Plata, Argentina, 27 November–2 December 2005; Springer: Dordrecht, The Netherlands, 2007; pp. 37–49. [Google Scholar]
  6. Kelpšienė, J.; Šneideris, D.; Burokienė, D.; Supronienė, S. The Presence of Pathogenic Bacteria Pseudomonas syringae in Cereals in Lithuania. Žemdirbystė 2021, 108, 291–296. [Google Scholar] [CrossRef]
  7. Tambong, J.T. Bacterial Pathogens of Wheat: Symptoms, Distribution, Identification, and Taxonomy. In Wheat—Recent Advances; IntechOpen: London, UK, 2022. [Google Scholar] [CrossRef]
  8. Wang, Q.; Li, Y.; Liu, L.; Wang, Y.; Yan, J.; Shah, S.M.A.; Chen, G. Comprehensive Genomic Insights into Unique TALEs of a Xanthomonas translucens pv. undulosa Strain from China. Plant Pathol. 2025, 74, 2455–2462. [Google Scholar] [CrossRef]
  9. Abo Bakr, A.; Khatib, F.; Kassem, M.; Kumari, S.G.; Husien, N.; Asaad, N. Investigation of the Spread of Bacterial Wheat Leaf Blight Caused by Pathotypes of Pseudomonas syringaein Some Wheat Growing Areas in Syria. Arab. J. Plant Prot. 2024, 42, 291–298. [Google Scholar] [CrossRef]
  10. Matveeva, I.E.V.; Pekhtereva, E.S.; Polityko, V.A.; Ignatov, A.N.; Nikolaeva, E.V.; Schaad, N.W. Distribution and Virulence of Pseudomonas syringae pv. atrofaciens, Causal Agent of Basal Glume Rot, in Russia. In Pseudomonas syringae and Related Pathogens; Iacobellis, N.S., Collmer, A., Hutcheson, S.W., Mansfield, J.W., Morris, C.E., Murillo, J., Schaad, N.W., Stead, D.E., Surico, G., Ullrich, M.S., et al., Eds.; Springer: Dordrecht, The Netherlands, 2003; pp. 97–105. [Google Scholar] [CrossRef]
  11. Slovareva, O.Y. Production, Export and Import of Cereals and Compilation of a List of Phytopathogenic Bacteria Associated with Them. Agrar. Bull. N. Cauc. 2023, 3, 47–54. [Google Scholar] [CrossRef]
  12. Tambong, J.T.; Xu, R.; Fleitas, M.C.; Kutcher, R. Taxonogenomic Analysis of the Xanthomonas translucens Complex Leads to the Descriptions of Xanthomonas cerealis sp. nov. and Xanthomonas graminis sp. nov. Int. J. Syst. Evol. Microbiol. 2024, 74, 006523. [Google Scholar] [CrossRef]
  13. EPPO. EPPO Global Database. 2022. Available online: https://gd.eppo.int (accessed on 23 September 2025).
  14. Fumero, M.V.; Garis, S.B.; Alberione, E.; Jofré, E.; Vanzetti, L.S. Genomic Analysis Identifies Five Pathogenic Bacterial Species in Argentinian Wheat. Trop. Plant Pathol. 2024, 49, 864–875. [Google Scholar] [CrossRef]
  15. Bockus, W.W.; Bowden, R.L.; Hunger, R.M.; Murray, T.D.; Smiley, R.W. Compendium of Wheat Diseases and Pests, 3rd ed.; American Phytopathological Society: St. Paul, MN, USA, 2010; p. viii-171. [Google Scholar]
  16. Dobrovol’skaya, T.G.; Khusnetdinova, K.A.; Manucharova, N.A.; Golovchenko, A.V. Structure of Epiphytic Bacterial Communities of Weeds. Microbiology 2017, 86, 257–263. [Google Scholar] [CrossRef]
  17. Butsenko, L.; Pasichnyk, L.; Kolomiiets, Y.; Kalinichenko, A.; Suszanowicz, D.; Sporek, M.; Patyka, V. Characteristic of Pseudomonas syringae pv. atrofaciens Isolated from Weeds of Wheat Field. Appl. Sci. 2021, 11, 286. [Google Scholar] [CrossRef]
  18. Knežević, T.; Koprivica, M.; Jevtić, R.; Obradović, A. Bacterial Diseases of Small Grains. Plant Dr. 2016, 44, 478–486. [Google Scholar]
