Abstract
Epichloë fungal endophytes hold promise in sustainable agriculture by fortifying cool-season grasses such as Elymus spp. against various stresses. Elymus spp. are widely distributed in Northwest China with a high incidence of endophyte infections. In this study, we identified 20 Epichloë endophytic fungal strains carried by five Elymus spp. from five areas of Northwest China and systematically characterized their morphology, molecular phylogeny, mating type, and alkaloid diversity for the first time. The morphological characterization underscores strain diversity, with variable colony textures and growth rates. A phylogenetic analysis confirms all strains are E. bromicola, emphasizing their taxonomic status. Alkaloid-encoding gene profiling delineates distinct alkaloid synthesis capabilities among the strains, which are crucial for host adaptability and resistance. A mating-type analysis reveals uniformity (mtAC) across the Epichloë strains, simplifying breeding strategies. Notably, the Epichloë strains exhibit diverse alkaloid synthesis gene profiles, impacting host interactions. This research emphasizes the ecological significance of Epichloë endophytes in Elymus spp. ecosystems, offering insights into their genetic diversity and potential applications in sustainable agriculture.
Keywords:
Epichloë; Elymus; phylogenetics; mating types; alkaloid diversity; sustainable agriculture 1. Introduction
Epichloë fungi are grass endophytes that complete most of their life cycle in the intercellular space of the host grass but do not cause obvious external symptoms on the host [1]. These endophytic fungi belong to the phylum Ascomycota (order, Hypocreales; family, Clavicipitaceae) [2,3]. These endophytes and their host grasses have undergone a long period of co-evolution, forming a very stable and mutually beneficial symbiotic relationship [4,5,6]. Endophytes can provide numerous benefits to host plants. For instance, they can enhance the host’s resistance to at least 40 types of pests, and they bolster grass resistance against pathogens such as Alternaria alternata and Bipolaris sorokiniana [7,8]. Moreover, they have a positive effect on the ability of grasses to withstand adverse environments such as low temperatures, drought, waterlogging, and salinity [9,10,11,12,13]. In addition, Epichloë endophytes can produce alkaloids, which enhance the host’s resistance to insects, but their toxicity is the cause of poisoning in livestock [14,15]. There are four types of bioactive alkaloids produced by Epichloë endophytes, including ergot alkaloids, indole-diterpenoids, peramine, and lolines [16,17]. Peramine and lolines have strong insect-resistant properties and provide a significant selection advantage for plants infected by endophytic fungi [18], whereas ergot alkaloids and indole–diterpenes are involved in livestock poisoning [19]. However, recently, new symbionts and new germplasms have been produced that are resistant to stress, are non-toxic to livestock, and can be stably inherited [4,5]. This breeding method has unveiled a new research idea and technology for breeding [20]. The primary condition of this method is to screen out animal-safe endophyte strains that can be inoculated, that is, endophytic fungi that only produce insect resistance and do not produce toxic alkaloids to livestock [21]. At present, through molecular biology techniques such as gene knockout and whole-genome sequencing, the genes that regulate alkaloid synthesis and their synthetic pathways have been clearly defined [22,23,24,25]. The use of conventional PCR and agarose gel electrophoresis can quickly and accurately predict the type of alkaloid production of endophytes [16,26,27], which provides technical support for the screening of animal-safe strains.
Elymus plants, which belong to the Poaceae family, also known as the grass family, comprise approximately 150 species. They are mainly distributed between the Arctic region and the subtropical region [28]. To date, 12 species of Elymus plants have been described in Northern China. They consistently play important roles in the production of grassland animal husbandry and the improvement of the ecological environment [28]. Several studies have found five Epichloë endophytic fungi symbioses with Elymus grasses, including Epichloë elymi, Epichloë typhina, Epichloë canadensis, Epichloë glyceriae, and Epichloë bromicola, two of which were previously found in China [28,29,30,31,32,33,34,35]. Although Elymus grasses are widely distributed in Northwest China, incidences of infections of these grasses by Epichloë fungal endophyte in most areas have not been reported. Additionally, there are few reports on the diversity of alkaloids produced by Elymus plants. Therefore, in this study, 20 Epichloë fungal endophyte strains were strained and identified from several Elymus grasses collected from five regions in three provinces of Northwest China. Moreover, their taxonomic status was determined by morphological characteristics and a phylogenetic analysis. Finally, the potential alkaloid biosynthesis and mating-type characteristics of each strain were determined by detecting the alkaloid synthesis genes. We believe that the results of the alkaloid synthesis gene test will provide important information about the host range of Epichloë and the risks of Epichloë–Elymus symbioses to grazing animals and herbivorous insects, further providing basic materials for germplasm innovation using the endophytic fungi of grasses.
2. Materials and Methods
2.1. Biological Materials
The Elymus grasses with mature seeds were collected from the Gansu, Sichuan, and Inner Mongolia provinces of China from August 2020 to October 2021 (Table 1). To guarantee the independence and representation of the samples taken, only one tiller was collected from a single plant. Some seeds of infected grasses (E+) were used to isolate Epichloë endophyte strains, while others were stored at 4 °C to maintain the vitality of the endophytes and seeds.
Table 1.
Infection frequency of Epichloë in Elymus plant samples.
2.2. Isolation of Epichloë Endophyte
The collected seeds underwent verification for endophyte infections through aniline blue staining and a subsequent microscopic examination [36]. Roughly 50% of the seeds obtained from one tiller were allocated for propagation purposes, while the remaining were designated for the isolation of Epichloë endophytes. The seeds were surface sterilized with 70% ethanol for 1 min, followed by treatment with a 5% sodium hypochlorite solution for 1 min, then washed three times with sterile distilled water, and allowed to air dry on sterilized filter papers. Seeds were placed on a potato dextrose agar (PDA) containing 100 μg/mL of ampicillin and 50 μg/mL of streptomycin sulfate to inhibit bacterial contaminations, and then the PDA plates were wrapped with a sealing film, cultured in the dark at 22 °C, and examined regularly for endophyte growth for up to 2 weeks. After 2 weeks, the endophytic fungal colonies grew around the seeds, and the hyphae were transferred onto fresh PDA plates to obtain a pure culture.
2.3. Morphological Examination
For the morphological examination, mycelial plugs with a diameter of about 0.4 cm were taken from a 30-day-old colony and were inoculated in the center of a fresh PDA medium. The plates were then sealed with a sealing film and cultured at 22 °C in the dark for 2 weeks, the sterilized coverslips were obliquely inserted at the edge of colony growth at an angle of 45°, and the mycelia were cultured until they grew to the surface of the coverslips. After staining with aniline blue, the morphology of the conidia and conidiogenous cells were observed and photographed using an automated upright fluorescence microscope (Olympus Corporation, Tokyo, Japan, Olympus, BX63), and the size of the conidia was measured (width and length, n = 50) along with the conidiogenous cells (length, n = 30). The 0.4 cm mycelial discs were inoculated in the center of a fresh PDA medium, with six replicates of each strain incubated at 22 °C and 25 °C in the dark, and the colony diameters were measured once a week for eight weeks, and the average growth rate of each colony was calculated.
2.4. DNA Isolation and PCR Amplification of Endophytes
The fungal strains were grown on a PDA at 25 °C for 4 weeks. After 4 weeks, fresh mycelia were harvested by a sterilized scalpel and transferred into an Eppendorf tube. The total genomic DNA was extracted using the HP fungal DNA kit (OMEGA, Beijing, China), according to the manufacturer’s instructions. Two genes, tefA (elongation factors) and tubB (microtubulin β-tubulin), were selected for PCR amplification. The primers used were tub2-exon 4u-2 (GTTTCGTCCGAGTTCTCGAC), tub2-exon 1d-1 (GAGAAAATGCGTGAGATTGT), tef1-exon 5u-1 (CGGCAGCGATAATCAGGATAG), and tef1-exon 1d-1 (GGGTAAGGACGAAAAGACTCA) [37,38]. The PCR reaction was carried out in a total volume of 25 μL of 2 × SanTaq Fast PCR Mix (12.5 μL), 1 μL of an upstream primer (10 μM), 1 μL of a downstream primer (10 μM), 9.5 μL of double-distilled H2O, and 1 μL of a DNA template (40 ng/μL). The PCR cycling program was as follows: 94 °C for 5 min (denaturation at 94 °C for 30 s, annealing at 55 °C (tefA) or 45 °C (tubB) for 30 s, and extension at 72 °C for 1 min) × 34 cycles and finally, extension at 72 °C for 10 min. The PCR products were subjected to Sanger sequencing by Sangon Bioengineering (Shanghai) Co., Ltd. (Shanghai, China).
2.5. Phylogenetic Analysis
Sequences with high similarity to the target sequences were retrieved from the National Center for Biotechnology Information (NCBI) website and were used to construct phylogenetic trees. Multiple Alignment using Fast Fourier Transform (MAFFT) (version 7.505) was used for multiple sequence alignments, and the Gblocks plug-in in the PhyloSuite software (version 1.2.2) was used to select the conserved sequence [39]. Sequence saturation detection was performed on the selection results of conserved sequences using the DAMBE software (version 4.0.36) [40]. The results show Iss < Iss.c with p < 0.05, indicating that the sequences are not saturated and can be analyzed phylogenetically. The IQ tree software (version 2.0.2) was used to select the optimal model and to construct the maximum likelihood phylogenetic tree [41]. The sequences were deposited in GenBank under the accession numbers PP804222—PP804240 for tubB and PP801109—PP801128 for tefA.
2.6. Alkaloid Gene and Mating-Type Analysis
A PCR analysis was conducted to assess the presence of genes associated with the biosynthesis of four major groups of alkaloids in all endophytic strains. We used specific primers to amplify 8 fragments of the perA gene, which is involved in peramine alkaloid biosynthesis [42]; 11 genes (LTM/IDT cluster) related to indole-diterpenoid alkaloid synthesis that were previously identified in Epichloë festucae Fl1 [43,44]; 11 genes (LOL cluster), previously identified in E. festucae E2368, that are required for the production of loline alkaloids; and 14 genes (EAS cluster), previously identified in E. inebrians E818, that are required for the production of ergot alkaloids, and the mating-type genes mtBA and mtAC were also included [16,24,45]. The genomic DNA from the twenty strains was amplified by PCR using target-specific primers, as described previously [29,46,47]. The PCR analyses were performed in a total volume of 25 μL (2 × Taq Master Mix containing 1.0 U of Taq DNA polymerase, 1.5 mM of MgCl2, 200 μm each of dNTP (ComWin Biotech Corp., Ltd., Beijing, China), 10 μL of double-distilled H2O, 5 ng of DNA, 1 μM of a target-specific forward primer, and 1 μM of a target-specific reverse primer). The PCR program included the following: 94 °C for 1 min, followed by 30 cycles of 94 °C for 15s, 56 °C for 30 s, 72 °C for 1 min, and then 10 min at 72 °C, before a final annealing temperature of 4 °C. PCR products were detected by 1.5% agarose gel electrophoresis and photographed. Epichloë sp. HboTG-4 D2, strained from Hordeum bogdanii, was known to produce paramine, and Epichloë sp. B3, strained from Hordeum bogdanii, was known to produce chanoclavine I, D-lysergic acid, ergovaline, and paspaline [48]. These two endophytes were used as the positive control for the genes related to these alkaloids, and water was used as the negative control.
3. Results
3.1. Morphological Characteristics
A total of 20 endophytic fungal strains were successfully isolated from 109 Elymus plants in five areas (Table 1). The infection rate of different grass species in different regions was different. The lowest carrier rate was Elymus nutans (8.33%), distributed in Maqu County, Gansu Province, and the highest carrier rate was Elymus cylindrica (81.82%), distributed in Hongyuan County, Sichuan Province. Endophytic fungal strains were isolated from grasses carrying endophytic fungi in five regions, which generally exhibited the typical characteristics of endophytic fungi. However, owing to differences in the hosts and distribution areas, the strains exhibited morphological diversity in the colony texture, colony color, morphology, and size of conidia and conidiophores, as well as the colony growth rate.
The colonies of fungal strains exhibited the typical characteristics of Epichloë endophytic fungi: the mycelium of E. cylindrica endophytic fungi (Figure 1A–F) appeared dense, with a white felt-like front, a gray center at the back, and gradually lightening towards the edges. The colony of E. sibiricus endophytic fungi (Figure 1G–H) displayed a white front, with the color transitioning from brown to light yellow from the center to the edge at the back. Strain FC1 exhibited a cotton-like aerial mycelium, while strain FC4 appeared brush-like. The colony of the endophytic fungi in E. nutans (Figure 1I–K) showed a white cotton-like appearance at the front, with strain GA7 appearing white brush-like with a central bulge, and the back of the colony ranging from grey to pale yellow. The colony of the endophytic fungi from E. tangutorum (Figure 1L–O) exhibited a uniform cotton-like appearance on the top. Strain KEM4 showed varying densities of aerial hyphae, being dense in the center and loose at the edges, with the bottom color transitioning from light brown to light yellow from the center to the edge. The endophytic fungal colonies of E. dahuricus (Figure 1P–T) appeared white and cotton-like at the top, with the bottom color transitioning from grey to pale yellow from the center to the edge. The conidiophores and conidia of each strain exhibited similar morphological characteristics and were mostly boat-shaped, kidney-shaped, oval, and asymmetrical. The 20 strains of endophytic fungi showed differences in the growth rate, as shown in Table 2. The slowest growth rate was observed in FC1 (0.59 ± 0.04 mm/d) at 22 °C and in GA2 (0.83 ± 0.03 mm/d) at 25 °C. Strain LE6 exhibited the fastest growth rate under both 22 °C and 25 °C, with the mycelium expanding to cover the entire medium by the end of the fourth week (the outer diameter of the culture dish was 90 mm, and the inner diameter was 86 mm).
Figure 1.
Colony morphology and conidia and conidiogenous cells of Epichloë endophytes (PDA, 22 °C;, 32 days). (1) A: AD3; B: AD5; C: AD16; D: ADX8; E: ADX9; F: ADX12; G: FC1; H: FC4; I: GA2; J: GA4; K: GA7; L: KE1; M: KEM1; N: KEM3; O: KEM4; P: LB1; Q: LE1; R: LE3; S: LE6; T: LE7; (2) 1: the top of the colony; 2: the bottom of the colony; 3: conidia (black arrow) and conidiogenous structures (white arrow); (3) the white scale is 2 cm, and the black scale is 20 μm; (4) conidia and conidiogenous cells were not observed in strain ADX12.
Table 2.
Morphological characteristics of Epichloë endophytes isolated from Elymus spp.
3.2. Phylogenetic Analyses
The sequencing results of tefA and tubB genes were both single copies, indicating that the 20 endophytic fungal strains isolated in this study were non-hybrids. The maximum likelihood phylogenetic tree constructed based on the intron sequences of 61 tubB genes is shown in Figure 2, and the strains obtained in this study are clustered in the branch of E. bromicola, with a bootstrap value of 97%. Among them, AD3, AD5, ADX8, ADX9, ADX16, KE1, KEM1, KEM3, KEM4, FC1, FC4, GA2, GA4, and GA7 were clustered with E. bromicola strained from Hordeum brevisubulatum, Hordeum bogdanii, Elymus dahuncus, and Elymus tangutorum; and LE1, LE3, LE6, and LE7 were clustered in the same branch with E. bromicola from Roegneria Kamoji, Bromus erecta, Bromus benekenii, and Bromus ramosus. The maximum likelihood phylogenetic tree constructed based on the intron sequence of the tefA gene is shown in Figure 3. This is similar to the phylogenetic analysis based on 54 tefA gene sequences, with all strains being grouped with E. bromicola. In summary, the maximum likelihood phylogenetic trees based on tefA and tubB gene sequences were constructed, and the results were consistent. The results show that the classification status of these 20 strains was E. bromicola.
Figure 2.
Molecular phylogeny derived from a maximum likelihood (substitution model K2P+G4) analysis of the tubB gene from representative Epichloë species. The tree was rooted with Claviceps purpurea as the outgroup.
Figure 3.
Molecular phylogeny derived from a maximum likelihood (substitution model K2P+G4) analysis of the tefA gene from representative Epichloë species. The tree was rooted with Claviceps purpurea as the outgroup.
3.3. Alkaloid Gene Profiling and Mating-Type Analysis
The results of the mating-type gene detection (Table 3) show that the 20 strains only contained the mating-type gene mtAC, so they all belonged to mating type A. The strains ADX8, ADX12, ADX9, AD16, AD3, AD5, LE6, LE1, and LE3 did not contain the ppzA–∆R domain (representing the allele ppzA-2), which was previously thought to impede peramine synthesis; ppzA–∆R means ppzA from which the R domain was deleted. The implication of this deletion is that the final enzymatic step from diketopiperazine to peramine is missing in the ∆R versions, such that pyrrolopyrazine-1,4-diones are produced instead of peramine. Recent studies have indicated its capacity to encode different metabolites and to confer protective effects on the host [49]. These strains contained the remaining seven fragments of the ppzA (formly perA) gene: ppzA-A1, ppzA-T1, ppzA-C, ppzA-A2, ppzA-M, ppzA-T2, and ppzA-R (representing the allele ppzA-1). It was predicted that they could produce the anti-insect alkaloid peramine. The strains FC1, FC4, GA7, GA2, GA4, KE1, KEM1, KEM3, KEM4, and LB1 contained seven gene fragments except ppzA-R, predicting that they could not produce the insect-resistant alkaloid peramine.
Table 3.
Mating type and segments of peramine biosynthesis genes in the genome of Epichloë.
The strains LE6, LE1, LE3, and LE7 did not contain any of the 14 genes in the EAS gene cluster, and it was predicted that they could not produce any kind of ergot alkaloids. The remaining 16 strains contained 11 of the 14 genes in the EAS gene cluster, which were dmaW, easF, easC, easE, easD, easA, easG, cloA, lpsB, lpsA, and easH, respectively (Table 4). It was predicted that they could produce chanoclavine I (CC) and D-lysergic acid and ergovaline (ERV). But due to the lack of three genes at the end of the metabolic pathway lpsC, easO, and easP, ergonovine (EN) and lysergic acid α-hydroxyacetamide (LAH) could not be produced.
Table 4.
Ergot alkaloid (EAS) biosynthesis genes in the genome of Epichloë endophytes strained from Elymus spp.
The distribution of indole–diterpene alkaloid synthesis genes in endophytic fungi can be divided into three categories, as shown in Table 5. The first category includes strains LE6, LE1, LE3, and LE7. These four strains did not contain any indole–diterpene alkaloid synthesis genes, and it is predicted that they cannot produce the final product lolitrem B and other intermediate metabolites. The second category includes strains GA2, GA4, GA7, FC1, and FC4, but these strains did not contain idtP, idtE, and idtJ, indicating that they could only produce paspaline. The third category of strains includes ADX8, ADX12, ADX9, AD16, AD3, AD5, KE1, KEM1, KEM3, KEM4, and LB1, and these 11 strains contain idtG, idtB, idtM, idtC, idtS, idtP, idtO, idtF, and idtK. It is predicted that they can produce terpendole K and paxilline (PAX), but due to the lack of idtE and idtJ, these 11 strains were predicted to not produce the final product lolitrem B. The results of the detection of loline alkaloid synthesis genes indicate that these 20 strains only contained the gene lolC. In the LOL pathway, the production of the first intermediate product 1-acetamido-pyrrolizidine (AcAP) requires the simultaneous participation of the five genes lolC, lolF, lolD, lolT, and lolU. Therefore, the 20 strains cannot produce AcAP and any other intermediate products in the LOL pathway, nor the final product N-formylloline (NFL) or N-acetylloline (NAL).
Table 5.
Indole–diterpene (IDT/LTM) alkaloid biosynthesis genes in the genome of Epichloë endophytes strained from Elymus spp.
According to their alkaloid synthesis genes, taxonomic status, and mating-type genes, the strains were divided into four types (Table 6). Type 1 included strains LE6, LE1, LE3, and LE7, which were predicted to only produce peramine. Type 2 includes strains AD3, AD5, ADX8, ADX12, ADX9, and AD16, which were predicted to have the ability to produce peramine, chanoclavine I, D-lysergic acid, ergovaline, paspaline, terpendole I, and paxilline. This type is also the most abundant type of alkaloid production. Type 3 includes strains GA2, GA4, GA7, FC1, and FC4, which were predicted to produce chanoclavine I, D-lysergic acid, ergovaline, and paspaline. Type 4 includes strains KE1, KEM1, KEM3, KEM4, and LB1, which could produce chanoclavine I, D-lysergic acid, ergovaline, paspaline, terpendole I, and paxilline. Considering the toxicity of endophytic fungi to insects and the safety of herbivorous livestock, the above four types of endophytic fungi can be divided into two categories. Category I includes four animal-safe strains of type 1, which could only produce insect-resistant alkaloids and do not produce any ergot or indole–diterpene alkaloids that are toxic to herbivores. Category II includes the remaining 16 strains, which could produce ergot and/or indole–diterpene alkaloids that are toxic to livestock.
Table 6.
Chemotype analyses of Epichloë endophytes strained from Elymus spp.
4. Discussion
In this study, a phylogenetic analysis of 20 Epichloë endophytes isolated from five species of Elymus plants from five regions of three provinces showed that the taxonomic status of these endophytes all belonged to E. bromicola. The strains derived from different hosts collected from different areas showed morphological diversity in the colony texture, colony color, morphology, and size of conidia and conidiophores, as well as the colony growth rate. E. bromicola was first identified from Bromus spp. grasses, originally described as a frequently occurring choke pathogen of Bromus erectus and a strictly seed-transmitted endophyte of Bromus benekenii and Bromus ramosus in the grass tribe of Bromeae. In this study, we found that the asexual Epichloë endophyte isolated from E. dahuricus, which was collected from Rangtang Sichuan and Maqu Gansu, was closely related to the sexual E. bromicola from Bromus erectus and asexual E. bromicola from Bromus benekenii, Bromus ramosus, Roegneria kamoji, and Hordelymus europaeus. Other strains were closely related to Hordeum bogdanii, Hordeum brevisubulatum, and Elymus spp. This set of relationships indicates that the horizontal transmission of Epichloë endophytes occurred between different tribes. Roegneria, Hordelymus, Hordeum, and Elymus are members of the Triticeae tribe, but Bromus is a member of the Bromeae tribe. Moon et al. [49] found that the transmission of Epichloë endophytes occurred not only within the same tribe but also between different tribes. There is information available about the transmission between the Triticeae tribe and the Poaceae tribe, and the data presented here show a possible horizontal transmission between the Triticeae tribe and the Bromeae tribe. There is a wide range of chemotypic diversity among and even within Epichloë species, among which ergot alkaloids mainly include chanoclavine I (CC), D-lysergic acid, ergovaline (ERV), ergonovine (EN), and lysergic acid α-hydroxyethylamide (LAH). Indole–diterpene alkaloids mainly include paspaline (PAS), terpendole K, and paxilline (PAX); and lolitrem B. Ryegrass alkaloids include 1-acetamido-pyrrolizidine (AcAP), N-formylloline (NFL) or N-acetylloline (NAL), N-acetylnorloline (NANL), loline and N-methylloline (NML), and finally the insect-resistant alkaloid peramine [50]. If there are different degrees of lack of genes in the gene cluster, the corresponding different strains will produce different intermediate products, which will lead to different alkaloid-producing types, making the alkaloid synthesis diversity of Epichloë endophytic fungi more abundant [16].
It has been found that the types of alkaloids produced by endophytic fungi in different habitats of the same host are diverse. Kaur studies have found that E. festucae var. lolii endophytic fungi isolated from Lolium perenne have a diversity of alkaloids among strains due to different host habitats. Of these, some strains produce lolitrem B, some produce terpendole C, and some produce janthitrem I due to differences in the host habitat [51]. Identically, in this study, both the LB1 and LE strains were isolated from E. dahuricus, and their taxonomic status belonged to E. bromicola. However, the host of strain LB1 belonged to Huachi, Gansu Province, which could produce toxic ergots and indole–diterpene alkaloids to livestock, while the LE strains were collected from Rangtang, Sichuan Province, which only produced the insect-resistant alkaloid peramine. In addition to the habitat-induced alkaloid diversity of endophytic fungi, alkaloid gene diversity was also observed among different strains of the same host and the same taxonomic status. For example, E. festucae from Festuca longifolia, F. ovina, and F. rubra subsp. commutata can produce peramine, while E. festucae isolated from F. rubra subsp. rubra cannot produce peramine [17,52,53]. Notably, E. bromicola isolated from different hosts display significant variations in their alkaloid biosynthetic potential. Among the four E. bromicola endophytic fungi isolated from Hordeum bogdanii, strains F, 2-8-1, and XE1-2 could produce PAS, while no related gene cluster of PAS was detected in strain el. [48]. Similar observations were reported for the E. bromicola strains E6261 and E6262 isolated from Elymus dahuricus, which have specific genes for peramine synthesis, while E6260 contains indole–diterpene alkaloids [54]. This phenomenon was further corroborated in the present study. The results of the alkaloid biosynthesis gene profiles of twenty E. bromicola strains show that they all lacked genes necessary for loline synthesis, but 16 of these strains possessed the potential to produce CC+D-LC+ERV and PAS, and 11 of 20 strains harbored genes potentially involved in PAS+PAX+TDK alkaloid biosynthesis. Interestingly, genetic polymorphisms within the ppzA (perA) gene resulted in differential peramine productions among the strains [55]. Out of the 20 strains examined, 10 were found to possess a specific gene responsible for peramine synthesis. Interestingly, the remaining 10 strains were found to contain the ppzA–∆R domain, representing the allele ppzA-2. Initially, this allele was believed to hinder peramine synthesis. However, recent studies have shed light on its potential to encode various metabolites and provide protective effects to the host. This discovery challenges previous assumptions about the role of the ppzA–∆R domain, suggesting a more complex relationship between genetic factors and the synthesis of metabolites within these strains [55]. These findings highlight the remarkable intraspecific diversity within E. bromicola regarding its alkaloid biosynthetic potential. This variation appears to be influenced by both the genetic polymorphisms within the fungal population and the host plant species. However, there have been no reports of E. bromicola poisoning livestock. Including the 20 strains of E. bromicola identified in this study, no livestock poisoning occurred in the corresponding collection area. This is mainly because the amount of toxic alkaloids produced does not reach the threshold of poisoning livestock, or the activity level of these bioactive alkaloids is not enough to cause livestock poisoning. However, further experimentation is required to evaluate their alkaloid-producing capabilities in host grasses for potential applications in artificial inoculation studies, which will be the primary focus of our forthcoming research.
The potential of endophytic fungi in Elymus plants to resist abiotic stress has been reported. Under drought stress, endophytic fungi can significantly improve the germination rate and seedling growth of the host [56]. Elymus virginicus infected with Epichloë endophytes have a higher biomass and tiller number than uninfected plants under daily watering and under similar drought conditions. Both the number of tillers produced and the root biomass were reduced by disinfection, with a greater difference between endophyte treatments under daily watering than under droughts [57]. In addition, under the stress of heavy metal chromium ions, Epichloë endophytes can increase the germination rate of Elymus [58]. Studies have found that E. bromicola can improve the salt tolerance of host plants and can also promote the growth of host plants by stimulating the host to produce IAA. Importantly, many successful cases demonstrate the utility of Epichloë endophyte species in plant germplasm innovation. For instance, researchers have utilized the Epichloë strains NEA2, AR1, and AR37 to cultivate commercially viable grass cultivars, accounting for more than 70% of proprietary seed sales in New Zealand a decade ago [59]. According to the latest research reports, E. bromicola isolated from wild barley (H. brevisubulatum) has been inoculated into cultivated barley (H. vulgare) by artificial inoculation technology, and the new germplasm E. bromicola barley has been created. Compared with the control, the aboveground biomass, seed yield per plant, and salt tolerance of the new germplasm were significantly increased [60,61]. These results indicate that E. bromicola might be used as a promising strain for the improvement of valued medicinal plants [62].
5. Conclusions
In conclusion, we determined the taxonomic status of 20 endophytic fungal strains isolated from E. dahuricus, E. nutans, E. tangutorum, and E. sibiricus and then found differences in the morphology, phylogeny, mating types, and alkaloid production. To our knowledge, this is the first systematic study of alkaloids’ producing ability and the diversity of the Epichloë fungal endophyte strains of Elymus plants. We divided these 20 strains into 4 types according to the type of alkaloid production: the type 1 strain only produced peramine. Type 2 produces peramine, chanoclavine I, D-lysergic acid, ergovaline, paspaline, terpendole I, and paxilline. Type 3 can produce chanoclavine I, D-lysergic acid, ergovaline, and paspaline. Type 4 can produce chanoclavine I, D-lysergic acid, ergovaline, paspaline, terpendol I, and paxilline. Finally, four animal-safe strains that only produce insect-resistant alkaloids were screened, LE1, LE3, LE6, and LE7, which provided excellent basic materials for germplasm innovation using grass endophytic fungi. These four strains did not contain any ergot and indole–diterpene alkaloid synthesis cluster genes and could not produce ergonovine and lolitrem B. Therefore, the four non-toxic strains obtained in this study can be used as animal-safe materials for artificial inoculation in the future and can be fully utilized in the resistance breeding of Poaceae plants. However, further experimentation is required to evaluate their alkaloid-producing capabilities in cultivated hosts for potential applications in artificial inoculation studies, which will be the primary focus of our forthcoming research.
Author Contributions
Conceptualization, T.C.; resources, T.W.; data curation, T.W. and M.D.; writing—original draft preparation, M.D.; writing—review and editing, M.D., T.C., and C.L. All authors have read and agreed to the published version of the manuscript.
Funding
This work was financially supported by the National Science Foundation of China (U21A20239 and 32001396); the Open Project of the State Key Laboratory of Plateau Ecology and Agriculture, Qinghai University (2022-KF-02); the Science and Technology Planning Project of Gansu Province, China (Natural Science Foundation) (22JR5RA458); and the Gansu Provincial Science and Technology Major Projects (22ZD6NA007).
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
All data supporting the findings of this study are available within the paper.
Acknowledgments
The authors thank Aqleem Abbas for editing the English text of this manuscript.
Conflicts of Interest
The authors declare no conflicts of interest.
References
- Siegel, M.R.; Dahlman, D.L.; Bush, L.P. The role of endophytic fungi in grasses-new approaches to biological-control of pests. Abstr. Pap. Am. Chem. Soc. 1987, 194, 247. [Google Scholar]
- Kuldau, G.; Bacon, C. Clavicipitaceous endophytes: Their ability to enhance plant resistance to multiple stresses. Phytopathology 2005, 956, 138. [Google Scholar] [CrossRef] [Scilit]
- Vogel, K.P.; Hopkins, A.A.; Moore, K.J.; Johnson, K.D.; Carlson, I.T. Genetic variation among canada wildrye accessions from midwest USA remnant prairies for biomass yield and other traits. Crop Sci. 2006, 466, 2348–2353. [Google Scholar] [CrossRef] [Scilit]
- Iannone, L.J.; Novas, M.V.; Young, C.A.; De Battista, J.P.; Schardl, C.L. Endophytes of native grasses from south america: Biodiversity and ecology. Fungal Ecol. 2012, 53, 357–363. [Google Scholar] [CrossRef] [Scilit]
- Johnson, L.J.; de Bonth, A.C.M.; Briggs, L.R.; Caradus, J.R.; Finch, S.C.; Fleetwood, D.J.; Fletcher, L.R.; Hume, D.E.; Johnson, R.D.; Popay, A.J.; et al. The exploitation of Epichloë endophytes for agricultural benefit. Fungal Divers. 2013, 601, 171–188. [Google Scholar] [CrossRef] [Scilit]
- Schardl, C.L.; Craven, K.D.; Speakman, S.; Stromberg, A.; Lindstrom, A.; Yoshida, R. A novel test for host-symbiont codivergence indicates ancient origin of fungal endophytes in grasses. Syst. Biol. 2008, 573, 483–498. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Casas, C.; Torretta, J.P.; Exeler, N.; Omacini, M. What happens next? Legacy effects induced by grazing and grass-endophyte symbiosis on thistle plants and their floral visitors. Plant Soil 2016, 4051–4052, 211–229. [Google Scholar] [CrossRef] [Scilit]
- Li, F.; Guo, Y.E.; Christensen, M.J.; Gao, P.; Li, Y.Z.; Duan, T.Y. An arbuscular mycorrhizal fungus and Epichloë festucae var. lolii reduce Bipolaris sorokiniana disease incidence and improve perennial ryegrass growth. Mycorrhiza 2018, 282, 159–169. [Google Scholar]
- Chen, T.X.; Johnson, R.; Chen, S.H.; Lv, H.; Zhou, J.L.; Li, C.J. Infection by the fungal endophyte Epichloë bromicola enhances the tolerance of wild barley (Hordeum brevisubulatum) to salt and alkali stresses. Plant Soil 2018, 4281–4282, 353–370. [Google Scholar] [CrossRef] [Scilit]
- Song, M.L.; Li, X.Z.; Saikkonen, K.; Li, C.J.; Nan, Z.B. An asexual Epichloë endophyte enhances waterlogging tolerance of Hordeum brevisubulatum. Fungal Ecol. 2015, 13, 44–52. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.J.; Zhou, Y.P.; Lin, W.H.; Li, M.M.; Wang, M.N.; Wang, Z.G.; Kuang, Y.; Tian, P. Effect of an Epichloë endophyte on adaptability to water stress in Festuca sinensis. Fungal Ecol. 2017, 30, 39–47. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.F.; Li, C.J.; White, J. Effects of Epichloë endophyte infection on growth, physiological properties and seed germination of wild barley under saline conditions. J. Agron. Crop Sci. 2020, 2061, 43–51. [Google Scholar] [CrossRef] [Scilit]
- Chen, Z.J.; White, J.F.; Malik, K.; Chen, H.; Jin, Y.Y.; Yao, X.; Wei, X.K.; Li, C.J.; Nan, Z.B. Soil nutrient dynamics relate to Epichloë endophyte mutualism and nitrogen turnover in a low nitrogen environment. Soil Biol. Biochem. 2022, 174, 108832. [Google Scholar] [CrossRef] [Scilit]
- Clay, K.; Schardl, C. Evolutionary origins and ecological consequences of endophyte symbiosis with grasses. Am. Nat. 2002, 160, 99–127. [Google Scholar] [CrossRef] [PubMed]
- Luo, H.; Xie, L.; Zeng, J.; Xie, J. Biosynthesis and regulation of bioprotective alkaloids in the Gramineae endophytic fungi with implications for herbivores deterrents. Curr. Microbiol. 2015, 716, 719–724. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schardl, C.L.; Young, C.A.; Faulkner, J.R.; Florea, S.; Pan, J. Chemotypic diversity of Epichloë, fungal symbionts of grasses. Fungal Ecol. 2012, 53, 331–344. [Google Scholar] [CrossRef] [Scilit]
- Siegel, M.R.; Latch, G.C.M.; Bush, L.P.; Fannin, F.F.; Rowan, D.D.; Tapper, B.A.; Bacon, C.W.; Johnson, M.C. Fungal endophyte-infected grasses-alkaloid accumulation and aphid response. J. Chem. Ecol. 1990, 1612, 3301–3315. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clay, K.; Hardy, T.N.; Hammond, A.M. Fungal endophytes grasses and their effects on an insect herbivore. Oecologia 1985, 661, 1–5. [Google Scholar] [CrossRef] [Scilit]
- Bacon, C.W.; Porter, J.K.; Robbins, J.D.; Luttrell, E.S. Epichloë typhina from toxic tall fescue grasses. Appl. Environ. Microbiol. 1977, 345, 576–581. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Richardson, K.A.; de Bonth, A.C.M.; Beechey-Gradwell, Z.; Kadam, S.; Cooney, L.J.; Nelson, K.A.; Cookson, R.; Winichayakul, S.; Reid, M.; Anderson, P.; et al. Epichloë fungal endophyte interactions in perennial ryegrass (Lolium perenne L.) modified to accumulate foliar lipids for increased energy density. BMC Plant Biol. 2023, 23, 636. [Google Scholar] [CrossRef] [Scilit]
- Wille, P.; Boller, T.; Kaltz, O. Mixed inoculation alters infection success of strains of the endophyte Epichloë bromicola on its grass host Bromus erectus. Proc. R. Soc. B Biol. Sci. 2002, 2691489, 397–402. [Google Scholar] [CrossRef] [Scilit]
- Fleetwood, D.J.; Khan, A.K.; Johnson, R.D.; Young, C.A.; Mittal, S.; Wrenn, R.E.; Hesse, U.; Foster, S.J.; Schardl, C.L.; Scott, B. Abundant degenerate miniature inverted-repeat transposable elements in genomes of Epichloë fungal endophytes of grasses. Genome Biol. Evol. 2011, 3, 1253–1264. [Google Scholar] [CrossRef] [Scilit]
- Schardl, C.L.; Young, C.A.; Hesse, U.; Amyotte, S.G.; Andreeva, K.; Calie, P.J.; Fleetwood, D.J.; Haws, D.C.; Moore, N.; Oeser, B.; et al. Plant-symbiotic fungi as chemical engineers: Multi-genome analysis of the Clavicipitaceae reveals dynamics of alkaloid loci. PLoS Genet. 2013, 92, e1003323. [Google Scholar] [CrossRef] [Scilit]
- Spiering, M.J.; Moon, C.D.; Wilkinson, H.H.; Schardl, C.L. Gene clusters for insecticidal loline alkaloids in the grass-endophytic fungus Neotyphodium uncinatum. Genetics 2005, 1693, 1403–1414. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, J.H.; Machado, C.; Panaccione, D.G.; Tsai, H.F.; Schardl, C.L. The determinant step in ergot alkaloid biosynthesis by an endophyte of perennial ryegrass. Fungal Genet. Biol. 2004, 412, 189–198. [Google Scholar] [CrossRef] [Scilit]
- Pan, J. Ether Bridge Formation and Chemical Diversification in Loline Alkaloid Biosynthesis. Ph.D. Thesis, University of Kentucky, Lexington, KY, USA, 2014. [Google Scholar]
- Takach, J.E.; Young, C.A. Alkaloid genotype diversity of tall fescue endophytes. Crop Sci. 2014, 542, 667–678. [Google Scholar] [CrossRef] [Scilit]
- Song, H.; Nan, Z. Origin, divergence, and phylogeny of asexual Epichloë endophyte in Elymus species from Western China. PLoS ONE 2015, 105, e0127096. [Google Scholar] [CrossRef] [Scilit]
- Charlton, N.D.; Craven, K.D.; Mittal, S.; Hopkins, A.A.; Young, C.A. Epichloë canadensis, a new interspecific Epichloë hybrid symbiotic with Canada wildrye (Elymus canadensis). Mycologia 2012, 1045, 1187–1199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schardl, C.L.; Leuchtmann, A. Three new species of Epichloë symbiotic with North American grasses. Mycologia 1999, 911, 95–107. [Google Scholar] [CrossRef] [Scilit]
- White, J.F. Endophyte-host associations in grasses.17. Ecological and physiological features characterizing Epichloë typhina and some anamorphic varieties in England. Mycologia 1992, 843, 431–441. [Google Scholar] [CrossRef] [Scilit]
- White, J.F.; Bultman, T.L. Endophyte-host associations in forage grasses. 8. Heterothallism in Epichloë typhina. Am. J. Bot. 1987, 7411, 1716–1721. [Google Scholar] [CrossRef] [Scilit]
- White, J.F.; Chambless, D.A. Endophyte-host associations in forage grasses. 15. Clustering of stromata-bearing individuals of agrostis infected by Epichloë typhina. Am. J. Bot. 1991, 784, 527–533. [Google Scholar] [CrossRef] [Scilit]
- White, J.F.; Morrow, A.C.; Morganjones, G.; Chambless, D.A. Endophyte-host associations in forage grasses. 14. Primary stromata formation and seed transmission in Epichloë typhina—Developmental and regulatory aspects. Mycologia 1991, 831, 72–81. [Google Scholar] [CrossRef] [Scilit]
- Li, W.; Ji, Y.L.; Yu, H.S.; Wang, Z.W. A new species of Epichloë symbiotic with Chinese grasses. Mycologia 2006, 984, 560–570. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, C. Biological and Ecological Characteristics of Achnatherum inebrians/Neotyphodium Endophyte Symbiont. Ph.D. Thesis, Lanzhou University, Lanzhou, China, 2005. [Google Scholar]
- Moon, C.D.; Guillaumin, J.J.; Ravel, C.; Li, C.; Craven, K.D.; Schardl, C.L. New Neotyphodium endophyte species from the grass tribes stipeae and meliceae. Mycologia 2007, 996, 895–905. [Google Scholar] [CrossRef]
- Moon, C.D.; Miles, C.O.; Jarlfors, U.; Schardl, C.L. The evolutionary origins of three new Neotyphodium endophyte species from grasses indigenous to the southern hemisphere. Mycologia 2002, 944, 694–711. [Google Scholar] [CrossRef] [Scilit]
- Zhang, D.; Gao, F.; Jakovlic, I.; Zou, H.; Zhang, J.; Li, W.X.; Wang, G.T. Phylosuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Mol. Ecol. Resour. 2020, 201, 348–355. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xia, X. Dambe6: New tools for microbial genomics, phylogenetics, and molecular evolution. J. Hered. 2017, 1084, 431–437. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Minh, B.Q.; Schmidt, H.; Chernomor, O.; Schrempf, D.; Woodhams, M.; von Haeseler, A.; Lanfear, R. Iq-tree 2: New models and efficient methods for phylogenetic inference in the genomic era. Mol. Biol. Evol. 2020, 375, 1530–1534. [Google Scholar] [CrossRef] [Scilit]
- Tanaka, A.; Tapper, B.A.; Popay, A.; Parker, E.J.; Scott, B. A symbiosis expressed non-ribosomal peptide synthetase from a mutualistic fungal endophyte of perennial ryegrass confers protection to the symbiotum from insect herbivory. Mol. Microbiol. 2005, 574, 1036–1050. [Google Scholar] [CrossRef] [Scilit]
- Young, C.A.; Bryant, M.K.; Christensen, M.J.; Tapper, B.A.; Bryan, G.T.; Scott, B. Molecular cloning and genetic analysis of a symbiosis-expressed gene cluster for lolitrem biosynthesis from a mutualistic endophyte of perennial ryegrass. Mol. Genet. Genom. 2005, 2741, 13–29. [Google Scholar] [CrossRef] [Scilit]
- Young, C.A.; Felitti, S.; Shields, K.; Spangenberg, G.; Johnson, R.D.; Bryan, G.T.; Saikia, S.; Scott, B. A complex gene cluster for indole-diterpene biosynthesis in the grass endophyte Neotyphodium lolii. Fungal Genet. Biol. 2006, 4310, 679–693. [Google Scholar] [CrossRef] [Scilit]
- Schardl, C.L.; Panaccione, D.G.; Tudzynski, P. Ergot Alkaloids—Biology and molecular biology. In Alkaloids: Chemistry and Biology; Cordell, G.A., Ed.; Academic Press: Cambridge, MA, USA, 2006; Volume 63, pp. 45–86. [Google Scholar]
- Berry, D.; Takach, J.E.; Schardl, C.L.; Charlton, N.D.; Scott, B.; Young, C.A. Disparate independent genetic events disrupt the secondary metabolism gene perA in certain symbiotic Epichloë species. Appl. Environ. Microbiol. 2015, 818, 2797–2807. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, L.; Li, X.Z.; Li, C.J.; Swoboda, G.A.; Young, C.A.; Sugawara, K.; Leuchtmann, A.; Schardl, C.L. Two distinct Epichloë species symbiotic with Achnatherum inebrians, drunken horse grass. Mycologia 2015, 1074, 863–873. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, T.X. Physiological Mechanism of Epichloë Endophyte Infection to Enhance Salt Tolerance of Wild Barley. Ph.D. Thesis, Lanzhou University, Lanzhou, China, 2019. [Google Scholar]
- Moon, C.D.; Scott, B.; Schardl, C.L.; Christensen, M.J. The evolutionary origins of Epichloë endophytes from annual ryegrasses. Mycologia 2000, 926, 1103–1118. [Google Scholar] [CrossRef] [Scilit]
- Schardl, C.L.; Florea, S.; Pan, J.; Nagabhyru, P.; Bec, S.; Calie, P.J. The Epichloë: Alkaloid diversity and roles in symbiosis with grasses. Curr. Opin. Plant Biol. 2013, 164, 480–488. [Google Scholar] [CrossRef] [Scilit]
- Kaur, J.; Ekanayake, P.N.; Tian, P.; de Jong, E.v.Z.; Dobrowolski, M.P.; Rochfort, S.J.; Mann, R.C.; Smith, K.F.; Forster, J.W.; Guthridge, K.M.; et al. Discovery and characterisation of novel asexual Epichloë endophytes from perennial ryegrass (Lolium perenne L.). Crop Pasture Sci. 2015, 6610, 1058–1070. [Google Scholar] [CrossRef] [Scilit]
- Rasmussen, S.; Parsons, A.J.; Fraser, K.; Xue, H.; Newman, J.A. Metabolic profiles of Lolium perenne are differentially affected by nitrogen supply, carbohydrate content, and fungal endophyte infection. Plant Physiol. 2008, 1463, 1440–1453. [Google Scholar] [CrossRef] [Scilit]
- Vázquez-De-Alldana, B.R.; Zabalgogeazcoa, I.; García-Ciudad, A.; García-Criado, B. Fungal alkaloids in populations of endophyte-infected Festuca rubra subsp. pruinosa. Grass Forage Sci. 2007, 623, 364–371. [Google Scholar] [CrossRef] [Scilit]
- Shi, C.; An, S.; Yao, Z.; Young, C.A.; Panaccione, D.G.; Lee, S.T.; Schardl, C.L.; Li, C. Toxin-producing Epichloë bromicola strains symbiotic with the forage grass Elymus dahuricus in China. Mycologia 2017, 1096, 847–859. [Google Scholar] [CrossRef] [Scilit]
- Berry, D.; Mace, W.; Grage, K.; Wesche, F.; Gore, S.; Schardl, C.L.; Young, C.A.; Dijkwel, P.P.; Leuchtmann, A.; Bode, H.B.; et al. Efficient nonenzymatic cyclization and domain shuffling drive pyrrolopyrazine diversity from truncated variants of a fungal nrps. Proc. Natl. Acad. Sci. USA 2019, 11651, 25614–25623. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.P.; Nan, Z.B. Growth and anti-oxidative systems changes in Elymus dahuricus is affected by Neotyphodium endophyte under contrasting water availability. J. Agron. Crop Sci. 2007, 1936, 377–386. [Google Scholar] [CrossRef] [Scilit]
- Rudgers, J.A.; Swafford, A.L. Benefits of a fungal endophyte in Elymus virginicus decline under drought stress. Basic Appl. Ecol. 2009, 101, 43–51. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.X.; Li, C.J.; Nan, Z.B. Effects of cadmium stress on seed germination and seedling growth of Elymus dahuricus infected with the Neotyphodium endophyte. Sci. China-Life Sci. 2012, 559, 793–799. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Caradus, J.R. Epichloë fungal endophytes—A vital component for perennial ryegrass survival in New Zealand. N. Z. J. Agric. Res. 2023, 502, 279–298. [Google Scholar] [CrossRef] [Scilit]
- Li, C.J.; Wang, Z.F.; Chen, T.X.; Nan, Z.B. Creation of novel barley germplasm using an Epichloë endophyte. Chin. Sci. Bull. 2021, 6620, 2608–2617. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.F.; Liu, J.; White, J.F.; Li, C.J. Epichloë bromicola from wild barley improves salt-tolerance of cultivated barley by altering physiological responses to salt stress. Front. Microbiol. 2022, 13, 1044735. [Google Scholar] [CrossRef] [Scilit]
- Xie, X.G.; Lu, W.L.; Feng, K.M.; Zheng, C.J.; Yang, Y.; Jia, M.; Wu, Y.S.; Shi, Y.Z.; Han, T.; Qin, L.P. Mechanisms of Epichloë bromicola to promote plant growth and its potential application for Coix lacryma-jobi L. cultivation. Curr. Microbiol. 2023, 809, 306. [Google Scholar] [CrossRef] [Scilit]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).




