AQP7 Protects Vitrified Sheep GV-Stage Oocyte Maturation via Mitochondrial Activity

Simple Summary

Oocyte vitrification is crucial for improving farm animal reproduction and preserving rare breeds, but it can cause internal damage that reduces their quality. We investigated whether a protein called aquaporin-7 (AQP7) helps protect oocytes during freezing. Our study on sheep oocytes revealed that inhibiting AQP7 significantly increased their susceptibility to damage. This damage was characterized by dysfunction of mitochondria, the cell’s power plants. Consequently, the oocytes matured poorly and had a drastically reduced potential to form embryos. Crucially, adding an antioxidant designed to protect mitochondria could partially reverse these detrimental effects. These findings identify AQP7 as a promising target for refining vitrification protocols, with the goal of enhancing breeding efficiency and safeguarding genetic diversity in sheep.

Abstract

Oocyte vitrification imposes oxidative stress that compromises maturation competence. Aquaporin-7 (AQP7) has been implicated in cellular redox regulation, but its specific role in cryopreserved oocytes remains unclear. Here, germinal vesicle (GV) stage oocytes were vitrified and warmed with AQP7 inhibitor Z433927330 (0.5, 5, 50 μM). AQP7 inhibition disrupted redox balance, compromised mitochondrial function. Consequently, it severely compromised developmental competence, leading to significantly reduced cleavage (39.90% ± 6.17 vs. 52.93% ± 3.37) and blastocyst formation rates (1.67% ± 2.89 vs. 5.17% ± 2.49) in vitro. To confirm, we performed microinjection-mediated AQP7 knockdown and overexpression and assessed their effects on maturation. AQP7 knockdown further reduced the maturation rate of vitrified oocytes (20.22% ± 3.14 vs. 36.31% ± 2.10), whereas overexpression partially restored it (43.98% ± 4.71 vs. 33.74% ± 2.21). The mitochondrial-targeted antioxidant MitoQ partially rescued the maturation rate (53.13% ± 2.75 vs. 43.52% ± 2.71). Thus, AQP7 is essential for the maturation of vitrified sheep oocytes by safeguarding intracellular redox homeostasis, thereby preventing mitochondrial dysfunction and cytoskeletal damage, and loss of embryonic developmental potential.

1. Introduction

Oocyte cryopreservation, a cornerstone of modern embryo biotechnology, is indispensable for enhancing animal reproductive efficiency and safeguarding genetic resources of rare breeds [1]. Vitrification is the core method of oocyte cryopreservation. Its principle is to rapidly cool through the temperature range where ice crystals form, thereby minimizing physical damage to cells and maintaining the integrity of cell structure and function [2]. However, oocytes are highly susceptible to cryodamage during vitrification due to their large size and low membrane permeability, which predisposes them to mechanical injury from ice crystals, osmotic imbalance, and cryoprotectant (CPA) toxicity. This could be subjected to a process that induces multiple forms of cellular dysfunctionities, including reduced membrane fluidity [3], organelle dysfunction [4], cytoskeletal disruption [5], and oxidative stress [6], all of which collectively diminish the developmental potential of oocytes after thawing. Consequently, the core mechanism of cryodamage in oocytes is closely related to the efficiency of transmembrane transport.

Among the key regulators of transmembrane water and certain solutes are the aquaporins (AQPs) family of channel proteins. As a member of this family, AQP7 adopts a six-transmembrane-α-helix architecture linked by five loops, designated A through E. Notably, the conserved asparagine-proline-alanine (NPA) motifs are located within loops B and E [7]. These structural features enable AQP7 to specifically and efficiently transport water molecules, glycerol, and the signaling oxidant hydrogen peroxide (H₂O₂) and other small molecules [8]. In adipocytes, AQP7 mediates the transmembrane transport of glycerol, and its downregulation leads to increased glycer-ol-3-phosphate synthesis, promoting the accumulation of triglycerides [9]. As the bone marrow mesenchymal stem cells proliferate, AQP7 continuously expels excess intracellular H₂O₂, maintaining redox balance [10]. The expression and functional significance of AQP7 in oocytes appear to vary across species in the context of reproduction. In humans, AQP7 is differentially expressed in granulosa cells, oocytes, and embryos of patients with polycystic ovary syndrome, and shows a negative correlation with insulin regulation [11]. In bovine, AQP7 expression in in vitro matured oocytes is closely associated with their cryotolerance, suggesting a role in water and cryoprotectant movement during vitrification [12]. In mouse oocytes, although earlier reports suggested AQP7 may expedite the diffusion of water and cryoprotectants under vitrification stress [13,14], there remains significant uncertainty regarding the relationship between AQP7 and key physiological processes.

This study aims to investigate how AQP7 orchestrates oocyte cryopreservation. We hypothesized that AQP7 safeguards oocyte cryotolerance by maintaining redox homeostasis and mitochondrial function. To test this, GV-stage oocytes were treated with the AQP7 inhibitor Z433927330 during vitrification [15]. We then assessed oxidative stress markers, mitochondrial function, calcium homeostasis, transcriptional and translational activity, and cytoskeletal integrity to elucidate the underlying mechanisms.

2. Materials and Methods

2.1. Experimental Design

Ovine cumulus–oocyte complexes (COCs) were randomly allocated to fresh controls or vitrification treatments with or without graded doses (0.5, 5, 50 μM) of the AQP7 inhibitor Z433927330 [16]. After defining the optimal inhibitor concentration based on oocyte survival and in vitro maturation rates, we examined redox status, mitochondrial function, calcium homeostasis, transcription–translation activity, and the abundance of meiosis-related cytoskeletal proteins. Subsequently, to test whether the maturation decline induced by AQP7 inhibition could be reversed by targeting mitochondria, a rescue experiment was conducted with four groups: vitrification control (Vit), vitrification with 0.5 μM Z433927330 (Vit + Z433), vitrification with 0.5 μM Z433927330 plus 100 nM MitoQ (Vit + Z433+MitoQ), and vitrification with 100 nM MitoQ alone (Vit + MitoQ). MitoQ was supplemented in the in vitro maturation (IVM) medium throughout the 24 h culture period. All experiments were performed in three independent replicates (Figure 1).

Figure 1. Illustration of the experimental procedures.

2.2. Ethics Statement

All protocols strictly followed the Guide for Care and Use of Agricultural Animals in Agricultural Research and Teaching, and received prior approval from the Animal Use Committee at Hebei Agricultural University (NO: 2025146).

2.3. Chemicals and Reagents

Unless specified, all reagents were from Sigma-Aldrich (St. Louis, MO, USA).

2.4. Collection of COCs

Ovaries collected at a nearby abattoir were conveyed to the lab within 3 h in prewarmed normal saline around 37 °C supplemented with penicillin and streptomycin. Upon arrival, all subsequent procedures were performed using sterile techniques. COCs were collected by manually piercing 2–6 mm follicles under a microscope (ECLIPSE Ti-s, Nikon, Tokyo, Japan) in handling medium containing penicillin-streptomycin. Only those exhibiting at least three intact cumulus cell layers and homogeneous cytoplasm were selected for further use.

2.5. Vitrification and Warming of Oocytes

COCs underwent a vitrification protocol involving thrice washing in basal medium (BM; TCM199-Hepes + 20% FBS), then held for 3 min in a 7.5% dimethyl sulfoxide (DMSO)/7.5% ethylene glycol (EG) pretreatment solution before being plunged into vitrification medium. After brief equilibration, COCs were transferred to the vitrification medium within 25 s, which comprised 15% DMSO/15% EG, and 0.5 M sucrose. Each Cryotop carrier (Beijing, China) was loaded with 5–8 oocytes in a minimal volume and then plunged into liquid nitrogen.

For warming, the oocytes were released by rapidly immersing the Cryotop leaves in 0.5 M sucrose for 60 s. Subsequently, the oocytes underwent stepwise dilution in decreasing sucrose concentrations, starting with a 3-min rinse in 0.25 M sucrose and followed by a 5-min rinse in 0.125 M sucrose. This sucrose dilution series was then followed by three final rinses in basal medium (BM).

A 50 mM stock of Z433927330 (Selleck, Shanghai, China) in DMSO was diluted into the pretreatment, vitrification, and warming media to give 0.5, 5, or 50 μM, which were selected based on our preliminary experiments [17]. For all vitrification groups (Vit control and Vit + Z433 groups), the final concentration of DMSO was equalized to match that of the 50 μM Z433927330 group.

2.6. Cumulus Collection and In Vitro Maturation (IVM) of Oocytes

The collection of cumulus cells was dissociated with 0.1% hyaluronidase from GV stage COCs according to the previous methods [18]. The COCs were cultured for 24 h at 38.5 °C, 5% CO₂, in humidified air, using tissue culture medium 199 (TCM199) fortified with 20 ng/mL epidermal growth factor (EGF), 10 mg/mL follicle-stimulating hormone (FSH), 1 mg/mL estradiol 2 (E2), 1 mmol/L L-glutamine, 10 mg/mL luteinizing hormone (LH), and 10% fetal bovine serum (FBS). For the specified rescue experiment groups, the IVM medium was further supplemented with mitoquinone (MitoQ) at a final concentration of 100 nM. COC expansion areas were measured by ImageJ v1.51j8 (NIH, Bethesda, MD, USA) after indicated treatments. First polar body extrusion was then microscopically assessed.

2.7. In Vitro Fertilization (IVF) and Embryo Culture (IVC) of Oocytes

Motile spermatozoa were isolated from thawed sheep semen using a discontinuous Percoll density gradient centrifugation, with the gradient formed by 40% and 90% Percoll solutions. Purified sperm were diluted to 1 × 10⁶ motile sperm/mL and added to pre-equilibrated IVF droplets (IVF Bioscience, Beijing, China), followed by a 20 h coincubation with COCs at 38.5 °C under 5% CO₂. Post-fertilization COCs underwent washing in IVC-I medium (IVF Bioscience, Beijing, China) to eliminate attached sperm prior to a 48 h culture period. Subsequent embryo development was supported by sequential culture in IVC-II (IVC-I supplemented with 10% FBS) and then in IVC-III (further supplemented with 27 mg/mL glucose) media for 5 days. Medium was refreshed periodically after rinsing the embryos. Cleavage and blastocyst formation rates were recorded as endpoints.

2.8. Microinjection of siRNA and Overexpression Plasmid

GV-stage oocytes were collected and transferred into droplets of DPBS supplemented with 20% FBS, covered with mineral oil, and placed under an inverted microscope. For knockdown experiments, siRNA was diluted with DEPC-treated water to a concentration of 30 μM, and approximately 5 pL of the solution was injected into the cytoplasm of GV-stage oocytes. Oocytes injected with AQP7-specific siRNA (sense: 5′-AGAGUUUUCUCCUAAAACCAU-3′; antisense: 5′-GGUUUUAGGAGAAAACUCUGG-3′) were designated as the AQP7-KD group, while those injected with negative control siRNA (scrambled siRNA, 5′-UUCUCCGAACGUGUCACGUTT-3′) served as the NC group. For overexpression experiments, the plasmid carrying the AQP7 coding sequence was diluted to a stock concentration of 30 ng/μL, and approximately 5 pL of the solution was injected into each oocyte. Oocytes injected with the recombinant pcDNA3.1(−)/AQP7-overexpressing vector were designated as the AQP7-OE group, whereas those injected with the empty pcDNA3.1 vector served as the pcDNA3.1 control group. After microinjection, oocytes were cultured in IVM medium containing 0.2 mM IBMX in a humidified atmosphere of 5% CO₂ at 38.5 °C for 20 h, followed by vitrification and subsequent maturation in IVM medium without IBMX.

2.9. Western Blot and Immunofluorescence (IF) Staining

To lyse the oocytes, 300 oocytes per sample were dissolved in 60 µL of 1× Reducing SDS Loading Buffer (Cell Signaling Technology, Danvers, Massachusetts, USA), supplemented with protease/phosphatase inhibitors, followed by heating at 65 °C for 10 min. After electrophoretic separation and transfer to PVDF membranes (Biotopped, Beijing, China), the membranes were blocked for 2 h using 5% nonfat dry milk in Tris aminoethane tween (TBST) buffer (Biotopped, Beijing, China), followed by incubation with the primary antibodies: AQP7 (1:500, Fabgennix, Frisco, TX, USA) and GAPDH (1:10,000, Cell Signaling Technology, Danvers, MA, USA) at 4 °C overnight. Following TBST washes, the membranes were subjected to a 1 h incubation with related horseradish-peroxidase-conjugated secondary antibodies at room temperature and then to incubation in ECL reagents (Biotopped, Beijing, China).

For immunofluorescence staining, oocytes were fixed in 4% paraformaldehyde for 1 h, permeabilised for 1 h using 0.5% Triton X-100, and blocked with 3% BSA for 1 h (BIOESN, Shanghai, China). They were then incubated overnight at 4 °C with primary antibodies against AQP7 (1:200, Fabgennix, Frisco, TX, USA) phosphorylated Ezrin/Radixin/Moesin (anti- p- ERM, 1:200, CST, Danvers, MA, USA) and phosphorylated Myosin Regulatory Light Chain (anti- p- MRLC, 1:200, CST, Danvers, MA, USA), followed by a 1-h room-temperature incubation with appropriate secondary antibodies. Nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI, Solarbio, Beijing, China) for 3 min and imaged on a fluorescence microscope. After identical fixation and permeabilization, F-actin was visualized by 30 min exposure to 1:200 phalloidin (Abbkine, Wuhan, China), then imaged on a fluorescence-inverted microscope.

2.10. Wound-Healing Assay

Cumulus cells were added into Culture-Insert 2 Well strips (COOLRUN, Guangdong, China) placed in a 12-well plate. Upon reaching confluency, the Culture-Insert was lifted with sterile forceps. After two PBS rinses (Servicebio, Wuhan, China), the monolayer was refed with DMEM + 1% FBS and monitored at 0, 12, and 24 h; images were captured on an Olympus microscope.

2.11. Analysis of Hydrogen Peroxide (H₂O₂) and Glutathione (GSH) Level

H₂O₂ in GV oocytes was quantified as described by Khatun et al. [19]. Specifically, oocytes were loaded for 20 min using 10 µM 2′,7′-dichlorofluorescein diacetates (2′,7′ -DCFH-DA, Solarbio, Beijing, China). To label GSH, GV oocytes were incubated for 20 min with 10 μM CMF2HC (Cell Tracker Blue; Beyotime, Shanghai, China), and imaged on the same fluorescence microscope and quantified by measuring fluorescence intensity.

2.12. ELISA

After clearing by centrifugation (12,000× g, 10 min), the IVM medium supernatant was stored at −80 °C. 8-Hydroxy-2′-deoxyguanosine (8-OHdG) levels were quantified with a commercial ELISA kit (Jingmei, Jiangsu, China). Briefly, standards and samples were added to the pre-coated 96-well plate and incubated at 37 °C for 60 min. After five washes, biotin-labeled antibody was added and incubated for 30 min at 37 °C, followed by another five washes. Horseradish peroxidase-conjugated avidin was then added and incubated for 30 min at 37 °C. After a final wash, substrate solution was added and incubated in the dark at 37 °C for 15 min. The reaction was terminated by stop solution, and the absorbance was measured at 450 nm using a microplate reader.

2.13. Detection of the Mitochondrial Activity

Rinse with PBS three times before staining to thoroughly remove the serum components in the culture medium, as the esterase in the serum may non-specifically decompose the probe, affecting the staining efficiency. Transfer the oocytes to the first drop of preheated 37 °C 100 μL PBS using a pipette or pipette. Gently blow and tap a few times to make the oocytes roll in the droplet, thoroughly washing away the culture medium adhering to the surface. Quickly transfer the oocytes to the second drop of fresh PBS and repeat the above action. Then carry out the third transfer and cleaning. Following three rinses by PBS, oocytes were stained for 20 min with 100 nM Mito-Tracker Red CMXRos (Yeasen, Shanghai, China), washed again, and imaged at 579 nm excitation on a fluorescence microscope. Fluorescence was quantified with ImageJ v1.51j.

2.14. Detection of Mitochondrial Reactive Oxygen Species (mitoROS)

After 30 min incubation with Mito-SOX (5 μM, Invitrogen, Carlsbad, CA, USA) and a brief rinse, oocytes were imaged with a fluorescence microscope.

2.15. Detection of Mitochondrial Permeability Transition Pore (mPTP) Opening

MPTP opening was evaluated by employing cobalt-mediated quenching of calcein-AM fluorescence [20]. In accordance with the kit (BestBio, Shanghai, China) protocol, a freshly prepared staining solution containing calcein-AM and CoCl₂ was loaded for 45 min in the incubator. After dye removal, oocytes were incubated for an additional 30 min in IVM medium under identical conditions, and was captured on a fluorescence microscope and quantified with ImageJ v1.51j.

2.16. Determination of Mitochondrial Membrane Potential (MMP)

JC-1 kit (Servicebio, Wuhan, China) was employed to evaluate MMP. Oocytes were incubated in JC-1 working solution for 30 min at 37 °C in the dark according to the manufacturer’s instructions, washed, and imaged on a fluorescence microscope. Following imaging, the red-to-green fluorescence ratio was then calculated.

2.17. Determination of the Ca²⁺ Levels

Subcellular Ca²⁺ levels were assessed using specific fluorescent probes following the published protocol [21]: Fluo 3-AM (Solarbio, Beijing, China) for cytosolic Ca²⁺, Rhod 2-AM (Solarbio, Beijing, China) for mitochondrial Ca²⁺ ([Ca²⁺]ₘ), and Fluo 4-AM (Invitrogen, Carlsbad, CA, USA) for endoplasmic reticulum Ca²⁺ ([Ca²⁺]ᴇʀ). Following a 30-min dye loading period, oocytes were washed three times prior to fluorescence microscopy imaging.

2.18. Assessment of Nascent RNA and Protein Synthesis in Oocytes

GV oocytes were pulsed for 1 h with 5-ethynyluridine in milrinone-supplemented IVM medium and then processed using Click-iT RNA Imaging Kits for visualization. To label nascent proteins, metaphase II (MII) oocytes were incubated with L-homopropargylglycine (HPG) in IVM medium for 30 min, then processed with Click-iT^® HPG Alexa Fluor^® Protein Synthesis Assay Kit for detection.

2.19. RNA Extraction and Quantitative Real-Time Reverse-Transcription Polymerase Chain Reaction (qRT-PCR)

Total RNA was isolated from 100 GV-stage oocytes per group or cumulus cells with a Qiagen kit and stored at −80 °C. Purity and concentration were verified on a NanoDrop 2000 (260/280 ≈ 1.9–2.1). First-strand cDNA was prepared with a Vazyme reverse transcription kit. After initial denaturation (95 °C, 120 s), 40 cycles of 95 °C (5 s) and 60 °C (30 s) were run, with β-actin as the internal reference. Analysis was calculated via 2^−ΔΔCt. Primer sequences are provided in Table 1.

Table 1. Primers used in this study.

Gene Accession Number	Gene Name	Primer Sequence (5′→3′)	Product Size
XM_004003220.5	Ptx3	TATCGGTCCATAATGCTTG	108 bp
		CTTTGAATCCCAGGTGC
NM_001009432.1	Ptgs2	CTGTGCCTGATGACTGC	217 bp
		TGGTTCTTTCCCTTGGT
XM_004011666.5	Has2	GTGCTGAGTCTGGGCTAT	220 bp
		CTGTGGCAATGAGAAAGA
XM_004004704.4	Tnfaip6	AGTTGGATACCCTATTGTGA	236 bp
		CATACTTGAGTCTAATGTGCC
XM_060400055.1	Cat	CCAGCGACCAGATGAAAC	175 bp
		CGGTCAAAGTGAGCCATT
XM_027972220.2	Gclm	CCTATTGAAGATGGAGTGAATC	189 bp
		GCAGGAGGCAAGATTAACT
NM_001145185.2	Sod1	CCACTTCGAGGCAAAGGGAGA	167 bp
		CCTTTGGCCCACCGTGTTTT
NM_001280703.1	Sod2	CCGTCAGCCTTACACCAAGT	112 bp
		CAAGCCACGCTCAGAAACAC
XM_015102643.4	Gclc	CATCAGAGACCCGCTGACTC	297 bp
		TGGGCGACCTTCATGTTCTC
NM_001009784.3	β-actin	CTCTTCCAGCCTTCCTTCCT	178 bp
		GGGCAGTGATCTCTTTCTGC

2.20. Statistical Analysis

All experiments were repeated at least three times. Statistics were performed in SPSS 21.0 (IBM Corporation, Armonk, NY, USA) by one-way ANOVA and Chi-square tests. * p < 0.05, ** p < 0.01 was considered statistically significant. Data are shown as mean ± standard error of the mean (SEM).

3. Results

3.1. Inhibition of AQP7 Impairs the Maturation and Developmental Competence of Vitrified GV-Stage Oocytes in Sheep

To explore the role of AQP7 in the in vitro maturation of ovine GV-stage vitrified oocytes, we first examined its expression via Western blot and immunofluorescence. The results showed that AQP7 protein expression was detectable in ovine GV-stage oocytes (Figure 2A,B). These findings suggest that AQP7 is clearly expressed in ovine GV-stage oocytes and may play a potential involvement in the extreme stress of oocyte cryopreservation. Based on these findings, in this experiment, GV-stage ovine oocytes were exposed to graded doses of the AQP7 inhibitor Z433927330 (0.5, 5 and 50 μM) during equilibration, vitrification and post-warming steps, because previous studies have shown that vitrification increases the abundance of AQP7 [14]. The results showed that, relative to the Vit group, every Z433927330-treated group exhibited sharply lower survival and maturation rates (p < 0.05, Table 2 and Figure 2C). Given that 0.5 μM Z433927330 was sufficient to significantly downregulate the in vitro maturation rate of vitrified oocytes, this effective dose was adopted in all subsequent trials. Furthermore, the developmental competence of oocytes after in vitro fertilization was significantly compromised by AQP7 inhibition. As summarized in Table 3, results showed that vitrification significantly reduced oocyte developmental competence (cleavage rate: 52.93% ± 3.37 vs. 70.76% ± 2.86; blastocyst rate: 5.17% ± 2.49 vs. 31.42% ± 3.89). Furthermore, the addition of 0.5 μM Z433927330 further suppressed the developmental capacity (cleavage rate: 39.90% ± 6.17 vs. 52.93% ± 3.37; blastocyst rate: 1.67% ± 2.89 vs. 5.17% ± 2.49). Therefore, the concentration of 0.5 μM Z433927330 was selected for all subsequent studies.

Figure 2. Effects of AQP7 on in vitro maturation of ovine GV-stage vitrified oocytes. (A) Western blot representative images of AQP7 in sheep GV stage. (B) Representative immunofluorescence images of AQP7 in sheep oocytes at the GV stage. Scale bar, 100 μm. (C) Representative images of oocyte maturation following exposure to 0.5, 5, and 50 μM Z433927330. The red arrow represents the first polar body. Scale bar, 100 μm. (D) Representative images of cumulus expansion in the fresh group, Vit group, and Vit + Z433 group. Scale bar, 100 μm. (E) Comparison of cumulus area in the fresh group (n = 99), Vit group (n = 106), and Vit + Z433 group (n = 103). (F) Images showing scratch area at 0, 12, and 24 h in the fresh group, Vit group, and Vit + Z433 group. Scale bar, 100 μm. (G) Comparison of scratch area at 0, 12, and 24 h in the fresh group, Vit group, and Vit + Z433 group. (H) Transcript abundance of cumulus-expansion genes Ptx3, Ptgs2, Has2, and Tnfaip6. * p < 0.05, ** p < 0.01, ns no significant difference. (I) Relative fluorescence intensity of AQP7 signals in the NC group (n = 35) and AQP7-KD group (n = 38). (J) Relative fluorescence intensity of AQP7 signals in the pcDNA3.1 group (n = 37) and AQP7-OE group (n = 36). (K) Representative immunofluorescence images of AQP7 expression in AQP7-KD and (L) AQP7-OE oocytes. Scale bar, 100 μm.

Table 2. Effect of Z433927330 supplementation on GV-stage ovine oocyte.

Groups	Number of Oocytes	Survival Rate %	Maturation Rate %
Fresh	182	96.22 ± 4.37 (174/182) a	80.04 ± 4.41 (138/174) a
Vit	226	67.14 ± 2.54 (152/226) b	63.96 ± 1.67 (97/152) b
Vit + 0.5μM Z433	203	58.45 ± 2.26 (112/203) c	44.43 ± 2.88 (50/112) c
Vit + 5μM Z433	211	53.60 ± 2.02 (101/211) d	37.58 ± 1.26 (38/101) d
Vit + 50μM Z433	211	50.85 ± 2.09 (79/211) d	21.75 ± 1.92 (17/79) e

Survival rate was judged microscopically on shape, perivitelline space, and membrane integrity. ^{a, b, c, d, e}: Bars labeled with distinct letters within a column differ (p < 0.05).

Table 3. Effects of AQP7 inhibition on the developmental competence of vitrified oocytes after in vitro fertilization.

Groups	Cleavage Rate%	Blastocyst/Cleavage%
Fresh	70.76 ± 2.86 (111/157) a	31.42 ± 3.89 (35/111) a
Vit	52.93 ± 3.37 (79/149) b	5.17 ± 2.49 (4/79) b
Vit + 0.5μM Z433	39.90 ± 6.17 (46/116) c	1.67 ± 2.89 (1/46) b

Values are presented as mean ± SEM. Within a column, values with different superscript letters (^{a, b, c}) differ significantly (p < 0.05).

Cumulus expansion serves as a key indicator of oocyte maturation and correlates directly with developmental competence [22]. In this experiment, cumulus expansion remained limited in the Vit group and was further restricted in the Vit + Z433 (p < 0.01, Figure 2D,E). Next, we also tested the migration rate of cumulus cells and the abundance of genes related to migration and expansion. The scratch assay revealed a marked reduction in the wounded area once AQP7 was blocked (p < 0.01, Figure 2F,G). Correspondingly, the mRNA abundance of the cumulus cells expansion marker genes Ptx3, Ptgs2 and Has2 was significantly reduced in the Vit + Z433 group (p < 0.05, Figure 2H). These data indicate that AQP7 plays a key role in the in vitro maturation of vitrified oocytes during the GV stage in sheep.

To rule out possible off-target effects or toxicity of the inhibitor and to better establish the positive role of AQP7 in the maturation of vitrified oocytes, we performed microinjection to knock down or overexpress AQP7 in GV-stage oocytes prior to vitrification and in vitro maturation. Successful knockdown and overexpression were confirmed by immunostaining (p < 0.05, Figure 2I–L). Following vitrification, the maturation rate of oocytes in the AQP7-KD group was significantly lower than that in the negative control group (20.22% ± 3.14 vs. 36.31% ± 2.10, Table 4), indicating that AQP7 downregulation exacerbates the impairment of oocyte maturation caused by vitrification. In contrast, oocytes in the AQP7-OE group showed a significantly higher maturation rate compared to the empty vector control group (43.98% ± 4.71 vs. 33.74% ± 2.21, Table 5), suggesting that AQP7 overexpression partially rescues the vitrification-induced decline in maturation.

Table 4. Effect of AQP7 knockdown on the maturation of vitrified ovine GV-stage oocytes.

Groups	Maturation Rate%
NC	36.31 ± 2.10 (39/109) a
AQP7-KD	20.22 ± 3.14 (34/167) b

Values are presented as mean ± SEM. Within a column, values with different superscript letters (^{a, b}) differ significantly (p < 0.05).

Table 5. Effect of AQP7 overexpression on the maturation of vitrified ovine GV-stage oocytes.

Groups	Maturation Rate%
pcDNA3.1	33.74 ± 2.21 (36/108) a
AQP7-OE	43.98 ± 4.71 (58/132) b

Values are presented as mean ± SEM. Within a column, values with different superscript letters (^{a, b}) differ significantly (p < 0.05).

3.2. AQP7 Inhibition Affects Oocyte Maturation Through Oxidative Stress

The survival and maturation of oocytes are highly dependent on the regulation of redox homeostasis. Our results showed that inhibition of AQP7 exacerbated oxidative stress: intracellular H₂O₂ surged (p < 0.01, Figure 3A,B), and GSH levels plummeted (p < 0.05, Figure 3A,C). Correspondingly, Vit + Z433 group markedly downregulated the mRNA abundance of Gpx4, Gclc, Gclm, Sod1 and Sod2 (p < 0.05, Figure 3D). To further clarify the extent of damage caused by oxidative stress, we measured the levels of 8-OHdG, a representative marker of oxidative damage, in the oocyte maturation medium and cumulus cells [23]. The results showed that after AQP7 inhibition, the levels of 8-OHdG in oocyte in vitro maturation culture medium (p < 0.05, Figure 3E) significantly increased. These findings establish AQP7 as a critical regulator of redox balance in cryopreserved ovine GV oocytes.

Figure 3. Inhibition of AQP7 affects oxidative stress. (A) Representative images of hydrogen peroxide (H₂O₂) and glutathione (GSH) levels in oocytes. Scale bar, 100 μm. (B) Relative fluorescence intensity of H₂O₂ signals in the fresh group (n = 55), Vit group (n = 60), and Vit + Z433 group (n = 53). (C) Relative fluorescence intensity of GSH signals in the fresh group (n = 104), Vit group (n = 98), and Vit + Z433 group (n = 103). (D) mRNA expression levels of oxidative stress-related genes Cat, Gpx4, Gclc, Gclm, Sod1, and Sod2 in oocytes. (E) 8-OHdG content in the in vitro maturation medium. * p < 0.05, ** p < 0.01.

3.3. AQP7 Inhibition Triggers Mitochondrial Functional Collapse via MitoROS Burst and mPTP Open in Vitrified Oocytes

Mitochondria are important targets of oxidative stress, and their functional status is closely related to oocyte maturation. In this study. Our results showed that, Vit oocytes exhibited a sharp reduction in mitochondrial activity related to fresh oocytes, and Vit + Z433 treatment drove a further significant decrease (p < 0.01, Figure 4A,B). Subsequently, our detection of mitochondrial reactive oxygen species revealed that mitochondrial superoxide levels surged in vitrified oocytes compared to the fresh group and were further elevated by Z433927330 cotreatment (p < 0.01, Figure 4C,D). Since the accumulation of mitoROS is known to impair mitochondrial function, we accordingly investigated its effects on mPTP permeability and MMP. The assessment revealed that Vit oocytes displayed a marked reduction in mPTP signal, and this decline was exacerbated in the Vit + Z433 group (p < 0.01, Figure 4E,F), indicating that AQP7 inhibition leads to abnormal suppression of mPTP. The MMP was significantly lower in the Vit group than in the Fresh group and was further reduced in the Vit + Z433 group (p < 0.01, Figure 4G,H), suggesting that mitochondrial dysfunction was exacerbated.

Figure 4. Oxidative stress caused by mitochondrial damage. (A) Representative images of mitochondrial activity in oocytes from the Fresh, Vit, and Vit + Z433 groups. Scale bar, 100 μm. (B) Mitochondrial fluorescence intensity in the fresh group (n = 103), Vit group (n = 96), and Vit + Z433 group (n = 97). (C) Representative images of mitochondrial superoxide levels in oocytes from the Fresh, Vit, and Vit + Z433 groups. Scale bar, 100 μm. (D) Relative fluorescence intensity of mitochondrial superoxide signals in the fresh group (n = 77), Vit group (n = 80), and Vit + Z433 group (n = 77). (E) Representative images of mitochondrial permeability transition pore opening in oocytes from the Fresh, Vit, and Vit + Z433 groups. Scale bar, 100 μm. (F) Relative fluorescence intensity of mitochondrial permeability transition pore opening signals in the fresh group (n = 75), Vit group (n = 66), and Vit + Z433 group (n = 71). (G) Representative images of mitochondrial membrane potential assessed by JC-1 staining in oocytes from the Fresh, Vit, and Vit + Z433 groups. Scale bar, 100 μm. (H) Relative fluorescence intensity of mitochondrial membrane potential in the fresh group (n = 79), Vit group (n = 83), and Vit + Z433 group (n = 81). ** p < 0.01.

3.4. AQP7 Inhibition Disrupts Compartmentalized Calcium Dynamics: Endoplasmic Reticulum (ER) Depletion Coupled with Mitochondrial Overload in Vitrified Oocytes

Precise regulation of oocyte calcium homeostasis is a critical prerequisite for normal maturation. Following previous research methods, we used specific fluorescent probes Fluo 4-AM, Rhod 2-AM, and Fluo 3-AM to detect endoplasmic reticulum calcium ion concentration ([Ca²⁺]_ER), mitochondrial calcium ([Ca²⁺]_m) and cytoplasmic calcium levels, respectively, to assess the calcium homeostasis status of oocytes in different treatment groups. As shown in the figure, the calcium level in the ER of the Vit group was significantly lower than that in the fresh group (p < 0.01), and the calcium fluorescence intensity in the ER of the Vit + Z433 group was further significantly lower than that in the Vit group (p < 0.05, Figure 5A,B), indicating that AQP7 inhibition worsened aberrant calcium efflux from the ER store. Rhod 2-AM detection results revealed that [Ca²⁺]_m load rose sharply after vitrification and climbed even higher upon AQP7 blockade (p < 0.01, Figure 5A,C). Results for cytoplasmic calcium levels showed no significant differences in Fluo 4-AM fluorescence intensity among the three groups (Figure 5A,D).

Figure 5. AQP7 inhibition leads to disruption of oocyte calcium homeostasis. (A) Representative images of [Ca²⁺]_ER, [Ca²⁺]_m and cytoplasmic calcium in the Fresh group, Vit group, and Vit + Z433 group. Scale bar, 100 μm. (B) Fluo 4-AM signal quantification in the Fresh group (n = 55), Vit group (n = 56), and Vit + Z433 group (n = 52). (C) Rhod 2-AM signal quantification in the Fresh group (n = 50), Vit group (n = 58), and Vit + Z433 group (n = 59). (D) Quantitative analysis of Fluo 3-AM signal in the Fresh group (n = 57), Vit group (n = 52), and Vit + Z433 group (n = 56). * p < 0.05, ** p < 0.01, ns no significant difference.

3.5. AQP7 Inhibition Impairs Transcriptome Dynamics and Proteome Remodeling in Vitrified Oocyte Maturation

The normal progression of transcription and translation activities is a crucial molecular basis for oocyte maturation. As shown in the figure, relative to the fresh group, the 5-Ethynyluridine (EU) fluorescence intensity was significantly reduced in the Vit group (p < 0.01, Figure 6A,B), while the EU fluorescence intensity declined even further under Vit + Z433 treatment compared with the Vit group (p < 0.05, Figure 6A,B), indicating that the downregulation of AQP7 impairs oocyte transcription. HPG fluorescence dropped sharply after vitrification (p < 0.01, Figure 6C,D) and declined further under Vit + Z433 (p < 0.05, Figure 6C,D), revealing that AQP7 suppression compromises translational activity in oocytes.

Figure 6. AQP7 Oocyte transcriptional and translational functions are weakened with downregulation of AQP7. (A) Representative fluorescence images of nascent RNA labeled by 5-Ethynyluridine (EU, green) in oocytes from the Fresh, Vit, and Vit + Z433 groups. Nuclei are stained with DAPI (blue). Scale bar, 100 μm. (B) Quantitative analysis of EU fluorescence intensity in the fresh group (n = 166), Vit group (n = 169), and Vit + Z433 group (n = 167). (C) Representative fluorescence images of nascent protein synthesis labeled by L-Homopropargylglycine (HPG, green) in oocytes from the Fresh, Vit, and Vit + Z433 groups. Nuclei are stained with DAPI (blue). Scale bar, 100 μm. (D) Quantitative analysis of HPG fluorescence intensity in the Fresh group (n = 94), Vit group (n = 84), and Vit + Z433 group (n = 81). * p < 0.05, ** p < 0.01.

3.6. AQP7 Inhibition Exacerbates Vitrification-Induced Cytoskeletal Disruption and Cortical Architecture Impairment

The balance of the cytoskeleton is an important structural foundation for maintaining the morphology and maturation process of oocytes. Quantitative F-actin analysis revealed that, compared to the fresh group, F-actin fluorescence intensity was significantly reduced in the Vit group (p < 0.05, Figure 7A), whereas in the Vit + Z433 group, F-actin fluorescence intensity decreased extremely significantly compared to the Vit group (p < 0.01, Figure 7B), suggesting that AQP7 downregulation leads to impaired integrity of oocyte cytoskeletal filaments. p-ERM (phosphorylated Ezrin/Radixin/Moesin) is a key molecule regulating cortical tension by anchoring the cytoskeleton to the membrane. It declined precipitously after vitrification and fell even further when AQP7 was inhibited (p < 0.01, Figure 7C,D). p-MRLC (phosphorylated myosin regulatory light chain) is another core protein regulating cortical tension. Relative to fresh oocytes, p-MRLC signal was significantly enhanced after vitrification (p < 0.01, Figure 7E,F), with a more pronounced increase in the Vit + Z433 group (p < 0.05, Figure 7E,F). Collectively, AQP7 inhibition exacerbates abnormal changes in F-actin, p-ERM, and p-MRLC cytoskeletal-related indicators in these oocytes.

Figure 7. AQP7 impact on oocyte cytoskeletal architecture. (A) Representative fluorescence images of F-actin (labeled by phalloidin, green) in oocytes from the Fresh, Vit, and Vit + Z433 groups, with nuclei stained by DAPI (blue). Scale bar, 100 μm. (B) F-actin signal quantitation in the fresh group (n = 87), Vit group (n = 88), and Vit + Z433 group (n = 89). (C) Representative fluorescence images of phosphorylated Ezrin/Radixin/Moesin (p-ERM, green) in oocytes from the three groups, with DAPI (blue) and DIC images shown. (D) Quantitative analysis of p-ERM signal intensity in the fresh group (n = 86), Vit group (n = 75), and Vit + Z433 group (n = 93). (E) Representative fluorescence images of phosphorylated Myosin Regulatory Light Chain (p-MRLC, green) in oocytes from the three groups, with DAPI (blue) and DIC images shown. (F) Quantitative analysis of p-MRLC fluorescence intensity in the Fresh group (n = 117), Vit group (n = 126), and Vit + Z433 group (n = 125). * p < 0.05, ** p < 0.01.

3.7. MitoQ Partially Rescued the Oocyte Maturation Defect Caused by AQP7 Inhibition

Based on the findings that AQP7 inhibition exacerbates oxidative stress in vitrified oocytes, we hypothesized that mitochondrial oxidative stress is a key mediator of AQP7-mediated injury. To test this, we conducted a functional rescue experiment by supplementing the maturation medium with 100 nM MitoQ, a concentration documented in the literature to effectively alleviate oxidative stress in oocytes [24]. As shown in Table 4, treatment with the AQP7 inhibitor significantly reduced the maturation rate of oocytes compared to the Vit control group (p < 0.05, Table 4). However, MitoQ significantly rescued the decrease in maturation rate caused by AQP7 inhibition (p < 0.05, Table 6).

Table 6. Effect of Z433927330 and MitoQ supplementation on GV-stage ovine oocyte.

Groups	Number of Oocytes	Maturation Rate %
Fresh	157	80.59 ± 4.83 (127/157) a
Vit	161	62.69 ± 0.97 (101/161) b
Vit + Z433	149	43.52 ± 2.71 (65/149) c
Vit + Z433+MitoQ	143	53.13 ± 2.75 (76/143) d
Vit + MitoQ	143	73.60 ± 2.86 (105/143) e

^{a, b, c, d, e}: Bars labeled with distinct letters within a column differ (p < 0.05).

4. Discussion

Oocyte vitrification technology, as a core strategy for long-term oocyte preservation [25], holds significant importance in fields such as human assisted reproductive technology [26], animal germplasm resource conservation [27], and endangered species protection [28,29,30]. However, stress damage caused during vitrification often leads to a significant decline in oocyte developmental capacity, limiting the widespread application and success rate of this technology [31]. AQP7, a pivotal aquaporin, underpins cellular water balance, substance transport, and microenvironmental homeostasis. Its reproductive expression is rapidly becoming a shared focal biomarker for assessing and treating female fertility [11,32,33]. Here, we employed Z433927330 to dissect how AQP7 modulates vitrified GV-stage oocyte maturation and to uncover the underlying pathways.

We detected the expression of AQP7 in ovine GV-stage oocytes, suggesting its potential role in cellular water homeostasis and cryoprotection. To confirm AQP7 function in the maturation of vitrified oocytes in sheep, we first treated sheep GV-stage oocytes with different concentrations of the AQP7 inhibitor in the pretreatment, vitrification and thawing solutions. Both survival and maturation declined progressively with increasing inhibitor concentration. This trend aligns with previous reports of reduced survival rates in mouse vitrified oocytes following AQP7 inhibition [14], directly confirming the necessity of AQP7 function for the recovery of vitrified oocytes. Extending these observations, the functional impact of AQP7 inhibition was further evident in the oocytes’ subsequent developmental competence. The functional significance of AQP7 was further corroborated by assessing post-fertilization developmental competence. Vitrification itself significantly compromised embryonic development, evident in the reduced cleavage and blastocyst rates compared to the fresh oocytes. Crucially, AQP7 inhibition with 0.5 μM Z433927330 (Vit + Z433 group) exacerbated this damage, leading to a further significant decline in the cleavage rate and maintaining a critically low blastocyst yield. As a complementary approach to rule out off-target effects of the inhibitor, we performed microinjection to knock down or overexpress AQP7 in GV-stage oocytes. These experiments corroborate the essential role of AQP7 in promoting the maturation of vitrified ovine GV-stage oocytes and confirm that the effects observed with the inhibitor are specific rather than off-target. Beyond the oocyte itself, AQP7 inhibition also impaired the function of its surrounding somatic cells. Cumulus cells, as crucial supportive cells for oocyte maturation, play a vital role in oocyte development through their expansion and migration capabilities [34,35]. We found that AQP7 inhibition significantly reduced cumulus expansion area and migration capacity, while mRNA abundance of cumulus expansion marker genes Ptx3, Ptgs2, and Has2 was significantly reduced. This disruption may further exacerbate subsequent oocyte stress and damage [36].

Oocyte maturation is highly dependent on the maintenance of redox homeostasis [37], and the oxidative stress imbalance induced by AQP7 inhibition serves as an important starting point for a series of subsequent damages. Following treatment with Z433927330, H₂O₂ accumulation and GSH depletion were observed in GV-stage oocytes, while the abundance of antioxidant genes Cat, Gpx4, Gclc, Sod1 and Sod2 is down-regulated. At the same time, the levels of the oxidative damage marker 8-OHdG increased in maturation culture medium. In oocytes, Cat rapidly clears excess H₂O₂, serving as a crucial defense against oxidative stress [38]. Gpx4 encodes glutathione peroxidase 4, a specialized antioxidant enzyme that utilizes GSH to clear hydrogen peroxide [39]. Gclc plays a central regulatory role in GSH synthesis [40]. Sod1 and Sod2 can clear superoxide free radicals in the cytoplasm and mitochondrial matrix [41,42]. The abnormal regulation of their abundance collectively leads to uncontrolled oxidative stress following AQP7 inhibition, serving as a key factor for subsequent pathological changes such as mitochondrial damage and calcium homeostasis disruption.

Mitochondria, as the core of cellular energy metabolism, are also sensitive targets of oxidative stress [43], and their functional state is closely related to oocyte maturation capacity [44]. AQP7 inhibition significantly exacerbated the decline in mitochondrial activity, and elevated mitoROS levels. The accumulation of mitoROS disrupts membrane structural integrity, leading to increased mPTP opening and reduced MMP [45], further impairing mitochondrial structure and function. Notably, AQP7 not only functions as a channel for water and H₂O₂, but also facilitates the transport of glycerol across membranes in various tissues. Within cells, glycerol serves as a substrate for mitochondrial energy production [46]. In oocytes, AQP7 expression is closely associated with maturation and subsequent embryonic development, and its expression pattern negatively correlates with insulin regulation, suggesting a potential role for AQP7 in oocyte energy metabolism [11]. Consistent with this notion, emerging evidence indicates that mitochondria undergo stage-specific spatial reorganization during oocyte maturation: they are evenly distributed in GV-stage oocytes, but become aggregated at the metaphase I (MI) and MII stages—a dynamic process essential for proper spindle assembly and chromosome segregation [47]. Disruption of mitochondrial integrity, as induced by AQP7 suppression, may impair this reorganization, thereby compromising meiotic progression. Indeed, loss of proteins critical for mitochondrial function has been shown to reduce membrane potential and lead to meiotic arrest, aneuploidy, and fertilization failure [48], reinforcing the idea that mitochondrial fitness is indispensable for successful meiosis. Moreover, oocytes possess an active quality control mechanism that preferentially sequesters dysfunctional mitochondria into polar bodies, ensuring the retention of healthy organelles to support post-fertilization development [49]. However, under conditions of AQP7 inhibition, structural damage to mitochondria may overwhelm or disrupt this quality control system, resulting in the persistence of damaged mitochondria and ultimately triggering meiotic failure. Thus, AQP7 likely safeguards oocyte competence by maintaining mitochondrial integrity and function.

As a pivotal second messenger, Ca²⁺ is essential for oocyte meiosis, fertilization, and early embryonic development [50,51]. Following AQP7 inhibition, ER calcium levels significantly decreased, while mitochondrial calcium accumulation increased. Although cytoplasmic calcium levels remained unchanged, this abnormal calcium distribution was sufficient to impair oocyte physiological functions. As the primary calcium storage reservoir, ER calcium depletion may impair protein folding and trigger ER stress [52]. The dynamic balance of mitochondrial calcium ions is also closely related to mitochondrial function [53]. Moderate mitochondrial calcium ion uptake can regulate mitochondrial energy metabolism and ROS production [54], but mitochondrial calcium overload further activates mPTP opening [55], exacerbating mitochondrial ROS production [56], forming a vicious cycle with previously observed mitochondrial dysfunction. Therefore, AQP7 participates in the balanced regulation of calcium release from ER and uptake into mitochondria. Its functional deficiency leads to calcium homeostasis disruption, thereby affecting calcium-dependent cytoskeletal remodeling and meiosis progression.

Transcription and translation activities are the molecular basis for oocyte maturation, providing the necessary genetic information and protein synthesis for cell division, structural remodeling, and functional maintenance [57,58]. The GV stage is the stage at which oocyte meiosis is arrested at the prophase I stage. At this stage, transcriptional activity is responsible for synthesizing a large reserve of mRNA required for meiosis recovery and maturation, including cell cycle regulatory factors, cytoskeletal remodeling-related genes, antioxidant proteins, and cumulus cell communication-related molecules [59,60]. In this study, AQP7 inhibition led to a decrease EU fluorescence intensity in GV oocytes, indicating insufficient transcriptional reserves of functional genes, which directly affects the transition of oocytes from the GV phase to the M I phase [61]. As the terminal stage of maturation, MII oocyte translational activity focuses on translating mRNA stored into functional proteins to ensure oocyte fertilization capacity and early embryonic developmental potential [62]. In this study, AQP7 inhibition resulted in a decrease in HPG fluorescence intensity in MII oocyte, indicating that protein synthesis was impaired. Even though there was a partial mRNA reserve during the GV phase, it could not be effectively converted into functional proteins. Newly synthesized RNA and protein are well-established indicators of transcriptional and translational activity in oocytes, and have been widely employed to assess meiotic progression and stress responses across species. Here, AQP7 inhibition led to a marked reduction in both EU and HPG fluorescence intensity in ovine oocytes, suggesting a global suppression of transcriptional and translational activity. These findings are consistent with previous observations in human and mouse oocytes, where loss of PATL2—an oocyte-specific RNA-binding protein—resulted in decreased maternal mRNA expression and reduced protein synthesis levels in germinal vesicle oocytes, ultimately leading to oocyte maturation arrest. PATL2 regulates mRNA homeostasis by interacting with EIF4E and CPEB1, and its phosphorylation at the S279 site triggers ubiquitin-mediated proteasomal degradation, thereby modulating PATL2 protein levels during oocyte maturation [63]. Together, these studies suggest that aberrant transcriptional and translational regulation represents a common mechanism underlying impaired oocyte maturation across mammalian species. It is worth noting that transcription is closely associated with translation. Insufficient transcription reserves directly limit the supply of translation substrates [64], while mitochondrial dysfunction, oxidative stress, and calcium disorders further inhibit the translation process [65], forming a vicious cycle of synergistic damage to transcription and translation. This is also an important molecular mechanism underlying the significant decrease in oocyte maturation rate after AQP7 inhibition.

Polar body extrusion marks oocyte maturation and relies on cytoskeletal remodeling and cortical tension control [66]. F-actin underpins oocyte meiosis and polar body extrusion as a core cytoskeletal element [67]. In this study, after treatment with Z433927330, the abundance of F-actin in the oocyte cytoskeleton decreased, which may lead to a reduction in the structural stability of the oocyte and subsequently hinder polar body expulsion. At the same time, the precise regulation of cortical tension relies on the synergistic action of two core molecules, p-ERM and p-MRLC [68]. P-ERM is located in the cortical region of the oocyte and enhances cortical tension by cross-linking with F-actin and membrane proteins [69,70]. P-MRLC is a phosphorylated and activated myosin light chain that mediates the sustained contraction of the actin-myosin contractile ring to generate mechanical force [71], ultimately promoting the separation of the polar body from the oocyte [72]. It has been reported that p-ERM remains distributed in the cortex throughout meiosis, while p-MRLC gradually moves from the cortex into the cytoplasm, the subsequent increase in myosin-II concentration in the cytoplasm leads to a decrease in cortical tension and ultimately results in meiosis defects [70,73]. In this study, AQP7 inhibition led to a decrease in p-ERM fluorescent intensity and an increase in cytoplasmic p-MRLC fluorescent intensity, resulting in decreased cortical zone stability and difficulty in completing the mechanical contraction required for polar body separation. In our early research, the PI3K/AKT/AQP7 signaling pathway regulates mitochondrial function in vitrified GV oocytes by controlling intracellular H₂O₂ levels, thereby reducing oxidative stress, preserving calcium homeostasis, and ultimately protecting cytoskeletal integrity [17]. This mechanistic link between AQP7-mediated redox regulation and cytoskeletal stability provides a molecular basis for the observed changes in F-actin and cortical tension-related proteins following AQP7 inhibition. Therefore, AQP7 safeguards oocyte cytoskeletal integrity and cortical tension balance.

MitoQ is a mitochondria-targeted antioxidant [74]. This study provided crucial causal evidence for the mechanism by which AQP7 regulates oocyte maturation through salvage experiments. Our results demonstrate that the rescue of the impaired maturation rate by MitoQ positions oxidative stress as a key downstream event of AQP7 inhibition. However, the rescue brought by MitoQ was partial restore the maturation rate. This indicates that while oxidative stress is a central pathway, AQP7 inhibition concurrently impairs oocyte maturation through additional mechanisms independent of mitochondrial ROS. Beyond oxidative stress, AQP7 inhibition may compromise oocyte maturation through multiple interconnected pathways. As a glycerol channel, AQP7 facilitates the transport of a key substrate for mitochondrial energy production, and its inhibition could lead to metabolic insufficiency in oocytes [15]. AQP7 is also involved in transmembrane water movement, and its dysfunction may disrupt osmotic regulation during vitrification [12]. Furthermore, the reduced cumulus expansion and migration capacity following AQP7 inhibition suggest disrupted cumulus-oocyte communication, which is critical for metabolic support and regulatory signaling [75]. These multi-faceted effects highlight the complexity of AQP7′s functions. A deep understanding of how AQP7 regulates these diverse cellular processes in sheep oocytes is crucial for optimizing cryopreservation protocols and improving assisted reproductive technologies for this species.

5. Conclusions

This study establishes AQP7 as a key determinant of cryotolerance in vitrified ovine GV-stage oocytes. Our findings reveal that AQP7 acts as a critical regulator of redox homeostasis, preserving mitochondrial integrity, calcium signaling, and cytoskeletal dynamics during post-vitrification maturation. The concordant results between inhibitor treatment and microinjection, where AQP7 knockdown phenocopied the inhibitor effects while overexpression partially rescued maturation, confirm that the observed phenotypes are specifically attributable to AQP7 function rather than off-target toxicity. The partial rescue achieved by MitoQ further implicates mitochondrial ROS as a key downstream effector. Despite these findings, several limitations should be acknowledged. First, the precise molecular mechanism by which AQP7 regulates redox balance remains to be determined. Second, although MitoQ partially restored maturation rates, the contribution of other AQP7 substrates to cryoprotection was not examined. Future studies should focus on exploring combinatorial strategies that enhance AQP7 function while mitigating mitochondrial oxidative damage, which may lead to optimized vitrification protocols. Ultimately, a deeper understanding of the AQP7-mediated cryopreservation protection mechanism can provide a basis for the transformation and application of cross-species assisted reproductive technologies.