  19. Schaad, N.W.; Jones, J.B.; Chun, W. Laboratory Guide for Identification of Plant Pathogenic Bacteria, 3rd ed.; American Phytopathological Society: St. Paul, MN, USA, 2001. [Google Scholar]
  20. Republic Hydrometeorological Service of Serbia. 2022–2023. Available online: https://www.hidmet.gov.rs (accessed on 25 September 2025).
  21. Klement, Z.; Mavridis, A.; Rudolph, K.; Vidaver, A.; Perombelon, M.C.M.; Moore, L. Inoculation of Plant Tissues. In Methods in Phytobacteriology; Klement, Z., Rudolph, K., Sands, D.C., Eds.; Academia Kiado: Budapest, Hungary, 1990; pp. 95–124. [Google Scholar]
  22. Duveiller, E.; Fucikovsky, L.; Rudolph, K. (Eds.) The Bacterial Diseases of Wheat: Concepts and Methods of Disease Management; CIMMYT: Mexico D.F., Mexico, 1997; 78p. [Google Scholar]
  23. Iličić, R.; Balaž, J.; Stojšin, V.; Bagi, F.; Pivić, R.; Stanojković-Sebić, A.; Jošić, D. Molecular Characterization of Pseudomonas syringae pvs. from Different Host Plants by Repetitive Sequence-Based PCR and Multiplex-PCR. Žemdirbystė 2016, 103, 199–206. [Google Scholar] [CrossRef]
  24. Sarkar, S.F.; Guttman, D.S. Evolution of the Core Genome of Pseudomonas syringae, a Highly Clonal, Endemic Plant Pathogen. Appl. Environ. Microbiol. 2004, 70, 1999–2012. [Google Scholar] [CrossRef]
  25. Hwang, M.S.; Morgan, R.L.; Sarkar, S.F.; Wang, P.W.; Guttman, D.S. Phylogenetic Characterization of Virulence and Resistance Phenotypes of Pseudomonas syringae. Appl. Environ. Microbiol. 2005, 71, 5182–5191. [Google Scholar] [CrossRef]
  26. Popović Milovanović, T.; Kosovac, A.; Jelušić, A.; Scortichini, M.; Trkulja, N.; Stanković, S.; Iličić, R. Genetic Diversity and Virulence Traits of Pseudomonas syringae pv. syringae Isolated from Various Hosts in Serbia. Ann. Appl. Biol. 2025, 186, 334–348. [Google Scholar] [CrossRef]
  27. Kimura, M. A Simple Method for Estimating Evolutionary Rates of Base Substitutions through Comparative Studies of Nucleotide Sequences. J. Mol. Evol. 1980, 16, 111–120. [Google Scholar] [CrossRef]
  28. Valencia-Botin, A.J.; Mendoza-Onofre, L.E.; Silva-Rojas, H.V.; Valadez-Moctezuma, E.; Cordova-Tellez, L.; Villaseñor-Mir, H.E. Effect of Pseudomonas syringae subsp. syringae on Yield and Biomass Distribution in Wheat. Span. J. Agric. Res. 2011, 9, 1287–1297. [Google Scholar] [CrossRef]
  29. Valencia-Botín, A.J.; Cisneros-López, M.E. A Review of the Studies and Interactions of Pseudomonas syringae Pathovars on Wheat. Int. J. Agron. 2012, 2012, 692350. [Google Scholar] [CrossRef]
  30. Hirano, S.S.; Upper, C.D. Bacteria in the Leaf Ecosystem with Emphasis on Pseudomonas syringae—A Pathogen, Ice Nucleus, and Epiphyte. Microbiol. Mol. Biol. Rev. 2000, 64, 624–653. [Google Scholar] [CrossRef]
  31. Iličić, R.; Balaž, J.; Ognjanov, V.; Popović, T. Epidemiology Studies of Pseudomonas syringae Pathovars Associated with Bacterial Canker on the Sweet Cherry in Serbia. Plant Prot. Sci. 2021, 57, 196–205. [Google Scholar] [CrossRef]
Agriculture 15 02473 g001
Figure 1. Pseudomonas syringae, natural infection of winter wheat observed in Serbia: (a) bacterial leaf blight, (b) basal glume rot.
Figure 1. Pseudomonas syringae, natural infection of winter wheat observed in Serbia: (a) bacterial leaf blight, (b) basal glume rot.
Agriculture 15 02473 g001
Agriculture 15 02473 g002
Figure 2. Temperature (minimum, average, maximum), rainfall, and humidity recorded for the period September 2022–May 2023 (locality Subotica).
Figure 2. Temperature (minimum, average, maximum), rainfall, and humidity recorded for the period September 2022–May 2023 (locality Subotica).
Agriculture 15 02473 g002
Agriculture 15 02473 g003
Figure 3. Temperature (minimum, average, maximum), rainfall, and humidity recorded for the period September 2022–May 2023 (locality Srbobran).
Figure 3. Temperature (minimum, average, maximum), rainfall, and humidity recorded for the period September 2022–May 2023 (locality Srbobran).
Agriculture 15 02473 g003
Agriculture 15 02473 g004
Figure 4. Pathogenicity tests, isolate P0123: (a) spraying; (b) trimming the leaves before spraying; (c) wounding the leaves with multiple needles, followed by spraying.
Figure 4. Pathogenicity tests, isolate P0123: (a) spraying; (b) trimming the leaves before spraying; (c) wounding the leaves with multiple needles, followed by spraying.
Agriculture 15 02473 g004
Agriculture 15 02473 g005
Figure 5. Disease severity for wheat isolates based on experiments conducted on wheat seedlings. Significant differences are presented with a small letter above the bar.
Figure 5. Disease severity for wheat isolates based on experiments conducted on wheat seedlings. Significant differences are presented with a small letter above the bar.
Agriculture 15 02473 g005
Agriculture 15 02473 g006
Figure 6. Neighbor-joining phylogenetic tree based on the concatenated sequences of four housekeeping genes (gapA, gltA, gyrB, and rpoD) for the eight tested isolates from this study (marked with a red rhombus), and comparative strains from the NCBI database.
Figure 6. Neighbor-joining phylogenetic tree based on the concatenated sequences of four housekeeping genes (gapA, gltA, gyrB, and rpoD) for the eight tested isolates from this study (marked with a red rhombus), and comparative strains from the NCBI database.
Agriculture 15 02473 g006
Table 1. Strains from the NCBI database used for phylogenetic analysis.
Table 1. Strains from the NCBI database used for phylogenetic analysis.
StrainHostCountryAccession No.
Pseudomonas syringae pv. atrofaciens
GM 2231wheat-CP166624
LMG5095wheatNew ZealandCP028490
UPB 463wheatCanadaCP162520
ARGTr 9-1wheatArgentinaCP147770
Pseudomonas syringae pv. syringae
Pss9644sweet cherryUnited KingdomCP066263
B48peachUSACP125300
CFBP4215-FranceLT962480
CFBP2118-FranceLT962481
B728a--CP000075
B301DpearUnited KingdomCP005969
Pseudomonas poae
B11_6wheatDenmarkCP142194
B12_8wheatDenmarkCP142188
RE*1-1-14endorhiza sugar beet-CP004045
B12_3WheatDenmarkCP142191
Z9_6WheatDenmarkCP142176
Table 2. BLASTn analysis of partial gapA, gltA, gyrB, and rpoD gene sequences of wheat isolates obtained in this study.
Table 2. BLASTn analysis of partial gapA, gltA, gyrB, and rpoD gene sequences of wheat isolates obtained in this study.
IsolateSpecies and Percent Identity
gapAgltAgyrBrpoD
P0123P. syringae pv. atrofaciens UPB 463, ARGTr 9-1/
P. syringae GAB0016, MUP17/
P. syringae pv. syringae IO 106 (100%)		P. syringae pv. atrofaciens GM 2231/
P. syringae CC457, CC440, Psy33, GAB0016 (100%)		P. syringae pv. atrofaciens GM 2231/P. syringae pv. syringae B37/09, IO109 (99.83%)P. syringae pv. syringae EC100, EC24, EC229, LMG 5496, EC2, EC101, EC20 (99.81%)
P0223P. syringae pv. atrofaciens LMG5095/
P. syringae pv. syringae IO 110 (99.54%)		P. syringae pv. atrofaciens GM 2231/
P. syringae CC457, CC440, Ps02KZ, GAB0016 (100%)		P. syrinage GAB0016 (100%)P. syringae pv. syringae EC100, EC24, EC229, LMG 5496, EC2, EC101, EC20 (99.81%)
P0323P. syringae pv. atrofaciens UPB 463, ARGTr 9-1, GM 2231/
P. syringae GAB0016, MUP17/
P. syringae pv. syringae IO 106 (100%)		P. syringae pv. atrofaciens LMG5095 (100%)P. syringae pv. atrofaciens LMG5095/P. syringae pv. syringae IZB1A. IZB2K, IZB1S, IZB2S, ST151, StP26 (100%)P. syringae pv. atrofaciens W39.6, GN-In/P. syringae pv. syringae V-85, IZB200, P5-2, EC100, TRR15/P. syringae Susan762 (99.41%)
P0423
P0523
P0823		P. syringae pv. atrofaciens UPB 463, ARGTr 9-1, GM 2231/
P. syringae GAB0016, MUP17/
P. syringae pv. syringae IO 106 (100%)		P. syringae pv. atrofaciens GM 2231/
P. syringae CC457, CC440, Ps02KZ, GAB0016 (100%)		P. syringae pv. atrofaciens GM 2231/P. syringae pv. syringae B37/09, IO109 (100%)P. syringae pv. atrofaciens W39.6, GN-In/P. syringae pv. syringae V-85, IZB200, P5-2, EC100, TRR15 (99.80%)
P1123P. poae B11_6, B12_8, B12_3, RE*1-1-1, Z9_6 (99.70%)P. poae B11_5, B11_6, B12_1, B12_3, B12_8, B05_3, W11_4, W12_7 (100%)Pseudomonas sp. BR2-22, LG1_A6 (99.63%)P. poae B11_6, RE*1-1-1, Z9_6, B05_3, Z9_2, W11_4 (99.22%)
P1323P. poae B11_6, B12_8, B12_3, RE*1-1-1, Z9_6 (99.70%)P. poae Z9_2, Z9_4, Z9_5, Z9_6 (99.68%)P. poae B11_5, B11_6, RE*1-1-1, B05_3, W11_2, W11_4 W11_9 (98.72%)P. poae B11_6, RE*1-1-1, Z9_6, B05_3, Z9_2, W11_4 (99.03%)
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Iličić, R.; Scortichini, M.; Bagi, F.; Pavković, N.; Jelušić, A.; Đorđević, S.; Popović Milovanović, T. Pseudomonas syringae Population Recently Isolated from Winter Wheat in Serbia. Agriculture 2025, 15, 2473. https://doi.org/10.3390/agriculture15232473

AMA Style

Iličić R, Scortichini M, Bagi F, Pavković N, Jelušić A, Đorđević S, Popović Milovanović T. Pseudomonas syringae Population Recently Isolated from Winter Wheat in Serbia. Agriculture. 2025; 15(23):2473. https://doi.org/10.3390/agriculture15232473

Chicago/Turabian Style

Iličić, Renata, Marco Scortichini, Ferenc Bagi, Nemanja Pavković, Aleksandra Jelušić, Snežana Đorđević, and Tatjana Popović Milovanović. 2025. "Pseudomonas syringae Population Recently Isolated from Winter Wheat in Serbia" Agriculture 15, no. 23: 2473. https://doi.org/10.3390/agriculture15232473

APA Style

Iličić, R., Scortichini, M., Bagi, F., Pavković, N., Jelušić, A., Đorđević, S., & Popović Milovanović, T. (2025). Pseudomonas syringae Population Recently Isolated from Winter Wheat in Serbia. Agriculture, 15(23), 2473. https://doi.org/10.3390/agriculture15232473

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop