Molecular Evidence of Raccoon Dog (Nyctereutes procyonoides) as a Natural Definitive Host for Several Sarcocystis Species
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and Isolation of Sarcocystis spp.
2.2. Molecular Analysis
2.3. Sequence Data Analysis
2.4. Statistical Data Analysis
3. Results
3.1. Microscopical Examination of Sarcocystis spp. Sporocysts/Oocysts from the Intestines of Raccoon Dogs
3.2. Molecular Identification of Sarcocystis Species
3.3. Distribution of Sarcocystis Species in Raccoon Dog Samples Analyzed
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Dubey, J.P.; Calero-Bernal, R.; Rosenthal, B.M.; Speer, C.A.; Fayer, R. Sarcocystosis of Animals and Humans, 2nd ed.; CRC Press: Boca Raton, FL, USA, 2015; ISBN 978-0-429-18318-8. [Google Scholar]
- Sutor, A.; Schwarz, S.; Conraths, F.J. The Biological Potential of the Raccoon Dog (Nyctereutes procyonoides, Gray 1834) as an Invasive Species in Europe—New Risks for Disease Spread? Acta Theriol. 2014, 59, 49–59. [Google Scholar] [CrossRef] [Scilit]
- Jasiulionis, M.; Stirkė, V.; Balčiauskas, L. The Distribution and Activity of the Invasive Raccoon Dog in Lithuania as Found With Country-Wide Camera Trapping. Forests 2023, 14, 1328. [Google Scholar] [CrossRef] [Scilit]
- Kauhala, K.; Kowalczyk, R. Invasion of the Raccoon Dog Nyctereutes procyonoides in Europe: History of Colonization, Features Behind its Success, and Threats to Native Fauna. Curr. Zool. 2011, 57, 584–598. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kauhala, K.; Kowalczyk, R. The Raccoon Dog (Nyctereutes procyonoides) in the Community of Medium-Sized Carnivores in Europe: Its Adaptations, Impact on Native Fauna and Management of the Population. In Carnivores: Species, Conservation, and Management; Nova Publishers: Hauppauge, NY, USA, 2012. [Google Scholar]
- Kauhala, K.; Holmala, K.; Schregel, J. Seasonal Activity Patterns and Movements of the Raccoon Dog, a Vector of Diseases and Parasites, in Southern Finland. Mamm. Biol. 2007, 72, 342–353. [Google Scholar] [CrossRef] [Scilit]
- Sutor, A.; Kauhala, K.; Ansorge, H. Diet of the Raccoon Dog Nyctereutes procyonoides—A Canid with an Opportunistic Foraging Strategy. Acta Theriol. 2010, 55, 165–176. [Google Scholar] [CrossRef] [Scilit]
- Balčiauskas, L.; Stratford, J.; Balčiauskienė, L.; Kučas, A. Roadkills as a Method to Monitor Raccoon Dog Populations. Animals 2021, 11, 3147. [Google Scholar] [CrossRef] [Scilit]
- Drake, J.A. Handbook of Alien Species in Europe, 1st ed.; Springer: Dordrecht, The Netherlands, 2009; Volume 3, ISBN 978-1-4020-8279-5. [Google Scholar]
- Klingenstein, F.; Kornacker, P.M.; Martens, H.; Schippmann, U. Gebietsfremde Arten. Positionspapier des Bundesamtes für Naturschutz. Bundesamt für Naturschutz. Bonn BfN Skripten 2005, 128, 1–31. [Google Scholar]
- Torchin, M.E.; Mitchell, C.E. Parasites, Pathogens, and Invasions by Plants and Animals. Front. Ecol. Environ. 2004, 2, 183–190. [Google Scholar] [CrossRef]
- Malakauskas, A.; Paulauskas, V.; Järvis, T.; Keidans, P.; Eddi, C.; Kapel, C.M.O. Molecular Epidemiology of Trichinella spp. in Three Baltic Countries: Lithuania, Latvia, and Estonia. Parasitol. Res. 2007, 100, 687–693. [Google Scholar] [CrossRef] [Scilit]
- Kjær, L.J.; Jensen, L.M.; Chriél, M.; Bødker, R.; Petersen, H.H. The Raccoon Dog (Nyctereutes procyonoides) as a Reservoir of Zoonotic Diseases in Denmark. Int. J. Parasitol. Parasites Wildl. 2021, 16, 175–182. [Google Scholar] [CrossRef] [Scilit]
- Myśliwy, I.; Perec-Matysiak, A.; Hildebrand, J. Invasive Raccoon (Procyon lotor) and Raccoon Dog (Nyctereutes procyonoides) as Potential Reservoirs of Tick-Borne Pathogens: Data Review from Native and Introduced Areas. Parasit. Vectors 2022, 15, 126. [Google Scholar] [CrossRef] [Scilit]
- Klink, J.C.; Rieger, A.; Wohlsein, P.; Siebert, U.; Obiegala, A. Vector-Borne and Zoonotic Pathogens in Raccoon Dogs (Nyctereutes procyonoides) and Raccoons (Procyon lotor) from Schleswig-Holstein, Germany. Pathogens 2024, 13, 270. [Google Scholar] [CrossRef] [Scilit]
- Hsueh, F.-C.; Shi, K.; Mendoza, A.; Bu, F.; Zhang, W.; Aihara, H.; Li, F. Structural Basis for Raccoon Dog Receptor Recognition by SARS-CoV-2. PLoS Pathog 2024, 20, e1012204. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bružinskaitė-Schmidhalter, R.; Šarkūnas, M.; Malakauskas, A.; Mathis, A.; Torgerson, P.R.; Deplazes, P. Helminths of Red Foxes (Vulpes vulpes) and Raccoon Dogs (Nyctereutes procyonoides) in Lithuania. Parasitology 2012, 139, 120–127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Murrell, K.D.; Pozio, E. Worldwide Occurrence and Impact of Human Trichinellosis, 1986–2009. Emerg. Infect. Dis. 2011, 17, 2194–2202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tuska-Szalay, B.; Takács, N.; Kontschán, J.; Vizi, Z.; Hornok, S. Dogs are Final Hosts of Sarcocystis morae (Apicomplexa: Sarcocystidae): First Report of This Species in Hungary and Its Region–Short Communication. Acta Vet. Hung. 2021, 69, 157–160. [Google Scholar] [CrossRef] [Scilit]
- Khan, R.A.; Evans, L. Prevalence of Sarcocystis spp. in Two Subspecies of Caribou (Rangifer tarandus) in Newfoundland and Labrador, and Foxes (Vulpes vulpes), Wolves (Canis lupus), and Husky Dogs (Canis familiaris) as Potential Definitive Hosts. J. Parasitol. 2006, 92, 662–663. [Google Scholar] [CrossRef] [Scilit]
- Gupta, A.; De Araujo, L.S.; Humpal, C.; Carstensen, M.; Rosenthal, B.M.; Dubey, J.P. Molecular Confirmation of Wolf (Canis lupus) as a Natural Definitive Host for Sarcocystis cruzi of Cattle, Sarcocystis mehlhorni of Deer, and Sarcocystis wenzeli of Chickens. J. Parasitol. 2024, 110, 679–683. [Google Scholar] [CrossRef] [Scilit]
- Prakas, P.; Liaugaudaitė, S.; Kutkienė, L.; Sruoga, A.; Švažas, S. Molecular Identification of Sarcocystis rileyi Sporocysts in Red Foxes (Vulpes vulpes) and Raccoon Dogs (Nyctereutes procyonoides) in Lithuania. Parasitol. Res. 2015, 114, 1671–1676. [Google Scholar] [CrossRef] [Scilit]
- Máca, O.; Gudiškis, N.; Butkauskas, D.; González-Solís, D.; Prakas, P. Red Foxes (Vulpes vulpes) and Raccoon Dogs (Nyctereutes procyonoides) as Potential Spreaders of Sarcocystis Species. Front. Vet. Sci. 2024, 11, 1392618. [Google Scholar] [CrossRef] [Scilit]
- Dahlgren, S.S.; Gjerde, B. The Red Fox (Vulpes vulpes) and the Arctic Fox (Vulpes lagopus) are Definitive Hosts of Sarcocystis alces and Sarcocystis hjorti from Moose (Alces alces). Parasitology 2010, 137, 1547–1557. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gherman, C.M.; Mihalca, A.D. A Synoptic Overview of Golden Jackal Parasites Reveals High Diversity of Species. Parasit. Vectors 2017, 10, 419. [Google Scholar] [CrossRef] [Scilit]
- Verma, S.K.; Lindsay, D.S.; Grigg, M.E.; Dubey, J.P. Isolation, Culture and Cryopreservation of Sarcocystis Species. Curr. Protoc. Microbiol. 2017, 45, 20D.1.1–20D.1.27. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prakas, P.; Jasiulionis, M.; Šukytė, T.; Juozaitytė-Ngugu, E.; Stirkė, V.; Balčiauskas, L.; Butkauskas, D. First Observations of Buzzards (Buteo) as Definitive Hosts of Sarcocystis Parasites Forming Cysts in the Brain Tissues of Rodents in Lithuania. Biology 2024, 13, 264. [Google Scholar] [CrossRef] [Scilit]
- Heydorn, A.O.; Mehlhorn, H. Fine Structure of Sarcocystis arieticanis Heydorn, 1985 in its Intermediate and Final Hosts (Sheep and Dog). Zentralbl. Bakteriol. Mikrobiol. Hyg. A 1987, 264, 353–362. [Google Scholar] [CrossRef] [Scilit]
- Zeng, W.; Sun, L.; Xiang, Z.; Li, N.; Zhang, J.; He, Y.; Li, Q.; Yang, F.; Song, J.; Morris, J.; et al. Morphological and Molecular Characteristics of Sarcocystis bertrami from Horses and Donkeys in China. Vet. Parasitol. 2018, 252, 89–94. [Google Scholar] [CrossRef] [Scilit]
- Gjerde, B.; de La Fuente, C.; Alunda, J.M.; Luzón, M. Molecular Characterisation of Five Sarcocystis Species in Domestic Sheep (Ovis aries) from Spain. Parasitol. Res. 2020, 119, 215–231. [Google Scholar] [CrossRef] [Scilit]
- Marandykina-Prakienė, A.; Butkauskas, D.; Gudiškis, N.; Juozaitytė-Ngugu, E.; Bagdonaitė, D.L.; Kirjušina, M.; Calero-Bernal, R.; Prakas, P. Sarcocystis Species Richness in Sheep and Goats from Lithuania. Vet. Sci. 2023, 10, 520. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dahlgren, S.S.; Gjerde, B. Sarcocystis in Moose (Alces alces): Molecular Identification and Phylogeny of Six Sarcocystis Species in Moose, and a Morphological Description of Three New Species. Parasitol. Res. 2008, 103, 93–110. [Google Scholar] [CrossRef] [Scilit]
- Gjerde, B.; Giacomelli, S.; Bianchi, A.; Bertoletti, I.; Mondani, H.; Gibelli, L.R. Morphological and Molecular Characterization of Four Sarcocystis spp., Including Sarcocystis linearis n. sp., from Roe Deer (Capreolus capreolus) in Italy. Parasitol. Res. 2017, 116, 1317–1338. [Google Scholar] [CrossRef] [Scilit]
- Gjerde, B.; Luzón, M.; Alunda, J.M.; de La Fuente, C. Morphological and Molecular Characteristics of Six Sarcocystis spp. from Red Deer (Cervus elaphus) in Spain, Including Sarcocystis cervicanis and Three New Species. Parasitol. Res. 2017, 116, 2795–2811. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dahlgren, S.S.; Gjerde, B. Molecular Characterization of Five Sarcocystis Species in Red Deer (Cervus elaphus), Including Sarcocystis hjorti n. sp., Reveals That These Species are Not Intermediate Host Specific. Parasitology 2010, 137, 815–840. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prakas, P.; Butkauskas, D.; Rudaitytė, E.; Kutkienė, L.; Sruoga, A.; Pūraitė, I. Morphological and Molecular Characterization of Sarcocystis taeniata and Sarcocystis pilosa n. sp. From the Sika Deer (Cervus nippon) in Lithuania. Parasitol. Res. 2016, 115, 3021–3032. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gjerde, B. Morphological and Molecular Characteristics of Four Sarcocystis spp. in Canadian Moose (Alces alces), Including Sarcocystis taeniata n. sp. Parasitol. Res. 2014, 113, 1591–1604. [Google Scholar] [CrossRef] [Scilit]
- Coelho, C.; Gomes, J.; Inácio, J.; Amaro, A.; Mesquita, J.R.; Pires, I.; Lopes, A.P.; Vieira-Pinto, M. Unraveling Sarcocystis miescheriana and Sarcocystis suihominis Infections in Wild Boar. Vet. Parasitol. 2015, 212, 100–104. [Google Scholar] [CrossRef] [Scilit]
- Gjerde, B. Phylogenetic Relationships among Sarcocystis Species in Cervids, Cattle and Sheep Inferred from the Mitochondrial Cytochrome c Oxidase Subunit I Gene. Int. J. Parasitol. 2013, 43, 579–591. [Google Scholar] [CrossRef] [Scilit]
- Marandykina-Prakienė, A.; Butkauskas, D.; Gudiškis, N.; Juozaitytė-Ngugu, E.; Januškevičius, V.; Rudaitytė-Lukošienė, E.; Prakas, P. Molecular Identification of Sarcocystis Species in Sheep from Lithuania. Animals 2022, 12, 2048. [Google Scholar] [CrossRef] [Scilit]
- Baranauskaitė, A.; Strazdaitė-Žielienė, Ž.; Servienė, E.; Butkauskas, D.; Prakas, P. Molecular Identification of Protozoan Sarcocystis in Different Types of Water Bodies in Lithuania. Life 2022, 13, 51. [Google Scholar] [CrossRef] [Scilit]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic Local Alignment Search Tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [Scilit]
- Reiczigel, J.; Marozzi, M.; Fábián, I.; Rózsa, L. Biostatistics for Parasitologists—A Primer to Quantitative Parasitology. Trends Parasitol. 2019, 35, 277–281. [Google Scholar] [CrossRef] [Scilit]
- Nummi, P.; Väänänen, V.-M.; Pekkarinen, A.-J.; Eronen, V.; Nurmi, J.; Rautiainen, A.; Rusanen, P. Alien Predation in Wetlands the Raccoon Dog and Waterbird Breeding Success. Balt. For. 2019, 25, 228–237. [Google Scholar] [CrossRef] [Scilit]
- Prūsaitė, J. Lithuanian Fauna. Mammals; Mokslas: Vilnius, Lithuania, 1988. [Google Scholar]
- Saito, M.; Itagaki, H. Experimental Infection of Raccoon Dogs with Sarcocystis cruzi and S. miescheriana. J. Vet. Med. Sci. 1994, 56, 671–674. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kubo, M.; Okano, T.; Ito, K.; Tsubota, T.; Sakai, H.; Yanai, T. Muscular Sarcocystosis in Wild Carnivores in Honshu, Japan. Parasitol. Res. 2009, 106, 213–219. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dubey, J.P. Experimental Infections of Sarcocystis cruzi, Sarcocystis tenella, Sarcocystis capracanis and Toxoplasma gondii in Red Foxes (Vulpes vulpes). J. Wildl. Dis. 1983, 19, 200–203. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wee, S.-H.; Shin, S.-S. Experimental Induction of the Two-Host Life Cycle of Sarcocystis cruzi between Dogs and Korean Native Calves. Korean J. Parasitol. 2001, 39, 227. [Google Scholar] [CrossRef] [Scilit]
- Butcher, M.; Lakritz, J.; Halaney, A.; Branson, K.; Gupta, G.D.; Kreeger, J.; Marsh, A.E. Experimental Inoculation of Domestic Cats (Felis domesticus) with Sarcocystis neurona or S. neurona-like Merozoites. Vet. Parasitol. 2002, 107, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Prakas, P.; Balčiauskas, L.; Juozaitytė-Ngugu, E.; Butkauskas, D. The Role of Mustelids in the Transmission of Sarcocystis spp. Using Cattle as Intermediate Hosts. Animals 2021, 11, 822. [Google Scholar] [CrossRef] [Scilit]
- Elshahawy, I.S.; Fawaz, M.; Gomaa, A.; Mohammed, E. Prevalence and First Molecular Identification of Sarcocystis Species in Feces of Domestic Dogs (Canis familiaris) in Egypt. BMC Vet. Res. 2023, 19, 278. [Google Scholar] [CrossRef] [Scilit]
- Šneideris, D.; Moskaliova, D.; Butkauskas, D.; Prakas, P. The Distribution of Sarcocystis Species Described by Ungulates-Canids Life Cycle in Intestines of Small Predators of the Family Mustelidae. Acta Parasit. 2024, 69, 747–758. [Google Scholar] [CrossRef] [Scilit]
- Xiang, Z.; Chen, X.; Yang, L.; He, Y.; Jiang, R.; Rosenthal, B.M.; Luan, P.; Attwood, S.W.; Zuo, Y.; Zhang, Y.; et al. Non-Invasive Methods for Identifying Oocysts of Sarcocystis spp. from Definitive Hosts. Parasitol. Int. 2009, 58, 293–296. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moré, G.; Maksimov, A.; Conraths, F.J.; Schares, G. Molecular Identification of Sarcocystis spp. in Foxes (Vulpes vulpes) and Raccoon Dogs (Nyctereutes procyonoides) from Germany. Vet. Parasitol. 2016, 220, 9–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Basso, W.; Alvarez Rojas, C.A.; Buob, D.; Ruetten, M.; Deplazes, P. Sarcocystis Infection in Red Deer (Cervus elaphus) with Eosinophilic Myositis/Fasciitis in Switzerland and Involvement of Red Foxes (Vulpes vulpes) and Hunting Dogs in the Transmission. Int. J. Parasitol. Parasit. Wildl. 2020, 13, 130–141. [Google Scholar] [CrossRef] [Scilit]
- Scioscia, N.P.; Olmos, L.; Gorosábel, A.; Bernad, L.; Pedrana, J.; Hecker, Y.P.; Gual, I.; Laura Gos, M.; Denegri, G.M.; Moore, D.P.; et al. Pampas Fox (Lycalopex gymnocercus) New Intermediate Host of Sarcocystis svanai (Apicomplexa: Sarcocystidae). Parasitol. Int. 2017, 66, 214–218. [Google Scholar] [CrossRef] [Scilit]
- Fleming, P.J.S.; Nolan, H.; Jackson, S.M.; Ballard, G.-A.; Bengsen, A.; Brown, W.Y.; Meek, P.D.; Mifsud, G.; Pal, S.K.; Sparkes, J. Roles for the Canidae in Food Webs Reviewed: Where Do They Fit? Food Webs 2017, 12, 14–34. [Google Scholar] [CrossRef] [Scilit]
- Baltrūnaitė, L. Diet and Winter Habitat Use of the Red Fox, Pine Marten and Raccoon Dog in Dzūkija National Park, Lithuania. Acta Zool. Litu. 2006, 16, 46–53. [Google Scholar] [CrossRef] [Scilit]
- Drygala, F.; Zoller, H. Diet Composition of the Invasive Raccoon Dog (Nyctereutes procyonoides) and the Native Red Fox (Vulpes vulpes) in North-East Germany. Hystrix 2014, 24, 190–194. [Google Scholar] [CrossRef] [Scilit]
- Gjerde, B. The Raccoon Dog (Nyctereutes procyonoides) as Definitive Host for Sarcocystis spp. of Reindeer (Rangifer tarandus). Acta Vet. Scand. 1984, 25, 419–424. [Google Scholar] [CrossRef] [Scilit]
- Máca, O. Molecular Identification of Sarcocystis lutrae (Apicomplexa: Sarcocystidae) from the Raccoon Dog, Nyctereutes procyonoides, and the Common Raccoon, Procyon lotor, in the Czech Republic. Parasit. Vectors 2020, 13, 231. [Google Scholar] [CrossRef] [Scilit]
- Heydorn, A.O. Beiträge zum Lebenszyklus der Sarkosporidien. IX. Entwicklungszyklus von Sarcocystis suihominis n. spec. Berl. Münch Tierärztl. Wochenschr. 1977, 90, 218–224. [Google Scholar]
- Heydorn, A.O.; Gestrich, R.; Janitschke, K. Beiträge zum Lebenszyklus der Sarkosporidien. VIII. Sporozysten von Sarcocystis bovihominis in den Fäzes von Rhesusaffen (Macaca rhesus) und Pavianen (Papio cynocephalus). Berl. Münch Tierärztl. Wochenschr. 1976, 89, 116–120. [Google Scholar] [PubMed]
- Dubey, J.P.; Van Wilpe, E.; Calero-Bernal, R.; Verma, S.K.; Fayer, R. Sarcocystis heydorni, n. sp. (Apicomplexa: Sarcocystidae) with Cattle (Bos taurus) and Human (Homo sapiens) Cycle. Parasitol. Res. 2015, 114, 4143–4147. [Google Scholar] [CrossRef] [Scilit]
- Ota, T.; Nakano, Y.; Mizuno, T.; Shiozaki, A.; Hori, Y.; Yamanishi, K.; Hayakawa, K.; Hayakawa, T.; Fujimoto, T.; Nakamoto, C.; et al. First Case Report of Possible Sarcocystis truncata-Induced Food Poisoning in Venison. Intern. Med. 2019, 58, 2727–2730. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kamata, Y.; Saito, M.; Irikura, D.; Yahata, Y.; Ohnishi, T.; Bessho, T.; Inui, T.; Watanabe, M.; Sugita-Konishi, Y. A Toxin Isolated from Sarcocystis fayeri in Raw Horsemeat May Be Responsible for Food Poisoning. J. Food Prot. 2014, 77, 814–819. [Google Scholar] [CrossRef] [Scilit]
- Irikura, D.; Saito, M.; Sugita-Konishi, Y.; Ohnishi, T.; Sugiyama, K.I.; Watanabe, M.; Yamazaki, A.; Izumiyama, S.; Sato, H.; Kimura, Y.; et al. Characterization of Sarcocystis fayeri’s Actin-Depolymerizing Factor as a Toxin that Causes Diarrhea. Genes Cells 2017, 22, 825–835. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heckeroth, A.R.; Tenter, A.M. Development and Validation of Species-Specific Nested PCRs for Diagnosis of Acute Sarcocystiosis in Sheep. Int. J. Parasitol. 1999, 29, 1331–1349. [Google Scholar] [CrossRef] [Scilit]
- Dessì, G.; Tamponi, C.; Pasini, C.; Porcu, F.; Meloni, L.; Cavallo, L.; Sini, M.F.; Knoll, S.; Scala, A.; Varcasia, A. A Survey on Apicomplexa Protozoa in Sheep Slaughtered for Human Consumption. Parasitol. Res. 2022, 121, 1437–1445. [Google Scholar] [CrossRef] [Scilit]
- Yan, W.; Qian, W.; Li, X.; Wang, T.; Ding, K.; Huang, T. Morphological and Molecular Characterization of Sarcocystis miescheriana from Pigs in the Central Region of China. Parasitol. Res. 2013, 112, 975–980. [Google Scholar] [CrossRef] [Scilit]
- Amairia, S.; Amdouni, Y.; Rouatbi, M.; Rjeibi, M.R.; Awadi, S.; Gharbi, M. First Detection and Molecular Identification of Sarcocystis spp. in Small Ruminants in North-West Tunisia. Transbound. Emerg. Dis. 2017, 65, 441–446. [Google Scholar] [CrossRef] [Scilit]
- Mustonen, A.; Asikainen, J.; Kauhala, K.; Paakkonen, T.; Nieminen, P. Seasonal Rhythms of Body Temperature in the Free-ranging Raccoon Dog (Nyctereutes procyonoides) with Special Emphasis on Winter Sleep. Chronobiol. Int. 2007, 24, 1095–1107. [Google Scholar] [CrossRef] [Scilit]
- Kowalczyk, R.; Jędrzejewska, B.; Zalewski, A.; Jędrzejewski, W. Facilitative Interactions Between the Eurasian Badger (Meles meles), the Red Fox (Vulpes vulpes), and the Invasive Raccoon Dog (Nyctereutes procyonoides) in Białowieża Primeval Forest, Poland. Can. J. Zool. 2008, 86, 1389–1396. [Google Scholar] [CrossRef] [Scilit]
- Süld, K.; Valdmann, H.; Laurimaa, L.; Soe, E.; Davison, J.; Saarma, U. An Invasive Vector of Zoonotic Disease Sustained by Anthropogenic Resources: The Raccoon Dog in Northern Europe. PLoS ONE 2014, 9, e96358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baltrūnaitė, L. Winter Habitat Use, Niche Breadth and Overlap Between the Red Fox, Pine Marten and Raccoon Dog in Different Landscapes of Lithuania. Folia Zool. 2010, 59, 278–284. [Google Scholar] [CrossRef] [Scilit]
- Reshamwala, H.S.; Mahar, N.; Dirzo, R.; Habib, B. Successful Neighbour: Interactions of the Generalist Carnivore Red Fox with Dogs, Wolves and Humans for Continued Survival in Dynamic Anthropogenic Landscapes. Glob. Ecol. Conserv. 2021, 25, e01446. [Google Scholar] [CrossRef] [Scilit]
- Janeiro-Otero, A.; Newsome, T.M.; Van Eeden, L.M.; Ripple, W.J.; Dormann, C.F. Grey Wolf (Canis lupus) Predation on Livestock in Relation to Prey Availability. Biol. Conserv. 2020, 243, 108433. [Google Scholar] [CrossRef] [Scilit]




| Species | Primer Name | Sequence | Reference |
|---|---|---|---|
| 1st step | |||
| Sarcocystis spp. | SF1 | ATGGCGTACAACAATCATAAAGAA | Dubey, 2013 [39] |
| SsunR3 | CCGTTGGWATGGCRATCAT | Marandykina-Prakienė et al., 2022 [40] | |
| 2nd step | |||
| S. alces | V2alc3 | CCTAGGTACCGTGCTCTTTGATG | Present study |
| V2alc4 | CTTCGAGGCCAGTAGTTACCATA | ||
| S. arieticanis | Arie7F | TAATTTCCTCGGTACTGTACTGTTTG | Marandykina-Prakienė et al., 2023 [31] |
| Arie7R | TACTTACGCATTGCGATATTACG | ||
| S. bertrami | V2ber7 | CCCCACTCAGTACGAACTCC | Baranauskaitė et al., 2022 [41] |
| V2ber8 | ACTGCGATATAACTCCAAAACCA | ||
| S. capracanis | V2ca3 | ATACCGATCTTTACGGGAGCAGTA | Marandykina-Prakienė et al., 2023 [31] |
| V2ca4 | GGTCACCGCAGAGAAGTACGAT | ||
| S. capreolicanis | V2capreo1 | CATCGTAGAGCCCCGTACTC | Present study |
| V2capreo2 | ACCGCTATACGCTGGAGCTG | ||
| S. cruzi | V2cr7 | CAATGTGCTGTTTACGCTCCA | |
| V2cr8 | TCGTACAGGCCCGTAGTTAG | ||
| S. gracilis | V2gr9 | GTGCTCGGGGCAGTGAAC | |
| V2gr10 | GCCAGTAGTCATCATGTGGTGT | ||
| S. hjorti | V2hjo1 | AAGGTACACGGCATTGTTCAC | |
| V2hjo2 | GAAAACTACCCTGCCGCCTA | ||
| S. iberica S. venatoria | V2ibeven1 | ATGGGCCATTATATTTACTGCTCTG | |
| V2ibeven2 | GCCGCCAAAAACTACCTTACC | ||
| S. miescheriana | V2mie5 | TCCTCGGTATTAGCAGCGTACTG | Baranauskaitė et al., 2022 [41] |
| V2mie6 | ATTGAAGGGCCACCAAACAC | ||
| S. morae | V2mor1 | GTGTGCTTGGATCGGTCAAC | Marandykina-Prakienė et al., 2023 [31] |
| V2mor2 | GCCGAATACCGGCTTACTTC | ||
| S. pilosa | V2pil3 | GTTAATTTCCTGGGCACAGTGTT | Present study |
| V2pil4 | CGAAAACTACTCTGCCGCCTAC | ||
| S. taeniata S. linearis | V2taelin1 | CGTAGACTGCATGACGACTTACAA | |
| V2taelin2 | CAAAGATGGATTTGCTGCCTA | ||
| S. tenella | Ten8F | ATACCGCTCTACGCTGGATCTAC | Marandykina-Prakienė et al., 2023 [31] |
| Ten8R | TACCGCTCTACGCTGGATCTAC | ||
| Sarcocystis Species | GenBank Acc. No. | The Length of the Fragment | No. of Haplotypes | Similarity with the Same Species | Similarity with Most Closely Related Species |
|---|---|---|---|---|---|
| S. alces | PQ900477–PQ900481 | 352 bp | 2 | 97.2–100% | S. gracilis 85.0–86.7 [QC = 96%] |
| S. capracanis | PQ900482–PQ900487 | 284 bp | 5 | 97.2–100% | S. tenella 91.5–94.3% |
| S. capreolicanis | PQ900488–PQ900498 | 376 bp | 1 | 99.5–100% | S. alceslatrans 95.0–95.5% |
| S. gracilis | PQ900499–PQ900510 | 371 bp | 2 | 98.7–100% | S. capracanis 83.0–84.9% |
| S. hjorti | PQ900511–PQ900520 | 227 bp | 2 | 96.7–100% | S. pilosa 92.5–94.3% |
| S. iberica | PQ900521–PQ900523 | 207 bp | 1 | 99.5–100% | S. venatoria 95.7–97.1% |
| S. linearis | PQ900524–PQ900531 | 617 bp | 5 | 98.5–100% | S. taeniata 96.8–97.7% |
| S. mieshceriana | PQ900532–PQ900541 | 315 bp | 3 | 98.1–100% | S. rangiferi 75.6–76.9% [QC = 96%] |
| S. morae | PQ900542–PQ900550 | 292 bp | 2 | 96.2–100% | S. cervicanis 83.6–85.3% |
| S. tenella | PQ900551–PQ900555 | 373 bp | 5 | 98.7–100% | S. capracanis 91.7–93.8% |
| S. venatoria | PQ900556 | 207 bp | 1 | 97.6–100% | S. iberica 95.7–96.1% |
| Sarcocystis Species | Intermediate Host | n |
Detection Rate, % (95% CI) |
|---|---|---|---|
| S. alces | Cervidae: moose (Alces alces) | 5 | 19.2 (6.6–39.4) |
| S. capreolicanis | Cervidae: roe deer (Capreolus capreolus) | 11 | 42.3 (23.4–63.1) |
| S. gracilis | Cervidae: roe deer | 12 | 46.2 (26.6–66.6) |
| S. hjorti | Cervidae: moose, red deer (Cervus elaphus), sika deer (Cervus nippon) | 10 | 38.5 (20.22–59.43) |
| S. iberica | Cervidae: red deer, sika deer | 3 | 11.5 (2.4–30.2) |
| S. linearis | Cervidae: moose, red deer, roe deer, sika deer, | 8 | 30.8 (14.3–51.8) |
| S. morae | Cervidae: fallow deer (Dama dama), red deer, sika deer, | 9 | 34.6 (17.2–55.7) |
| S. venatoria | Cervidae: red deer | 1 | 3.9 (0.1–19.6) |
| S. miescheriana | Suidae: pig and wild boar (Sus scrofa) | 10 | 38.5 (20.2–59.4) |
| S. capracanis | Caprinae: goat (Capra hircus), Barbary sheep (Ammotragus lervia), European mouflon (Ovis aries musimon) | 6 | 23.1 (09.0–43.7) |
| S. tenella | Caprinae: sheep (Ovis aries), argali (Ovis ammon), Barbary sheep, European mouflon, Tatra chamois (Rupicapra rupicapra tatrica) | 5 | 19.2 (6.6–39.4) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Prakas, P.; Kalashnikova, T.; Gudiškis, N.; Šneideris, D.; Juozaitytė-Ngugu, E.; Butkauskas, D. Molecular Evidence of Raccoon Dog (Nyctereutes procyonoides) as a Natural Definitive Host for Several Sarcocystis Species. Pathogens 2025, 14, 288. https://doi.org/10.3390/pathogens14030288
Prakas P, Kalashnikova T, Gudiškis N, Šneideris D, Juozaitytė-Ngugu E, Butkauskas D. Molecular Evidence of Raccoon Dog (Nyctereutes procyonoides) as a Natural Definitive Host for Several Sarcocystis Species. Pathogens. 2025; 14(3):288. https://doi.org/10.3390/pathogens14030288
Chicago/Turabian StylePrakas, Petras, Tamara Kalashnikova, Naglis Gudiškis, Donatas Šneideris, Evelina Juozaitytė-Ngugu, and Dalius Butkauskas. 2025. "Molecular Evidence of Raccoon Dog (Nyctereutes procyonoides) as a Natural Definitive Host for Several Sarcocystis Species" Pathogens 14, no. 3: 288. https://doi.org/10.3390/pathogens14030288
APA StylePrakas, P., Kalashnikova, T., Gudiškis, N., Šneideris, D., Juozaitytė-Ngugu, E., & Butkauskas, D. (2025). Molecular Evidence of Raccoon Dog (Nyctereutes procyonoides) as a Natural Definitive Host for Several Sarcocystis Species. Pathogens, 14(3), 288. https://doi.org/10.3390/pathogens14030288

