Next Article in Journal
A Bibliometric Analysis of HPV-Positive Oropharyngeal Squamous Cell Carcinoma from 2000 to 2023
Next Article in Special Issue
Occurrence of Ticks and Tick-Borne Pathogens During Warm Winter—A Snapshot from Central Europe
Previous Article in Journal
Prevalence and Molecular Characterization of Cryptosporidium Species in Diarrheic Children in Cameroon
Previous Article in Special Issue
Human Retinal Organoid Model of Ocular Toxoplasmosis
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Evidence of Raccoon Dog (Nyctereutes procyonoides) as a Natural Definitive Host for Several Sarcocystis Species

by
Petras Prakas
*,
Tamara Kalashnikova
,
Naglis Gudiškis
,
Donatas Šneideris
,
Evelina Juozaitytė-Ngugu
and
Dalius Butkauskas
Nature Research Centre, Akademijos Str. 2, 08412 Vilnius, Lithuania
*
Author to whom correspondence should be addressed.
Pathogens 2025, 14(3), 288; https://doi.org/10.3390/pathogens14030288
Submission received: 28 January 2025 / Revised: 11 March 2025 / Accepted: 13 March 2025 / Published: 15 March 2025
(This article belongs to the Special Issue Parasitic Diseases in the Contemporary World)

Abstract

Sarcocystis parasites infect a wide range of animals, including reptiles, birds, and mammals, and have complex two-host prey–predator life cycle. Sarcocysts are mainly found in the muscles of intermediate hosts, and oocysts sporulate in the intestines of the definitive host. The raccoon dog (Nyctereutes procyonoides), native to Asia and invasive in Europe, is a known disease carrier. However, studies on raccoon dogs in the transmission of Sarcocystis are scarce. Between 2019 and 2024, a total of 26 raccoon dog carcasses were collected in Lithuania. The results of a light microscopy examination indicated that 50% of the samples were positive for Sarcocystis spp. sporocysts and sporulated oocysts. Based on nested PCR and sequencing of cox1, 88.5% of the samples were positive for these parasites. Molecular analysis revealed the presence of 11 different Sarcocystis species. Eight species, including S. alces, S. capracanis, S. hjorti, S. iberica, S. linearis, S. morae, S. tenella, and S. venatoria were reported for the first time in raccoon dogs as definitive hosts. The identified Sarcocystis species were linked to intermediate hosts, such as cervids, wild boars, pigs, goats, and sheep. These findings suggest that raccoon dogs play a key role in the spread of Sarcocystis, particularly species infecting cervids.

1. Introduction

Protozoan parasites of the genus Sarcocystis Lankaster (1982) have a compulsory two-host life cycle that relies on a prey–predator relationship. These parasites are abundant, distributed worldwide, and infect a wide range of reptiles, birds, and mammals. The genus Sarcocystis is characterized by the formation of sarcocysts, mainly in the muscles of intermediate hosts (IHs). Sexual multiplication of parasites takes place in the intestines of the definitive hosts, and the sporocysts produced after the sporulation of the oocysts are released into the environment in feces. The IH becomes infected by consuming food or water contaminated with sporocysts, while the definitive host becomes infected by ingesting tissues containing mature sporocysts [1].
The raccoon dog, Nyctereutes procyonoides (Gray, 1834), is a widespread invasive canid species in northern, eastern, and central Europe [2]. It is commonly believed that the animal was introduced to the territory of Lithuania in 1948 and by 1960 had already invaded it [3]. Raccoon dogs were brought to Europe because of their valuable fur or as pets and either escaped or were intentionally introduced into the wild [4]. The raccoon dog is known as an ecological generalist, meaning that it is highly adaptable to a wide range of environmental conditions and has a variety of food preferences. They are omnivores, so their eating habits vary with the seasons and the environment in which they live [5,6]. Typical foods may include invertebrates, small mammals, amphibians, birds, carrion, insects, and plants [7]. The current population of raccoon dogs in Lithuania is estimated to be at least 10,000 individuals, which was counted by the number of road kills and hunted animals [8].
The raccoon dog is listed among the 100 worst alien species in Europe [9]. This invasive species can damage biological diversity and impact autochthonous ecosystems [10]. Raccoon dogs are omnivorous and can prey on native fauna, as well as compete with native predators for natural resources [2,10]. This invasive canid species is also characterized by its high behavioral plasticity, reproductive capacity, and adaptability to a wide range of environmental conditions, which has allowed it to successfully colonize Europe [2]. In addition, according to the enemy release hypothesis, an invasive host may have a competitive advantage over native species by leaving behind its natural enemies, including parasites [11]. The raccoon dog encounters and accumulates parasites found in newly colonized areas, and parasitological investigations are essential to identify these organisms. Furthermore, it must be taken into account that this invasive species can be a vector and potential reservoir for several illnesses [2].
Raccoon dogs are known to spread many zoonotic and pathogenic diseases [2,10,12,13,14,15] that can be harmful to both human and animal health. These invasive mammals can also serve as reservoirs for a variety of vector-borne diseases, including Borreliella Adeolu and Gupta (2015) spp. and Rickettsia da Rocha-Lima (1916) spp., and for a number of infectious agents, including rabies lyssavirus, canine distemper virus, SARS-CoV-2, Trichinella Railliet (1895) spp., Baylisascaris procyonis Stefanski and Zarnowski, 1951, and Echinococcus multilocularis Leuckart, 1863 [12,13,14,15,16]. Trichinella spp. have previously been detected in muscle tissues of raccoon dogs in Lithuania, Latvia, and Estonia [12,17]. In addition, cestodes (Echinococcus multilocularis Leuckart, 1863, Mesocestoides Vaillant (1863) spp., and Taenia Linnaeus (1758) spp.), nematodes (Toxocara canis Werner, 1782, Capillaria Zeder (1800) spp., and Uncinaria stenocephala Railliet, 1884), and trematodes (Alaria alata (Goeze, 1782) Krause, 1914 and Opistorchis felineus (Rivolta, 1884) Blanchard, 1895) were detected in Lithuanian raccoon dogs through detailed helminthological examination [17]. Some helminth species can cause serious illness in humans; for example, infection with Trichinella spp. can lead to death [18]. On the other hand, Sarcocystis spp. infection in carnivores as definitive hosts of these parasites are mainly asymptomatic. However, it has been shown that among Sarcocystis spp. forming sarcocysts in meat-producing livestock, species transmittable via canids are more pathogenic compared to those transmittable via other definitive hosts [1]. In this context, it is relevant to examine different canid species for their role in the transmission of various Sarcocystis species. Up to date among canids, dogs [19], gray wolves, Canis lupus (Linnaeus, 1758) [20,21], red foxes, Vulpes vulpes (Linnaeus, 1758) [22,23], arctic foxes, Vulpes lagopus (Linnaeus, 1758) [24], and golden jackals, Canis aureus (Linnaeus, 1758) [25] were mostly investigated as potential definitive hosts of Sarcocystis species. However, there is still a limited number of studies on raccoon dogs as definitive hosts of Sarcocystis spp.
The objective of our study was to evaluate the prevalence of Sarcocystis spp. in the small intestines of raccoon dogs collected in Lithuania by means of light microscopy and molecular methods and to identify parasite species using DNA sequence analysis.

2. Materials and Methods

2.1. Sample Collection and Isolation of Sarcocystis spp.

The research of the current study was conducted under the approval guidelines of the Ethics Committee of the Nature Research Centre (no. GGT-1). The Minister of Environment in Lithuania approves the rules on hunting (20 June 2002 no. IX-966) of the Republic of Lithuania, a list of game species and the time limits for hunting these animals. Based on this document, the hunting of the common raccoon dog is allowed all year round in Lithuania. A total of 26 raccoon dog carcasses were collected in Lithuania between 2019 and 2024. The collection sites of raccoon dogs examined are shown in Figure 1.
Different forms of Sarcocystis spp. from the intestinal samples of raccoon dogs were isolated using a previously described protocol [26]. The necessary modifications made during this procedure were already detailed in the earlier work by Prakas et al. [27].

2.2. Molecular Analysis

DNA extraction from the intestinal scrapings of raccoon dogs was conducted with the GeneJET Genomic DNA Purification Kit (Thermo Fisher Scientific Baltics, Vilnius, Lithuania) following the manufacturer’s recommendations.
Nested PCR (nPCR) was employed to amplify partial cox1 sequences from the extracted DNA samples. The primers used in this study are listed in Table 1. A total of 16 Sarcocystis species were selected, including five that use farm animals as intermediate hosts: Sarcocystis arieticanis Heydorn, 1985; Sarcocystis bertrami Doflein, 1901; Sarcocystis capracanis Fischer, 1979; Sarcocystis cruzi (Hasselmann, 1926) Wenyon, 1926; and Sarcocystis tenella (Railliet, 1886) Moulé, 1886 [28,29,30,31]. Additionally, ten species that infect members of the Cervidae family were chosen: Sarcocystis alces Dahlgren and Gjerde, 2008; Sarcocystis capreolicanis Erber, Boch and Barth, 1978; Sarcocystis gracilis Ratz, 1906; Sarcocystis hjorti (Dahlgren and Gjerde, 2008) Dahlgren and Gjerde, 2010; Sarcocystis linearis Gjerde, Giacomelli, Bianchi, Bertoletti, Mondani and Gibelli 2017; Sarcocystis iberica, Sarcocystis morae, Sarcocystis venatoria Gjerde, Luzon, Alunda and de la Fuente 2017; Sarcocystis pilosa Prakas, Butkauskas, Rudaitytė-Lukošienė, Kutkienė, Sruoga and Pūraitė, 2016; and Sarcocystis taeniata Gjerde, 2014 [32,33,34,35,36,37]. Lastly, Sarcocystis miescheriana (Kühn, 1865) Labbé, 1899, which infects both wild boars and domestic pigs, was included [38].
The first round of nPCR was carried out in a final volume of 25 μL, comprising 12.5 μL of DreamTaq PCR Master Mix (Thermo Fisher Scientific, Vilnius, Lithuania), 0.5 μM of both forward and reverse primers, and 4 μL of extracted DNA and nuclease-free water to make up the remaining volume. The cycling conditions began with an initial denaturation at 95 °C for 5 min, followed by 35 cycles of 35 s at 94 °C, 45 s at the species-specific annealing temperature (depending on the primer pair), 55 s at 72 °C, and finishing with 5 min at 72 °C. The second round of amplification was also conducted in the reaction volume of 25 μL, comprising 12.5 μL of DreamTaq PCR Master Mix, 0.5 μM of both forward and reverse primers, 2 μL of the amplified product from the first nPCR step, and nuclease-free water up to 25 μL. Positive controls, consisting of DNA extracted from Sarcocystis spp. sarcocysts in previous studies, and negative controls, consisting of nuclease-free water instead of the DNA template, were used for the assessment of both nPCR rounds.
The amplified PCR products were assessed using 1% agarose gel electrophoresis. Positive amplicons were purified using ExoI and FastAP (Thermo Fisher Scientific Baltics, Vilnius, Lithuania) according to the manufacturer’s recommendations. Following this, purified products were subjected to Sanger sequencing using the same forward and reverse primers as for the nPCR. The Big-Dye® Terminator v3.1 Cycle Sequencing Kit and 3500 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) were used to perform sequencing reactions according to the manufacturer’s recommendations. Obtained sequences were checked manually for the absence of any double peaks or poly signals.

2.3. Sequence Data Analysis

To compute intraspecific and interspecific genetic similarity values, in the current study, the obtained cox1 sequences were compared with those of closely related Sarcocystis spp. using the Nucleotide BLAST online tool ([42]; accessed on 9 January 2025). Phylogenetic analysis was performed using MEGA v. 11.0.13 software [43]. Multiple sequence alignments were created using the MUSCLE algorithm incorporated into MEGA. Sequences included in the sequence alignment differed in nucleotide substitutions but not in deletions/insertions. Phylogenetic relationships of Sarcocystis spp. were assessed using the maximum likelihood method. Based on MEGA’s Find Best DNA/Protein Models (ML) function, Kimura 2 parameter + G was selected as the best fitting to all alignments analyzed. The robustness of the phylogeny was tested using the bootstrap method with 1000 replicates.

2.4. Statistical Data Analysis

The Clopper–Pearson method was used to compute 95% confidence intervals (CIs) for the frequency of listed Sarcocystis spp. in definitive host animals collected for several years. A Chi-squared test was used to evaluate differences in the detection rates of Sarcocystis species in the examined raccoon dogs. Statistical tests were carried out using the Quantitative Parasitology 3.0 software [44].

3. Results

3.1. Microscopical Examination of Sarcocystis spp. Sporocysts/Oocysts from the Intestines of Raccoon Dogs

Under light microscopy, oocysts and/or sporocysts of Sarcocystis spp. were detected in 13 out of 26 intestinal samples (50.0%; 95% CI = 36.9–76.7) from raccoon dogs. In contrast, Sarcocystis spp. were identified in 23 out of 26 tested individuals (88.5%; 95% CI = 69.8–97.6) using molecular methods. The observed detection rates indicate a significantly higher efficiency of molecular methods compared to microscopy (χ2 = 9.03, p = 0.003).
Free sporocysts were observed in all samples where Sarcocystis parasites were detected microscopically, whereas in eight samples sporulated oocysts were seen. The number of Sarcocystis stages per 24 × 24 mm coverslip area ranged from 3 to 175 (73.1 ± 61.4). In most of the intestinal samples, free sporocysts were more frequently detected than sporulating oocysts. Sporocysts of Sarcocystis spp. measured 11.1–17.6 × 7.1–10.2 μm (14.0 ± 1.4 × 8.4 ± 0.9 μm; n = 222), whereas ellipsoidal sporulated oocysts were thin-walled and measured 14.6–23.2 × 12.0–18.1 μm (18.6 ± 3.0 × 14.8 ± 1.9; n = 31) (Figure 2). The identification of Sarcocystis species was conducted by further molecular analysis.

3.2. Molecular Identification of Sarcocystis Species

Using species-specific nested PCR and a subsequent sequencing approach, we have tested the presence of 16 Sarcocystis species in the intestinal samples of raccoon dogs. Overall, 11 different Sarcocystis species, i.e., S. alces, S. capracanis, S. capreolicanis, S. gracilis, S. hjorti, S. iberica, S. linearis, S. miescheriana, S. morae, S. tenella, and S. venatoria have been identified (Table 2). On the contrary, the designed primers failed to produce positive amplicons when applied to S. arieticanis, S. bertrami, S. cruzi, S. taeniata, and S. pilosa. By using V2ibeven1/V2ibeven2 primers, theoretically designed to amplify S. iberica and S. venatoria cox1 fragments, S. iberica was detected in three samples, and another tested species was found in one sample. However, only one species, S. linearis, was identified with the help of V2taelin1/V2taelin2 primers in silico designed to amplify cox1 of either S. linearis or S. taeniata. After the resulting sequences were truncated by discarding the primer-binding nucleotides, the lengths of the analyzed sequences varied between 207 and 617 bp (Table 2). One to five cox1 haplotypes were identified in the Sarcocystis species detected. Our generated sequences showed very high similarity compared to other sequences of the same Sarcocystis species available in GenBank (96.2–100%). Despite the short DNA fragments compared, for each tested Sarcocystis species, the calculated values of intraspecific genetic similarity and interspecific genetic similarity did not overlap, indicating the correctness of the method used in this study.
For some species, the differences between the intraspecific and interspecific genetic variability values obtained were relatively small. Specifically, the resulting sequences of S. capracanis, S. capreolicanis, S. hjorti, S. iberica, S. linearis, S. tenella, and S. venatoria showed 91.5–97.7% similarity with those of most closely related species. Therefore, phylogenetic analyses were carried out for a conclusive identification of these species. In phylograms, our sequences clustered with those of the same species obtained from the GenBank, confirming the identity of the Sarcocystis species established (Figure 3). Based on the cox1 fragments examined, S. linearis was a sister species to S. taeniata (Figure 3a), S. capracanis was a sister species to S. tenella (Figure 3b,e), S. capreolicanis showed the closest relationships with S. alceslatrans, S. gjerdei, and S. pilosa (Figure 3c), S. hjorti was most closely related to S. pilosa (Figure 3d), and S. iberica clustered with S. venatoria (Figure 3f). In general, the species identified were most closely related to Sarcocystis spp. using members of the Bovidae or Cervidae family as their IHs and canids as their definitive hosts.

3.3. Distribution of Sarcocystis Species in Raccoon Dog Samples Analyzed

By using molecular methods, we have identified the Sarcocystis species utilizing both domestic and wild animals as IHs in the intestinal samples of raccoon dogs. Among the molecularly confirmed Sarcocystis species, the most prevalent ones were S. gracilis (46.2%), S. capreolicanis (42.3%), and S. hjorti (38.5%), which employ Cervidae as IHs and S. miescheriana (38.5%), forming sarcocysts in pigs/wild boars (Table 3). The analysis revealed that S. gracilis was found to be significantly more prevalent in raccoon dogs than several other Sarcocystis species, including S. alces2 = 4.28, p < 0.05), S. iberica2 = 7.59, p < 0.0001), S. tenella2 = 4.28, p < 0.05), and S. venatoria2 = 12.41, p < 0.00001). Similarly, S. capreolicanis showed significantly higher detection rates compared to S. iberica2 = 10.83, p < 0.00001) and S. venatoria2 = 6.26, p < 0.05). In addition, S. hjorti, S. miescheriana, and S. morae were detected more frequently than S. venatoria and S. iberica (p < 0.05). On the other hand, S. venatoria was found to be less common than both S. capracanis2 = 4.13, p < 0.05) and S. linearis2 = 6.58, p < 0.05).
Among 23 Sarcocystis spp.-positive raccoon dogs, a single Sarcocystis species was identified only in one animal, while in the rest of the samples analyzed, two to seven different Sarcocystis species were established. In most cases, two to four different Sarcocystis species were present within a single animal specimen, accounting for 69.2% of the samples investigated (18/26). The most prevalent parasite species combinations involved distinct Sarcocystis species from the Cervidae family, as this was recorded in 34.6% of animals (9/26). In five samples (19.2%), we found at least one species of Sarcocystis using Caprinae, Cervidae, and Suidae as their IHs. For instance, S. capracanis and S. tenella (IH: Caprinae), S. hjorti (IH: Cervidae), and S. miescheriana (IH: Suidae) were identified in one of the samples.

4. Discussion

Raccoon dogs have been recognized as one of the most successful invasive carnivorous species after their introduction to the European continent from East Asia [45]. Their diverse diet and adaptability to various environments allowed them to spread not only across Lithuania but throughout eastern, central, and northern parts of Europe, competing with native species [4,46]. Despite this, data on the role of raccoon dogs in spreading Sarcocystis parasites are scarce, as is information on the diversity of these parasites within this host, particularly in their native range [47,48]. Traditionally, identification of Sarcocystis parasites in definitive hosts relied on transmission experiments using experimental animals from the Canidae family, such as dogs or foxes, and from the Felidae family, such as cats [49,50,51]. Nowadays, due to ethical issues, the use of laboratory experiments on predatory mammals is limited. Therefore, molecular methods have become increasingly popular for identifying Sarcocystis species in fecal or mucosal scraping samples from wild predators infected under natural conditions [26,52,53].
During our investigation, molecular analysis revealed that 88.5% (23/26) of the intestinal samples from raccoon dogs were positive for Sarcocystis parasites, while microscopic analysis showed a lower detection rate of 50.0% (13/26). In many studies, molecular methods have been found to give higher detection rates of Sarcocystis spp. than microscopy. [23,54]. The scarcity and small size of excreted sporocysts in natural infections make the microscopic approach challenging for scientists without prior experience observing Sarcocystis spp. in the mucosal scrapings or feces of the definitive host [55]. Additionally, differences in detection rates may be attributed to the higher sensitivity of molecular methods, which can detect parasitic gDNA present in lower concentrations [53].
Based on the results of microscopical methods, the occurrence of Sarcocystis spp. in the intestines of raccoon dogs across Europe is generally similar, with 66.7% (2/3) found in the large intestines of raccoon dogs from the Czech Republic [23] and 52.6% (20/38) and 53.8% (7/13) in the small intestines of raccoon dogs from Germany [56] and Lithuania [22], respectively. Interestingly, lower detection rates of Sarcocystis parasites were recorded in the intestinal scrapings of foxes, also members of the Canidae family. Only 20.0% (4/20) of intestinal samples from red foxes in Lithuania [22], 38.0% (19/50) in Germany [56], 30.0% (6/20) in Switzerland [57], and 39.4% (13/33) of intestinal samples from Pampas foxes, Lycalopex gymnocercus (Fischer, 1814), in Argentina [58] tested positive for Sarcocystis. The relatively higher detection rates of Sarcocystis spp. in raccoon dogs’ intestinal scrapings compared to other Canidae species may be linked to their dietary preferences. However, all these species—raccoon dogs, red foxes, and others—consume similar diets, including small and medium to large mammals, ungulates, and carrion [59,60,61]. Therefore, further research involving various Canidae species within the same geographic area is needed to compare detection rates of Sarcocystis spp. among the members of the Canidae family.
Experimental studies confirmed raccoon dogs to be definitive hosts for at least four Sarcocystis species: S. cruzi (IH: cattle) [47], Sarcocystis grueneri Yakimoff and Sokoloff, 1934 (IH: Cervidae/reindeer (Rangifer tarandus)) [62], S. miescheriana (IH: wild boars and pigs) [47], and Sarcocystis tarandivulpes Gjerde, 1984 (IH: Cervidae/reindeer (Rangifer tarandus)) [62]. Through the application of molecular methods, raccoon dogs were found to be definitive hosts for four additional Sarcocystis species, S. capreolicanis (IH: Cervidae/roe deer (Capreolus capreolus)), S. gracilis (IH: Cervidae/roe deer (Capreolus capreolus)) [56], Sarcocystis lutrae Gjerde and Josefsen, 2015 (IH: carnivores of families Canidae, Mustelidae and Procyonidae) [63], and Sarcocystis rileyi (Stiles, 1893) Dubey, Cawthorn, Speer and Wobeser, 2003 (IH: birds of family Anatidae) [22]. Our study provides new evidence that raccoon dogs can serve as definitive host for eight Sarcocystis species, all of which were previously unidentified in this host. This includes six species (S. alces, S. hjorti, S. iberica, S. linearis, S. morae, and S. venatoria) that typically use Cervidae as IHs and two species (S. capracanis and S. tenella) that infect members of subfamily Caprinae.
Some Sarcocystis species are zoonotic and pose a significant health risk to humans. Currently, humans can act as definitive hosts for three species: S. heydorni and S. hominis, transmitted through cattle, and S. suihominis, which spreads through wild boars and pigs [64,65,66]. Furthermore, recent studies indicate that ingesting raw meat containing a high concentration of Sarcocystis spp. sarcocysts may result in toxic effects. In Japan, there have been documented instances where individuals developed temporary gastrointestinal issues, including nausea, abdominal discomfort, diarrhea, and vomiting, within a few hours of consuming contaminated horsemeat carrying Sarcocystis fayeri Dubey, Streitel, Stromberg and Toussant, 1997, sarcocysts or raw venison contaminated with Sarcocystis truncata (Gjerde, 1984) Gjerde, 2014 [67,68,69]. In addition to the human health impact, Sarcocystis species also affect various animal hosts, particularly ruminants. Occasionally, S. tenella and S. arieticanis infections in sheep can result in miscarriage or acute disease during the early stages, with chronic effects, such as reduced productivity and persistent illness, becoming evident in the later stages of infection [70,71]. In pigs, acute infections with S. miescheriana can lead to serious symptoms such as loss of appetite, fever, cyanosis, heart inflammation, liver damage, and kidney issues [72]. Similar pathological changes, such as fever, miscarriage, or even death, have been observed in goats with acute S. capracanis infections [73], though no zoonotic Sarcocystis species have been detected in small ruminants to date. Data on the pathogenicity of Sarcocystis species in cervids (Cervidae) are extremely limited. Despite that, a study in Switzerland identified S. hjorti as a cause of eosinophilic fasciitis in red deer (Cervus elaphus), highlighting the need for further research on its impact on wildlife health [57]. Evidence suggests that Sarcocystis spp. transmitted by canids or primates are generally more pathogenic than those spread by felids. In the present study, we have identified S. capracanis, S. hjorti, S. miescheriana, and S. tenella, which can be pathogenic to their respective IHs, indicating that raccoon dogs may contribute to the spread of pathogenic Sarcocystis species (Figure 4).
Raccoon dogs are considered medium-sized predators, and the winter season plays a crucial role in their survival [74,75]. Of all the species in the Canidae family, this is the only one that demonstrates winter lethargy in regions with severe winter conditions [6]. Although they typically hibernate, raccoon dogs in Lithuania remain active year-round during milder winters [60]. In this study, we identified multiple Sarcocystis species, with their IHs belonging to the Caprinae subfamily, Cervidae, and Suidae families, showing the importance of this predator in the transmission of various Sarcocystis spp. During previous studies, it was observed that active raccoon dogs often visit an increased number of artificial wild boar-feeding sites in Northern Europe [76], which may explain the relatively high detection rate of S. miescheriana in our study. However, the majority of Sarcocystis spp. detected during our study infect Cervidae as IHs. This preference may be linked to raccoon dogs’ avoidance of areas with high human activity, as they tend to favor natural habitats, particularly mixed forests in Lithuania [77]. Other members of the Canidae family prevalent in Lithuania, red foxes and gray wolves, are known to prey on livestock, particularly in rural habitats. These predators often target farm animals, including poultry, sheep, and cattle, when natural prey is scarce or when they are in close proximity to human settlements [78,79]. This feeding behavior is further supported by studies from Switzerland and Germany, which found that red foxes were more commonly infected with Sarcocystis spp. whose IHs are farm animals, while raccoon dogs were predominantly infected with species whose IHs are Cervidae [56,57].

5. Conclusions

The prevalence of Sarcocystis spp. in this study was notably higher when detected using molecular methods (88.5%) compared to microscopy (50.0%). The comprehensive analysis, incorporating microscopical, molecular, and phylogenetic techniques, revealed that raccoon dogs in Lithuania were infected with 11 distinct Sarcocystis species. Among these, S. alces, S. capracanis, S. hjorti, S. iberica, S. linearis, S. morae, S. tenella, and S. venatoria were identified in raccoon dogs as natural definitive hosts for the first time worldwide. Of the Sarcocystis species detected, some can be pathogenic to farm animals and cervids. Additionally, raccoon dogs more frequently harbored Sarcocystis species with wild animals as their IHs than those associated with farm animals.

Author Contributions

Conceptualization, P.P. and D.B.; methodology, P.P.; software, P.P. and T.K.; validation, P.P., D.Š., E.J.-N. and D.B.; formal analysis, P.P., T.K. and N.G.; investigation, T.K., N.G., D.Š. and E.J.-N.; resources, P.P., E.J.-N. and D.B.; writing—original draft preparation, P.P., T.K., N.G. and E.J.-N.; writing—review and editing, P.P., T.K., N.G., D.Š., E.J.-N. and D.B.; visualization, P.P., T.K. and E.J.-N.; supervision, D.B.; funding acquisition, D.B. All authors have read and agreed to the published version of the manuscript.

Funding

The research was funded by the Research Council of Lithuania (grant number S-MIP-23-3).

Institutional Review Board Statement

The animal study protocol was approved by the Ethics Committee of the Nature Research Centre (no. GGT-1; 11 January 2024).

Informed Consent Statement

Not applicable.

Data Availability Statement

The cox1 sequences of Sarcocystis spp. from intestinal mucosa scrapings of raccoon dogs were submitted in the GenBank database with accession numbers PQ900477–PQ900556.

Acknowledgments

The authors are grateful to hunters M. Mackevičius and V. Pabrinkis for providing common raccoon dog samples for this study.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Dubey, J.P.; Calero-Bernal, R.; Rosenthal, B.M.; Speer, C.A.; Fayer, R. Sarcocystosis of Animals and Humans, 2nd ed.; CRC Press: Boca Raton, FL, USA, 2015; ISBN 978-0-429-18318-8. [Google Scholar]
  2. Sutor, A.; Schwarz, S.; Conraths, F.J. The Biological Potential of the Raccoon Dog (Nyctereutes procyonoides, Gray 1834) as an Invasive Species in Europe—New Risks for Disease Spread? Acta Theriol. 2014, 59, 49–59. [Google Scholar] [CrossRef] [Scilit]
  3. Jasiulionis, M.; Stirkė, V.; Balčiauskas, L. The Distribution and Activity of the Invasive Raccoon Dog in Lithuania as Found With Country-Wide Camera Trapping. Forests 2023, 14, 1328. [Google Scholar] [CrossRef] [Scilit]
  4. Kauhala, K.; Kowalczyk, R. Invasion of the Raccoon Dog Nyctereutes procyonoides in Europe: History of Colonization, Features Behind its Success, and Threats to Native Fauna. Curr. Zool. 2011, 57, 584–598. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Kauhala, K.; Kowalczyk, R. The Raccoon Dog (Nyctereutes procyonoides) in the Community of Medium-Sized Carnivores in Europe: Its Adaptations, Impact on Native Fauna and Management of the Population. In Carnivores: Species, Conservation, and Management; Nova Publishers: Hauppauge, NY, USA, 2012. [Google Scholar]
  6. Kauhala, K.; Holmala, K.; Schregel, J. Seasonal Activity Patterns and Movements of the Raccoon Dog, a Vector of Diseases and Parasites, in Southern Finland. Mamm. Biol. 2007, 72, 342–353. [Google Scholar] [CrossRef] [Scilit]
  7. Sutor, A.; Kauhala, K.; Ansorge, H. Diet of the Raccoon Dog Nyctereutes procyonoides—A Canid with an Opportunistic Foraging Strategy. Acta Theriol. 2010, 55, 165–176. [Google Scholar] [CrossRef] [Scilit]
  8. Balčiauskas, L.; Stratford, J.; Balčiauskienė, L.; Kučas, A. Roadkills as a Method to Monitor Raccoon Dog Populations. Animals 2021, 11, 3147. [Google Scholar] [CrossRef] [Scilit]
  9. Drake, J.A. Handbook of Alien Species in Europe, 1st ed.; Springer: Dordrecht, The Netherlands, 2009; Volume 3, ISBN 978-1-4020-8279-5. [Google Scholar]
  10. Klingenstein, F.; Kornacker, P.M.; Martens, H.; Schippmann, U. Gebietsfremde Arten. Positionspapier des Bundesamtes für Naturschutz. Bundesamt für Naturschutz. Bonn BfN Skripten 2005, 128, 1–31. [Google Scholar]
  11. Torchin, M.E.; Mitchell, C.E. Parasites, Pathogens, and Invasions by Plants and Animals. Front. Ecol. Environ. 2004, 2, 183–190. [Google Scholar] [CrossRef]
  12. Malakauskas, A.; Paulauskas, V.; Järvis, T.; Keidans, P.; Eddi, C.; Kapel, C.M.O. Molecular Epidemiology of Trichinella spp. in Three Baltic Countries: Lithuania, Latvia, and Estonia. Parasitol. Res. 2007, 100, 687–693. [Google Scholar] [CrossRef] [Scilit]
  13. Kjær, L.J.; Jensen, L.M.; Chriél, M.; Bødker, R.; Petersen, H.H. The Raccoon Dog (Nyctereutes procyonoides) as a Reservoir of Zoonotic Diseases in Denmark. Int. J. Parasitol. Parasites Wildl. 2021, 16, 175–182. [Google Scholar] [CrossRef] [Scilit]
  14. Myśliwy, I.; Perec-Matysiak, A.; Hildebrand, J. Invasive Raccoon (Procyon lotor) and Raccoon Dog (Nyctereutes procyonoides) as Potential Reservoirs of Tick-Borne Pathogens: Data Review from Native and Introduced Areas. Parasit. Vectors 2022, 15, 126. [Google Scholar] [CrossRef] [Scilit]
  15. Klink, J.C.; Rieger, A.; Wohlsein, P.; Siebert, U.; Obiegala, A. Vector-Borne and Zoonotic Pathogens in Raccoon Dogs (Nyctereutes procyonoides) and Raccoons (Procyon lotor) from Schleswig-Holstein, Germany. Pathogens 2024, 13, 270. [Google Scholar] [CrossRef] [Scilit]
  16. Hsueh, F.-C.; Shi, K.; Mendoza, A.; Bu, F.; Zhang, W.; Aihara, H.; Li, F. Structural Basis for Raccoon Dog Receptor Recognition by SARS-CoV-2. PLoS Pathog 2024, 20, e1012204. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Bružinskaitė-Schmidhalter, R.; Šarkūnas, M.; Malakauskas, A.; Mathis, A.; Torgerson, P.R.; Deplazes, P. Helminths of Red Foxes (Vulpes vulpes) and Raccoon Dogs (Nyctereutes procyonoides) in Lithuania. Parasitology 2012, 139, 120–127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Murrell, K.D.; Pozio, E. Worldwide Occurrence and Impact of Human Trichinellosis, 1986–2009. Emerg. Infect. Dis. 2011, 17, 2194–2202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Tuska-Szalay, B.; Takács, N.; Kontschán, J.; Vizi, Z.; Hornok, S. Dogs are Final Hosts of Sarcocystis morae (Apicomplexa: Sarcocystidae): First Report of This Species in Hungary and Its Region–Short Communication. Acta Vet. Hung. 2021, 69, 157–160. [Google Scholar] [CrossRef] [Scilit]
  20. Khan, R.A.; Evans, L. Prevalence of Sarcocystis spp. in Two Subspecies of Caribou (Rangifer tarandus) in Newfoundland and Labrador, and Foxes (Vulpes vulpes), Wolves (Canis lupus), and Husky Dogs (Canis familiaris) as Potential Definitive Hosts. J. Parasitol. 2006, 92, 662–663. [Google Scholar] [CrossRef] [Scilit]
  21. Gupta, A.; De Araujo, L.S.; Humpal, C.; Carstensen, M.; Rosenthal, B.M.; Dubey, J.P. Molecular Confirmation of Wolf (Canis lupus) as a Natural Definitive Host for Sarcocystis cruzi of Cattle, Sarcocystis mehlhorni of Deer, and Sarcocystis wenzeli of Chickens. J. Parasitol. 2024, 110, 679–683. [Google Scholar] [CrossRef] [Scilit]
  22. Prakas, P.; Liaugaudaitė, S.; Kutkienė, L.; Sruoga, A.; Švažas, S. Molecular Identification of Sarcocystis rileyi Sporocysts in Red Foxes (Vulpes vulpes) and Raccoon Dogs (Nyctereutes procyonoides) in Lithuania. Parasitol. Res. 2015, 114, 1671–1676. [Google Scholar] [CrossRef] [Scilit]
  23. Máca, O.; Gudiškis, N.; Butkauskas, D.; González-Solís, D.; Prakas, P. Red Foxes (Vulpes vulpes) and Raccoon Dogs (Nyctereutes procyonoides) as Potential Spreaders of Sarcocystis Species. Front. Vet. Sci. 2024, 11, 1392618. [Google Scholar] [CrossRef] [Scilit]
  24. Dahlgren, S.S.; Gjerde, B. The Red Fox (Vulpes vulpes) and the Arctic Fox (Vulpes lagopus) are Definitive Hosts of Sarcocystis alces and Sarcocystis hjorti from Moose (Alces alces). Parasitology 2010, 137, 1547–1557. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Gherman, C.M.; Mihalca, A.D. A Synoptic Overview of Golden Jackal Parasites Reveals High Diversity of Species. Parasit. Vectors 2017, 10, 419. [Google Scholar] [CrossRef] [Scilit]
  26. Verma, S.K.; Lindsay, D.S.; Grigg, M.E.; Dubey, J.P. Isolation, Culture and Cryopreservation of Sarcocystis Species. Curr. Protoc. Microbiol. 2017, 45, 20D.1.1–20D.1.27. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Prakas, P.; Jasiulionis, M.; Šukytė, T.; Juozaitytė-Ngugu, E.; Stirkė, V.; Balčiauskas, L.; Butkauskas, D. First Observations of Buzzards (Buteo) as Definitive Hosts of Sarcocystis Parasites Forming Cysts in the Brain Tissues of Rodents in Lithuania. Biology 2024, 13, 264. [Google Scholar] [CrossRef] [Scilit]
  28. Heydorn, A.O.; Mehlhorn, H. Fine Structure of Sarcocystis arieticanis Heydorn, 1985 in its Intermediate and Final Hosts (Sheep and Dog). Zentralbl. Bakteriol. Mikrobiol. Hyg. A 1987, 264, 353–362. [Google Scholar] [CrossRef] [Scilit]
  29. Zeng, W.; Sun, L.; Xiang, Z.; Li, N.; Zhang, J.; He, Y.; Li, Q.; Yang, F.; Song, J.; Morris, J.; et al. Morphological and Molecular Characteristics of Sarcocystis bertrami from Horses and Donkeys in China. Vet. Parasitol. 2018, 252, 89–94. [Google Scholar] [CrossRef] [Scilit]
  30. Gjerde, B.; de La Fuente, C.; Alunda, J.M.; Luzón, M. Molecular Characterisation of Five Sarcocystis Species in Domestic Sheep (Ovis aries) from Spain. Parasitol. Res. 2020, 119, 215–231. [Google Scholar] [CrossRef] [Scilit]
  31. Marandykina-Prakienė, A.; Butkauskas, D.; Gudiškis, N.; Juozaitytė-Ngugu, E.; Bagdonaitė, D.L.; Kirjušina, M.; Calero-Bernal, R.; Prakas, P. Sarcocystis Species Richness in Sheep and Goats from Lithuania. Vet. Sci. 2023, 10, 520. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Dahlgren, S.S.; Gjerde, B. Sarcocystis in Moose (Alces alces): Molecular Identification and Phylogeny of Six Sarcocystis Species in Moose, and a Morphological Description of Three New Species. Parasitol. Res. 2008, 103, 93–110. [Google Scholar] [CrossRef] [Scilit]
  33. Gjerde, B.; Giacomelli, S.; Bianchi, A.; Bertoletti, I.; Mondani, H.; Gibelli, L.R. Morphological and Molecular Characterization of Four Sarcocystis spp., Including Sarcocystis linearis n. sp., from Roe Deer (Capreolus capreolus) in Italy. Parasitol. Res. 2017, 116, 1317–1338. [Google Scholar] [CrossRef] [Scilit]
  34. Gjerde, B.; Luzón, M.; Alunda, J.M.; de La Fuente, C. Morphological and Molecular Characteristics of Six Sarcocystis spp. from Red Deer (Cervus elaphus) in Spain, Including Sarcocystis cervicanis and Three New Species. Parasitol. Res. 2017, 116, 2795–2811. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Dahlgren, S.S.; Gjerde, B. Molecular Characterization of Five Sarcocystis Species in Red Deer (Cervus elaphus), Including Sarcocystis hjorti n. sp., Reveals That These Species are Not Intermediate Host Specific. Parasitology 2010, 137, 815–840. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Prakas, P.; Butkauskas, D.; Rudaitytė, E.; Kutkienė, L.; Sruoga, A.; Pūraitė, I. Morphological and Molecular Characterization of Sarcocystis taeniata and Sarcocystis pilosa n. sp. From the Sika Deer (Cervus nippon) in Lithuania. Parasitol. Res. 2016, 115, 3021–3032. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Gjerde, B. Morphological and Molecular Characteristics of Four Sarcocystis spp. in Canadian Moose (Alces alces), Including Sarcocystis taeniata n. sp. Parasitol. Res. 2014, 113, 1591–1604. [Google Scholar] [CrossRef] [Scilit]
  38. Coelho, C.; Gomes, J.; Inácio, J.; Amaro, A.; Mesquita, J.R.; Pires, I.; Lopes, A.P.; Vieira-Pinto, M. Unraveling Sarcocystis miescheriana and Sarcocystis suihominis Infections in Wild Boar. Vet. Parasitol. 2015, 212, 100–104. [Google Scholar] [CrossRef] [Scilit]
  39. Gjerde, B. Phylogenetic Relationships among Sarcocystis Species in Cervids, Cattle and Sheep Inferred from the Mitochondrial Cytochrome c Oxidase Subunit I Gene. Int. J. Parasitol. 2013, 43, 579–591. [Google Scholar] [CrossRef] [Scilit]
  40. Marandykina-Prakienė, A.; Butkauskas, D.; Gudiškis, N.; Juozaitytė-Ngugu, E.; Januškevičius, V.; Rudaitytė-Lukošienė, E.; Prakas, P. Molecular Identification of Sarcocystis Species in Sheep from Lithuania. Animals 2022, 12, 2048. [Google Scholar] [CrossRef] [Scilit]
  41. Baranauskaitė, A.; Strazdaitė-Žielienė, Ž.; Servienė, E.; Butkauskas, D.; Prakas, P. Molecular Identification of Protozoan Sarcocystis in Different Types of Water Bodies in Lithuania. Life 2022, 13, 51. [Google Scholar] [CrossRef] [Scilit]
  42. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic Local Alignment Search Tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
  43. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [Scilit]
  44. Reiczigel, J.; Marozzi, M.; Fábián, I.; Rózsa, L. Biostatistics for Parasitologists—A Primer to Quantitative Parasitology. Trends Parasitol. 2019, 35, 277–281. [Google Scholar] [CrossRef] [Scilit]
  45. Nummi, P.; Väänänen, V.-M.; Pekkarinen, A.-J.; Eronen, V.; Nurmi, J.; Rautiainen, A.; Rusanen, P. Alien Predation in Wetlands the Raccoon Dog and Waterbird Breeding Success. Balt. For. 2019, 25, 228–237. [Google Scholar] [CrossRef] [Scilit]
  46. Prūsaitė, J. Lithuanian Fauna. Mammals; Mokslas: Vilnius, Lithuania, 1988. [Google Scholar]
  47. Saito, M.; Itagaki, H. Experimental Infection of Raccoon Dogs with Sarcocystis cruzi and S. miescheriana. J. Vet. Med. Sci. 1994, 56, 671–674. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Kubo, M.; Okano, T.; Ito, K.; Tsubota, T.; Sakai, H.; Yanai, T. Muscular Sarcocystosis in Wild Carnivores in Honshu, Japan. Parasitol. Res. 2009, 106, 213–219. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Dubey, J.P. Experimental Infections of Sarcocystis cruzi, Sarcocystis tenella, Sarcocystis capracanis and Toxoplasma gondii in Red Foxes (Vulpes vulpes). J. Wildl. Dis. 1983, 19, 200–203. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  50. Wee, S.-H.; Shin, S.-S. Experimental Induction of the Two-Host Life Cycle of Sarcocystis cruzi between Dogs and Korean Native Calves. Korean J. Parasitol. 2001, 39, 227. [Google Scholar] [CrossRef] [Scilit]
  51. Butcher, M.; Lakritz, J.; Halaney, A.; Branson, K.; Gupta, G.D.; Kreeger, J.; Marsh, A.E. Experimental Inoculation of Domestic Cats (Felis domesticus) with Sarcocystis neurona or S. neurona-like Merozoites. Vet. Parasitol. 2002, 107, 1–14. [Google Scholar] [CrossRef] [Scilit]
  52. Prakas, P.; Balčiauskas, L.; Juozaitytė-Ngugu, E.; Butkauskas, D. The Role of Mustelids in the Transmission of Sarcocystis spp. Using Cattle as Intermediate Hosts. Animals 2021, 11, 822. [Google Scholar] [CrossRef] [Scilit]
  53. Elshahawy, I.S.; Fawaz, M.; Gomaa, A.; Mohammed, E. Prevalence and First Molecular Identification of Sarcocystis Species in Feces of Domestic Dogs (Canis familiaris) in Egypt. BMC Vet. Res. 2023, 19, 278. [Google Scholar] [CrossRef] [Scilit]
  54. Šneideris, D.; Moskaliova, D.; Butkauskas, D.; Prakas, P. The Distribution of Sarcocystis Species Described by Ungulates-Canids Life Cycle in Intestines of Small Predators of the Family Mustelidae. Acta Parasit. 2024, 69, 747–758. [Google Scholar] [CrossRef] [Scilit]
  55. Xiang, Z.; Chen, X.; Yang, L.; He, Y.; Jiang, R.; Rosenthal, B.M.; Luan, P.; Attwood, S.W.; Zuo, Y.; Zhang, Y.; et al. Non-Invasive Methods for Identifying Oocysts of Sarcocystis spp. from Definitive Hosts. Parasitol. Int. 2009, 58, 293–296. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  56. Moré, G.; Maksimov, A.; Conraths, F.J.; Schares, G. Molecular Identification of Sarcocystis spp. in Foxes (Vulpes vulpes) and Raccoon Dogs (Nyctereutes procyonoides) from Germany. Vet. Parasitol. 2016, 220, 9–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  57. Basso, W.; Alvarez Rojas, C.A.; Buob, D.; Ruetten, M.; Deplazes, P. Sarcocystis Infection in Red Deer (Cervus elaphus) with Eosinophilic Myositis/Fasciitis in Switzerland and Involvement of Red Foxes (Vulpes vulpes) and Hunting Dogs in the Transmission. Int. J. Parasitol. Parasit. Wildl. 2020, 13, 130–141. [Google Scholar] [CrossRef] [Scilit]
  58. Scioscia, N.P.; Olmos, L.; Gorosábel, A.; Bernad, L.; Pedrana, J.; Hecker, Y.P.; Gual, I.; Laura Gos, M.; Denegri, G.M.; Moore, D.P.; et al. Pampas Fox (Lycalopex gymnocercus) New Intermediate Host of Sarcocystis svanai (Apicomplexa: Sarcocystidae). Parasitol. Int. 2017, 66, 214–218. [Google Scholar] [CrossRef] [Scilit]
  59. Fleming, P.J.S.; Nolan, H.; Jackson, S.M.; Ballard, G.-A.; Bengsen, A.; Brown, W.Y.; Meek, P.D.; Mifsud, G.; Pal, S.K.; Sparkes, J. Roles for the Canidae in Food Webs Reviewed: Where Do They Fit? Food Webs 2017, 12, 14–34. [Google Scholar] [CrossRef] [Scilit]
  60. Baltrūnaitė, L. Diet and Winter Habitat Use of the Red Fox, Pine Marten and Raccoon Dog in Dzūkija National Park, Lithuania. Acta Zool. Litu. 2006, 16, 46–53. [Google Scholar] [CrossRef] [Scilit]
  61. Drygala, F.; Zoller, H. Diet Composition of the Invasive Raccoon Dog (Nyctereutes procyonoides) and the Native Red Fox (Vulpes vulpes) in North-East Germany. Hystrix 2014, 24, 190–194. [Google Scholar] [CrossRef] [Scilit]
  62. Gjerde, B. The Raccoon Dog (Nyctereutes procyonoides) as Definitive Host for Sarcocystis spp. of Reindeer (Rangifer tarandus). Acta Vet. Scand. 1984, 25, 419–424. [Google Scholar] [CrossRef] [Scilit]
  63. Máca, O. Molecular Identification of Sarcocystis lutrae (Apicomplexa: Sarcocystidae) from the Raccoon Dog, Nyctereutes procyonoides, and the Common Raccoon, Procyon lotor, in the Czech Republic. Parasit. Vectors 2020, 13, 231. [Google Scholar] [CrossRef] [Scilit]
  64. Heydorn, A.O. Beiträge zum Lebenszyklus der Sarkosporidien. IX. Entwicklungszyklus von Sarcocystis suihominis n. spec. Berl. Münch Tierärztl. Wochenschr. 1977, 90, 218–224. [Google Scholar]
  65. Heydorn, A.O.; Gestrich, R.; Janitschke, K. Beiträge zum Lebenszyklus der Sarkosporidien. VIII. Sporozysten von Sarcocystis bovihominis in den Fäzes von Rhesusaffen (Macaca rhesus) und Pavianen (Papio cynocephalus). Berl. Münch Tierärztl. Wochenschr. 1976, 89, 116–120. [Google Scholar] [PubMed]
  66. Dubey, J.P.; Van Wilpe, E.; Calero-Bernal, R.; Verma, S.K.; Fayer, R. Sarcocystis heydorni, n. sp. (Apicomplexa: Sarcocystidae) with Cattle (Bos taurus) and Human (Homo sapiens) Cycle. Parasitol. Res. 2015, 114, 4143–4147. [Google Scholar] [CrossRef] [Scilit]
  67. Ota, T.; Nakano, Y.; Mizuno, T.; Shiozaki, A.; Hori, Y.; Yamanishi, K.; Hayakawa, K.; Hayakawa, T.; Fujimoto, T.; Nakamoto, C.; et al. First Case Report of Possible Sarcocystis truncata-Induced Food Poisoning in Venison. Intern. Med. 2019, 58, 2727–2730. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  68. Kamata, Y.; Saito, M.; Irikura, D.; Yahata, Y.; Ohnishi, T.; Bessho, T.; Inui, T.; Watanabe, M.; Sugita-Konishi, Y. A Toxin Isolated from Sarcocystis fayeri in Raw Horsemeat May Be Responsible for Food Poisoning. J. Food Prot. 2014, 77, 814–819. [Google Scholar] [CrossRef] [Scilit]
  69. Irikura, D.; Saito, M.; Sugita-Konishi, Y.; Ohnishi, T.; Sugiyama, K.I.; Watanabe, M.; Yamazaki, A.; Izumiyama, S.; Sato, H.; Kimura, Y.; et al. Characterization of Sarcocystis fayeri’s Actin-Depolymerizing Factor as a Toxin that Causes Diarrhea. Genes Cells 2017, 22, 825–835. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  70. Heckeroth, A.R.; Tenter, A.M. Development and Validation of Species-Specific Nested PCRs for Diagnosis of Acute Sarcocystiosis in Sheep. Int. J. Parasitol. 1999, 29, 1331–1349. [Google Scholar] [CrossRef] [Scilit]
  71. Dessì, G.; Tamponi, C.; Pasini, C.; Porcu, F.; Meloni, L.; Cavallo, L.; Sini, M.F.; Knoll, S.; Scala, A.; Varcasia, A. A Survey on Apicomplexa Protozoa in Sheep Slaughtered for Human Consumption. Parasitol. Res. 2022, 121, 1437–1445. [Google Scholar] [CrossRef] [Scilit]
  72. Yan, W.; Qian, W.; Li, X.; Wang, T.; Ding, K.; Huang, T. Morphological and Molecular Characterization of Sarcocystis miescheriana from Pigs in the Central Region of China. Parasitol. Res. 2013, 112, 975–980. [Google Scholar] [CrossRef] [Scilit]
  73. Amairia, S.; Amdouni, Y.; Rouatbi, M.; Rjeibi, M.R.; Awadi, S.; Gharbi, M. First Detection and Molecular Identification of Sarcocystis spp. in Small Ruminants in North-West Tunisia. Transbound. Emerg. Dis. 2017, 65, 441–446. [Google Scholar] [CrossRef] [Scilit]
  74. Mustonen, A.; Asikainen, J.; Kauhala, K.; Paakkonen, T.; Nieminen, P. Seasonal Rhythms of Body Temperature in the Free-ranging Raccoon Dog (Nyctereutes procyonoides) with Special Emphasis on Winter Sleep. Chronobiol. Int. 2007, 24, 1095–1107. [Google Scholar] [CrossRef] [Scilit]
  75. Kowalczyk, R.; Jędrzejewska, B.; Zalewski, A.; Jędrzejewski, W. Facilitative Interactions Between the Eurasian Badger (Meles meles), the Red Fox (Vulpes vulpes), and the Invasive Raccoon Dog (Nyctereutes procyonoides) in Białowieża Primeval Forest, Poland. Can. J. Zool. 2008, 86, 1389–1396. [Google Scholar] [CrossRef] [Scilit]
  76. Süld, K.; Valdmann, H.; Laurimaa, L.; Soe, E.; Davison, J.; Saarma, U. An Invasive Vector of Zoonotic Disease Sustained by Anthropogenic Resources: The Raccoon Dog in Northern Europe. PLoS ONE 2014, 9, e96358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  77. Baltrūnaitė, L. Winter Habitat Use, Niche Breadth and Overlap Between the Red Fox, Pine Marten and Raccoon Dog in Different Landscapes of Lithuania. Folia Zool. 2010, 59, 278–284. [Google Scholar] [CrossRef] [Scilit]
  78. Reshamwala, H.S.; Mahar, N.; Dirzo, R.; Habib, B. Successful Neighbour: Interactions of the Generalist Carnivore Red Fox with Dogs, Wolves and Humans for Continued Survival in Dynamic Anthropogenic Landscapes. Glob. Ecol. Conserv. 2021, 25, e01446. [Google Scholar] [CrossRef] [Scilit]
  79. Janeiro-Otero, A.; Newsome, T.M.; Van Eeden, L.M.; Ripple, W.J.; Dormann, C.F. Grey Wolf (Canis lupus) Predation on Livestock in Relation to Prey Availability. Biol. Conserv. 2020, 243, 108433. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Detection of Sarcocystis spp. in the raccoon dogs from Lithuania. Circles indicate location where animals were hunted. Red circles represent Sarcocystis spp.-positive animals, while empty circles indicate individuals in which tested parasite species have not been established.
Figure 1. Detection of Sarcocystis spp. in the raccoon dogs from Lithuania. Circles indicate location where animals were hunted. Red circles represent Sarcocystis spp.-positive animals, while empty circles indicate individuals in which tested parasite species have not been established.
Pathogens 14 00288 g001
Figure 2. Sporocysts/sporulated oocysts found in the intestinal mucosa of raccoon dogs. (a) Sporocysts. (b) Sporulated oocysts.
Figure 2. Sporocysts/sporulated oocysts found in the intestinal mucosa of raccoon dogs. (a) Sporocysts. (b) Sporulated oocysts.
Pathogens 14 00288 g002
Figure 3. Maximum likelihood phylogenetic trees showing phylogenetic placement of S. linearis (a), S. tenella (b), S. capreolicanis (c), S. hjorti (d), S. capracanis (e), S. iberica, and S. venatoria (f). Phylograms were constructed using cox1 sequences and scaled according to the branch length. Sarcocystis tarandivulpes was chosen as an outgroup for all analyses. Bootstrap values ≥ 70 are displayed next to branches. GenBank accession numbers of sequences are shown after the species name. Sequences generated in the present study are indicated in boldface.
Figure 3. Maximum likelihood phylogenetic trees showing phylogenetic placement of S. linearis (a), S. tenella (b), S. capreolicanis (c), S. hjorti (d), S. capracanis (e), S. iberica, and S. venatoria (f). Phylograms were constructed using cox1 sequences and scaled according to the branch length. Sarcocystis tarandivulpes was chosen as an outgroup for all analyses. Bootstrap values ≥ 70 are displayed next to branches. GenBank accession numbers of sequences are shown after the species name. Sequences generated in the present study are indicated in boldface.
Pathogens 14 00288 g003
Figure 4. Schematic view of the involvement of raccoon dog in the life cycle of Sarcocystis spp. (Image created in BioRender. Gudiškis, N. (2025) https://BioRender.com/j04o051, accessed on 11 March 2025).
Figure 4. Schematic view of the involvement of raccoon dog in the life cycle of Sarcocystis spp. (Image created in BioRender. Gudiškis, N. (2025) https://BioRender.com/j04o051, accessed on 11 March 2025).
Pathogens 14 00288 g004
Table 1. PCR primers used in this study.
Table 1. PCR primers used in this study.
SpeciesPrimer NameSequenceReference
1st step
Sarcocystis spp.SF1ATGGCGTACAACAATCATAAAGAADubey, 2013 [39]
SsunR3CCGTTGGWATGGCRATCATMarandykina-Prakienė et al., 2022 [40]
2nd step
S. alcesV2alc3CCTAGGTACCGTGCTCTTTGATGPresent study
V2alc4CTTCGAGGCCAGTAGTTACCATA
S. arieticanisArie7FTAATTTCCTCGGTACTGTACTGTTTGMarandykina-Prakienė et al., 2023 [31]
Arie7RTACTTACGCATTGCGATATTACG
S. bertramiV2ber7CCCCACTCAGTACGAACTCCBaranauskaitė et al., 2022 [41]
V2ber8ACTGCGATATAACTCCAAAACCA
S. capracanisV2ca3ATACCGATCTTTACGGGAGCAGTAMarandykina-Prakienė et al., 2023 [31]
V2ca4GGTCACCGCAGAGAAGTACGAT
S. capreolicanisV2capreo1CATCGTAGAGCCCCGTACTCPresent study
V2capreo2ACCGCTATACGCTGGAGCTG
S. cruziV2cr7CAATGTGCTGTTTACGCTCCA
V2cr8TCGTACAGGCCCGTAGTTAG
S. gracilisV2gr9GTGCTCGGGGCAGTGAAC
V2gr10GCCAGTAGTCATCATGTGGTGT
S. hjortiV2hjo1AAGGTACACGGCATTGTTCAC
V2hjo2GAAAACTACCCTGCCGCCTA
S. iberica
S. venatoria
V2ibeven1ATGGGCCATTATATTTACTGCTCTG
V2ibeven2GCCGCCAAAAACTACCTTACC
S. miescherianaV2mie5TCCTCGGTATTAGCAGCGTACTGBaranauskaitė et al., 2022 [41]
V2mie6ATTGAAGGGCCACCAAACAC
S. moraeV2mor1GTGTGCTTGGATCGGTCAACMarandykina-Prakienė et al., 2023 [31]
V2mor2GCCGAATACCGGCTTACTTC
S. pilosaV2pil3GTTAATTTCCTGGGCACAGTGTTPresent study
V2pil4CGAAAACTACTCTGCCGCCTAC
S. taeniata
S. linearis
V2taelin1CGTAGACTGCATGACGACTTACAA
V2taelin2CAAAGATGGATTTGCTGCCTA
S. tenellaTen8FATACCGCTCTACGCTGGATCTACMarandykina-Prakienė et al., 2023 [31]
Ten8RTACCGCTCTACGCTGGATCTAC
Table 2. The comparison of in the present study obtained cox1 sequences with those of various Sarcocystis species available in GenBank.
Table 2. The comparison of in the present study obtained cox1 sequences with those of various Sarcocystis species available in GenBank.
Sarcocystis
Species
GenBank
Acc. No.
The Length
of the Fragment
No.
of Haplotypes
Similarity with the Same SpeciesSimilarity with
Most Closely Related Species
S. alcesPQ900477–PQ900481352 bp297.2–100%S. gracilis 85.0–86.7 [QC = 96%]
S. capracanisPQ900482–PQ900487284 bp5 97.2–100%S. tenella 91.5–94.3%
S. capreolicanisPQ900488–PQ900498376 bp199.5–100%S. alceslatrans
95.0–95.5%
S. gracilisPQ900499–PQ900510371 bp298.7–100%S. capracanis
83.0–84.9%
S. hjortiPQ900511–PQ900520227 bp296.7–100%S. pilosa
92.5–94.3%
S. ibericaPQ900521–PQ900523207 bp199.5–100%S. venatoria
95.7–97.1%
S. linearisPQ900524–PQ900531617 bp598.5–100%S. taeniata 96.8–97.7%
S. mieshcerianaPQ900532–PQ900541315 bp398.1–100%S. rangiferi 75.6–76.9%
[QC = 96%]
S. moraePQ900542–PQ900550292 bp296.2–100%S. cervicanis 83.6–85.3%
S. tenellaPQ900551–PQ900555373 bp598.7–100%S. capracanis
91.7–93.8%
S. venatoriaPQ900556207 bp197.6–100%S. iberica
95.7–96.1%
QC—query coverage.
Table 3. Detection rates of identified Sarcocystis species in raccoon dogs.
Table 3. Detection rates of identified Sarcocystis species in raccoon dogs.
Sarcocystis
Species
Intermediate Hostn Detection Rate, %
(95% CI)
S. alcesCervidae: moose (Alces alces)519.2 (6.6–39.4)
S. capreolicanisCervidae: roe deer (Capreolus capreolus)1142.3 (23.4–63.1)
S. gracilisCervidae: roe deer 1246.2 (26.6–66.6)
S. hjortiCervidae: moose, red deer (Cervus elaphus), sika deer (Cervus nippon) 1038.5 (20.22–59.43)
S. ibericaCervidae: red deer, sika deer 311.5 (2.4–30.2)
S. linearisCervidae: moose, red deer, roe deer, sika deer, 830.8 (14.3–51.8)
S. moraeCervidae: fallow deer (Dama dama), red deer, sika deer, 934.6 (17.2–55.7)
S. venatoriaCervidae: red deer 13.9 (0.1–19.6)
S. miescherianaSuidae: pig and wild boar (Sus scrofa)1038.5 (20.2–59.4)
S. capracanisCaprinae: goat (Capra hircus), Barbary sheep (Ammotragus lervia),
European mouflon (Ovis aries musimon)
623.1 (09.0–43.7)
S. tenellaCaprinae: sheep (Ovis aries), argali (Ovis ammon), Barbary sheep,
European mouflon, Tatra chamois (Rupicapra rupicapra tatrica)
519.2 (6.6–39.4)
n—number of infected animals.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Prakas, P.; Kalashnikova, T.; Gudiškis, N.; Šneideris, D.; Juozaitytė-Ngugu, E.; Butkauskas, D. Molecular Evidence of Raccoon Dog (Nyctereutes procyonoides) as a Natural Definitive Host for Several Sarcocystis Species. Pathogens 2025, 14, 288. https://doi.org/10.3390/pathogens14030288

AMA Style

Prakas P, Kalashnikova T, Gudiškis N, Šneideris D, Juozaitytė-Ngugu E, Butkauskas D. Molecular Evidence of Raccoon Dog (Nyctereutes procyonoides) as a Natural Definitive Host for Several Sarcocystis Species. Pathogens. 2025; 14(3):288. https://doi.org/10.3390/pathogens14030288

Chicago/Turabian Style

Prakas, Petras, Tamara Kalashnikova, Naglis Gudiškis, Donatas Šneideris, Evelina Juozaitytė-Ngugu, and Dalius Butkauskas. 2025. "Molecular Evidence of Raccoon Dog (Nyctereutes procyonoides) as a Natural Definitive Host for Several Sarcocystis Species" Pathogens 14, no. 3: 288. https://doi.org/10.3390/pathogens14030288

APA Style

Prakas, P., Kalashnikova, T., Gudiškis, N., Šneideris, D., Juozaitytė-Ngugu, E., & Butkauskas, D. (2025). Molecular Evidence of Raccoon Dog (Nyctereutes procyonoides) as a Natural Definitive Host for Several Sarcocystis Species. Pathogens, 14(3), 288. https://doi.org/10.3390/pathogens14030288

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop