Infestation Pattern and Population Dynamics of the Tropical Bed Bug, Cimex hemipterus (F.) (Hemiptera: Cimicidae) Based on Novel Microsatellites and mtDNA Markers
Abstract
1. Introduction
2. Materials and Methods
2.1. Bed Bugs Collection
2.2. 454 Pyrosequencing
2.3. Microsatellite Detection and Primer Design
2.4. Characterization of Microsatellite Markers and Genotyping
2.5. Microsatellite Data Analyses
2.6. Mitochondrial DNA Analyses
3. Results
3.1. Development and Characterization of Microsatellite Markers
3.2. Population Genetics Analyses Based on the Microsatellite Markers
3.3. MtDNA Analyses
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Doggett, S.L.; Miller, D.M.; Lee, C.Y. Introduction. In Advances in the Biology and Management of Modern Bed Bugs; Doggett, S.L., Miller, D.M., Lee, C.Y., Eds.; Wiley-Blackwell: London, UK, 2018. [Google Scholar]
- Usinger, R.L. Monograph of Cimicidae (Hemiptera-Heteroptera); Thomas Say Foundation: Annapolis, MD, USA, 1966; Volume 7. [Google Scholar]
- Hwang, S.; Svoboda, W.T.J.; de Jong, I.J.; Kabasele, K.J.; Gogosis, E. Bed bug infestations in an urban environment. Emerg. Infect. Dis. 2005, 11, 533–538. [Google Scholar] [CrossRef] [Scilit]
- Delaunay, P.; Blanc, V.; Giudice, P.D.; Levy-Becheton, A.; Chosidow, O.; Marty, P.; Brouqui, P. Bedbugs and infectious diseases. Clin. Infect. Dis. 2011, 52, 200–210. [Google Scholar] [CrossRef] [Scilit]
- Doggett, S.L.; Dwyer, D.E.; Penas, P.F.; Russell, R.C. Bed bugs: Clinical relevance and control options. Clin. Microbiol. Rev. 2012, 25, 164–192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leulmi, H.; Bitam, I.; Berenger, J.M.; Lepidi, H.; Rolain, J.M.; Almeras, L.; Raoult, D.; Parola, P. Competence of Cimex lectularius bed bugs for the transmission of Bartonella quintana, the agent of trench fever. PLoS Negl. Trop. Dis. 2015, 9, e0003789. [Google Scholar] [CrossRef] [Scilit]
- Salazar, R.; Castillo-Neyra, R.; Tustin, A.W.; Borrini-Mayori, K.; Naquira, C.; Levy, M.Z. Bed bugs (Cimex lectularius) as vectors of Trypanosoma cruzi. Am. J. Trop. Med. Hyg. 2015, 92, 331–335. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, C.Y.; Doggett, S.L.; Miller, D.M. Chemical control. In Advances in the Biology and Management of Modern Bed Bugs; Doggett, S.L., Miller, D.M., Lee, C.Y., Eds.; Wiley-Blackwell: London, UK, 2018. [Google Scholar]
- Dang, K.; Doggett, S.L.; Veera Singham, G.; Lee, C.Y. Insecticide resistance and resistance mechanisms in bed bugs, Cimex spp. (Hemiptera: Cimicidae). Parasit. Vectors. 2017, 10, 1–31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Romero, A. Insecticide resistance. In Advances in the Biology and Management of Modern Bed Bugs; Doggett, S.L., Miller, D.M., Lee, C.Y., Eds.; Wiley-Blackwell: London, UK, 2018. [Google Scholar]
- How, Y.F.; Lee, C.Y. Survey of bed bugs in infested premises in Malaysia and Singapore. J. Vector. Ecol. 2010, 35, 89–94. [Google Scholar] [CrossRef] [Scilit]
- Tawatsin, A.; Thavara, U.; Chompoosri, J.; Phusup, Y.; Jonjang, N.; Khumsawads, C.; Bhakdeenuan, P.; Sawanpanyalert, P.; Asavadachanukorn, P.; Mulla, M.S.; et al. Insecticide resistance in bedbugs in Thailand and laboratory evaluation of insecticides for the control of Cimex hemipterus and Cimex lectularius (Hemiptera: Cimicidae). J. Med. Entomol. 2011, 48, 1023–1030. [Google Scholar] [CrossRef] [Scilit]
- Khan, H.R.; Rahman, M.M. Morphology and biology of the bed bugs, Cimex hemipterus (Hemiptera: Cimicidae) in the laboratory. J. Biol. Sci. 2012, 21, 125–130. [Google Scholar] [CrossRef] [Scilit]
- Leong, X.Y.; Kim, D.Y.; Dang, K.; Veera Singham, G.; Doggett, S.L.; Lee, C.Y. Performance of commercial insecticides formulations against different developmental stages of insecticide-resistant tropical bed bugs (Hemiptera: Cimicidae). J. Econ. Entomol. 2020, 113, 353–366. [Google Scholar] [CrossRef] [Scilit]
- Newberry, K. Production of a hybrid between the bedbugs Cimex hemipterus and Cimex lectularius. Med. Vet. Entomol. 1988, 2, 297–300. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Doggett, S.L.; Geary, M.J.; Crowe, W.J.; Wilson, P.; Russell, R.C. Has the tropical bed bug, Cimex hemipterus (Hemiptera: Cimicidae), invaded Australia? J. Environ. Health. 2003, 3, 80–82. [Google Scholar]
- Lee, C.Y. Bed Bugs in Asia-Perspective from Southeast Asia; Presented at the Global Bed Bug Summit: Denver, CO, USA, 2013. [Google Scholar]
- Campbell, B.E.P.; Koehler, G.; Buss, L.J.; Baldwin, R.W. Recent documentation of the tropical bed bug (Hemiptera: Cimicidae) in Florida since the common bed bug resurgence. Fla. Entomol. 2016, 99, 549–551. [Google Scholar] [CrossRef] [Scilit]
- Komatsu, N.; Shirakawa, A.; Nakamura, H.; Fujii, K. Distribution of tropical bedbug Cimex hemipterus in Tokyo, Japan. Med. Entomol. Zool. 2018, 69, 95–98. [Google Scholar] [CrossRef] [Scilit]
- Szalanski, A.L.; Austin, J.W.; McKern, J.A.; Steelman, C.D.; Gold, R.E. Mitochondrial and ribosomal internal transcribed spacer 1 diversity of Cimex lectularius (Hemiptera: Cimicidae). Genetics 2008, 45, 229–236. [Google Scholar] [CrossRef]
- Booth, W.; Saenz, V.L.; Santangelo, R.G.; Wang, C.; Schal, C.; Vargo, E.L. Molecular markers reveal infestation dynamics of the bed bug (Hemiptera: Cimicidae) within apartment buildings. J. Med. Entomol. 2012, 49, 535–546. [Google Scholar] [CrossRef] [Scilit]
- Saenz, V.L.; Booth, W.; Schal, C.; Vargo, E.L. Genetic analysis of bed bug populations reveals small propagule size within individual infestations but high genetic diversity across infestations from the Eastern United States. J. Med. Entomol. 2012, 49, 865–875. [Google Scholar] [CrossRef] [Scilit]
- Akhoundi, M.; Kegne, P.; Cannet, A.; Brengues, C.; Berenger, J.M.; Izri, A.; Marty, P.; Simard, F.; Fontenille, D.; Delaunay, P. Spatial genetic structure and restricted gene flow in bed bugs (Cimex lectularius) populations in France. Infect. Genet. Evol. 2015, 34, 236–243. [Google Scholar] [CrossRef] [Scilit]
- Narain, R.B.; Latihambika, S.; Ksamble, S.T. Genetic variability and geographic diversity of the common bed bug (Hemiptera: Cimicidae) populations from the Midwest using microsatellite markers. J. Med. Entomol. 2015, 52, 566–572. [Google Scholar] [CrossRef] [Scilit]
- Fountain, T.; Duvaux, L.; Horsburgh, G.; Reinhardt, K.; Butlin, R.K. Human-facilitated metapopulation dynamics in an emerging pest species, Cimex lectularius. Mol. Ecol. 2014, 23, 1071–1084. [Google Scholar] [CrossRef] [Scilit]
- Masran, S.N.A.S.; Majid, A.H.A. Population genetic structure and breeding pattern of Cimex hemipterus (F.) (Hemiptera: Cimicidae) in Malaysia. J. Med. Entomol. 2019, 56, 942–952. [Google Scholar] [CrossRef] [Scilit]
- Reinhardt, K.; Siva-Jothy, M.T. Biology of the bed bugs (Cimicidae). Annu. Rev. Entomol. 2007, 52, 351–374. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- How, Y.F.; Lee, C.Y. Effects of temperature and humidity on survival and water loss of Cimex hemipterus (Hemiptera: Cimicidae). J. Med. Entomol. 2010, 47, 987–995. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dang, K.; Toi, C.S.; Lilly, D.G.; Lee, C.Y.; Naylor, R.; Tawatsin, A.; Thavara, U.; Wu, B.; Dogget, S.L. Identification of putative kdr mutations in the tropical bed bug, Cimex hemipterus (Hemiptera: Cimicidae). Pest. Manag. Sci. 2015, 71, 1015–1020. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, D.; Billen, J.; Doggett, S.L.; Lee, C.Y. Differences in climbing ability between Cimex lectularius and Cimex hemipterus (Hemiptera: Cimicidae). J. Econ. Entomol. 2017, 110, 1179–1186. [Google Scholar] [CrossRef] [Scilit]
- Gardner, M.G.; Fitch, A.J.; Bertozzi, T.; Lowe, A.J. Rise of the machines—Recommendations for ecologists when using the next generation sequencing for microsatellite development. Mol. Ecol. Resour. 2011, 11, 1093–1101. [Google Scholar] [CrossRef] [Scilit]
- Avise, J.C. Molecular Markers, Natural History and Evolution, 2nd ed.; Sinauer Inc.: Sunderland, MA, USA, 2004. [Google Scholar]
- Faircloth, B.C. MSATCOMMANDER: Detection of microsatellite repeat arrays and automated, locus-specific primer design. Mol. Ecol. Resour. 2008, 8, 92–94. [Google Scholar] [CrossRef] [Scilit]
- Rozen, S.; Skaletsky, H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. 2000, 132, 365–386. [Google Scholar] [CrossRef] [Scilit]
- Veera Singham, G.; Othman, A.S.; Vargo, E.L.; Booth, W.; Lee, C.Y. Polymorphic microsatellite loci from an indigenous Asian fungus-growing termite, Macrotermes gilvus (Blattodea: Termitidae) and cross amplification in related taxa. Environ. Entomol. 2012, 41, 426–431. [Google Scholar] [CrossRef] [Scilit]
- Excoffier, L.; Laval, G.; Schneider, S. ARLEQUIN ver. 3.01: An integrated software package for population genetics data analysis. Evol. Bioinform. 2005, 1, 47–50. [Google Scholar] [CrossRef] [Scilit]
- Van Oosterhout, C.V.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. MICRO- CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar] [CrossRef] [Scilit]
- Goudet, J. FSTAT (Version 1.2): A computer program to computer note computer program to calculate F-statistics. J. Hered. 1995, 86, 485–486. [Google Scholar] [CrossRef] [Scilit]
- Queller, D.C.; Goodnight, K.F. Estimating relatedness using genetic markers. Evolution 1989, 43, 258–275. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, J. COANCESTRY: A program for simulating, estimating and analyzing relatedness and inbreeding coefficients. Mol. Ecol. Resour. 2011, 11, 141–145. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Corrander, J.A.; Marttinen, P.; Siren, J.; Tang, J. Enhanced Bayesian modelling in BAPS software for learning genetic structure of populations. BMC Bioinform. 2008, 9, 539. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vargo, E.L.; Crissmann, J.R.; Booth, W.; Santangelo, R.G.; Mukha, D.V.; Schal, C. Hierarchical genetic analysis of German cockroach (Blatella germanica) populations from within buildings to across continents. PLoS ONE 2014, 9, e102321. [Google Scholar] [CrossRef] [Scilit]
- Addinsoft. XLSTAT-Statistics Package for Excel. Available online: https://www.xlstat.com (accessed on 22 January 2020).
- Luikart, G.; Allendorf, F.W.; Cornuet, J.M.; Sherwin, W.B. Distortion of allele frequency distributions provides a test for recent population bottlenecks. J. Hered. 1998, 89, 238–247. [Google Scholar] [CrossRef] [Scilit]
- Balvin, O.; Munclinger, P.; Kratochvil, L.; Vílímová, J. Mitochondrial DNA and morphology show independent evolutionary histories of bedbug Cimex lectularius (Heteroptera: Cimicidae) on bats and humans. Parasitol. Res. 2012, 111, 457–469. [Google Scholar] [CrossRef] [Scilit]
- Kambhampati, S.; Smith, P.T. PCR primers for the amplification of four insect mitochondrial gene fragments. Insect Mol. Biol. 1995, 44, 233–236. [Google Scholar] [CrossRef] [Scilit]
- Simon, C.; Frati, F.; Beckenbach, A.; Crespi, B.; Liu, H.; Flook, P. Evolution, weighting and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann. Entomol. Soc. Am. 1994, 87, 651–701. [Google Scholar] [CrossRef] [Scilit]
- Veera Singham, G.; Othman, A.S.; Lee, C.Y. Phylogeography of the termite Macrotermes gilvus and insight into ancient dispersal corridors in Pleistocene Southeast Asia. PLoS ONE 2017, 12, e0186690. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Farris, J.S.; Källersjö, M.; Kluge, A.G.; Bult, C. Testing significance of incongruence. Cladistics 1994, 10, 315–319. [Google Scholar] [CrossRef]
- Swofford, D.L. PAUP*. In Phylogenetic Analysis Using Parsimony and Other Methods Version 4; Sinauer Associates: Sunderland, UK, 2003. [Google Scholar]
- Rozas, J.; Ferrer-Mata, A.; Sánchez-DelBarrio, J.C.; Guirao-Rico, S.; Librado, P.; Ramos-Onsins, S.E.; Sánches-Gracia, A. DnaSP 6: DNA sequence polymorphism analysis of large datasets. Mol. Biol. Evol. 2017, 34, 3299–3302. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. jModelTest 2: More models, new heuristics and parallel computing. Nat. Methods 2012, 9, 772. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bandelt, H.J.; Foster, P.; Rohl, A. Median-joining networks for inferring intraspecific phylogenies. Mol. Biol. Evol. 1999, 6, 37–38. [Google Scholar] [CrossRef] [Scilit]
- Chakraborty, R.; Fuerst, P.A.; Nei, M. Statistical studies on protein polymorphism in natural populations III. Distribution of allele frequencies and the number of alleles per locus. Genetics 1980, 94, 1039–1063. [Google Scholar] [PubMed]
- Nei, M.; Maruyama, T.; Chakraborty, R. The bottleneck effect and genetic variability in populations. Evolution 1975, 29, 1–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Taylor, H.R. The use and abuse of genetic marker-based estimates of relatedness and inbreeding. Ecol. Evol. 2015, 15, 3140–3150. [Google Scholar] [CrossRef] [Scilit]
- Hillis, D.M.; Bull, J.J. An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. Syst. Biol. 1993, 42, 182–192. [Google Scholar] [CrossRef] [Scilit]
- Mellanby, K. The physiology and activity of the bedbug (Cimex letularius L.) in a natural infestation. J. Parasitol. 1939, 31, 200–211. [Google Scholar] [CrossRef] [Scilit]
- Pfiester, M.; Koehler, P.G.; Pereira, R.M. Sexual conflict to the extreme: Traumatic insemination in bed bugs. Entomol. Am. 2009, 55, 244–249. [Google Scholar] [CrossRef] [Scilit]
- How, Y.F.; Lee, C.Y. Effects of life-stages and feeding regimes on active movement behavior of the tropical bed bug, Cimex hemipterus (Hemiptera: Cimicidae). J. Med. Entomol. 2010, 47, 305–312. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Newberry, K.; Mchunu, Z.M.; Cebekhulu, S.Q. Bedbug reinfestation rates in rural Africa. Med. Vet. Entomol. 1991, 5, 503–505. [Google Scholar] [CrossRef] [Scilit]
- Boase, C. Bedbugs—Back from the brink. Pest Manag. Sci. 2001, 12, 159–162. [Google Scholar] [CrossRef] [Scilit]
- Hentley, W.T.; Webster, B.; Evison, S.F.E.; Siva-Jothy, M.T. Bed bug aggregation on dirty laundry: A mechanism for passive dispersal. Sci. Rep. 2017, 7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Keller, L.F.; Waller, D.M. Inbreeding effects in wild populations. Trends Ecol. Evol. 2002, 17, 230–241. [Google Scholar] [CrossRef] [Scilit]
- Charlesworth, B.; Charlesworth, D. The genetic basis of inbreeding depression. Genet. Res. 1999, 74, 329–340. [Google Scholar] [CrossRef] [Scilit]
- Facon, B.; Hufbauer, R.A.; Tayeh, A.; Loiseau, A.; Lombaert, E.; Vitalis, R.; Guillemaud, T.; Lundgren, J.G.; Estoup, A. Inbreeding depression is purged by the invasive insect Harmonia axyridis. Curr. Biol. 2011, 2, 424–427. [Google Scholar] [CrossRef] [Scilit]
- Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef] [Scilit]
- Primmer, C.R.; Ellegren, H.; Saino, N.; Møller, A.P. Directional evolution in germline microsatellite mutations. Nat. Genet. 1996, 3, 391–393. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Robison, G.A.; Balvin, O.; Schal, C.; Vargo, E.L.; Booth, W. Extensive mitochondrial heteroplasmy in natural populations of a resurging human pest, the bed bug (Hemiptera: Cimicidae). J. Med. Entomol. 2015, 52, 734–738. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mastrantonio, V.; Latrofa, M.S.; Porretta, D.; Lia, R.P.; Parisi, A.; Latta, R.; Dantas-Torres, F.; Otranto, D.; Urbanelli, S. Paternal leakage and mtDNA heteroplasmy in Rhipicephalus spp. ticks. Sci. Rep. 2019, 9, 1460. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cariou, M.; Duret, L.; Charlat, S. The global impact of Wolbachia on mitochondrial diversity and evolution. J. Evol. Biol. 2017, 30, 2204–2210. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hosokawa, T.; Koga, R.; Kikuchi, Y.; Meng, X.Y.; Fukatsu, T. Wolbachia as a bacteriocyte-associated nutritional mutualist. Proc. Natl. Acad. Sci. USA 2010, 107, 769–774. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Balvin, O.; Roth, S.; Talbot, B.; Reindhart, K. Co-speciation in bedbug Wolbachia parallel the pattern in nematode host. Sci. Rep. 2018, 8, 1–9. [Google Scholar] [CrossRef] [Scilit]



| Population ID | Longitude | Latitude | Type of Infestation Unit | City, Country | mtDNA Haplotypes a |
|---|---|---|---|---|---|
| BMV | 1°17′04″ N | 103°49′23″ E | Private residence | Bukit Merah, Singapore | Hap05 (5) |
| TPL | 1°20′08″ N | 103°51′12″ E | Private residence | Toa Payoh, Singapore | Hap03 (5) |
| CC | 1°19′39″ N | 103°55′37″ E | Private residence | Bedok, Singapore | Hap01 (5) |
| MJ | 3°09’05.7″ N | 101°41’46.5″ E | Hotel | Jalan Melayu, Kuala Lumpur, Malaysia | Hap01 (5) |
| LVKL | 3°08’41.6″ N | 101°41’51.5″ E | Backpacker’s hostel | Jalan Petaling, Kuala Lumpur, Malaysia | Hap01 (2), Hap02 (1), Hap04 (2) |
| FKL | 3°08’39.6″ N | 101°41’44.7″ E | Backpacker’s hostel | Jalan Hang Kasturi, Kuala Lumpur, Malaysia | Hap01 (2), Hap06 (3) |
| BLD | 5°19’57.3″ N | 100°17’39.8″ E | Worker’s hostel | Bayan Lepas, Penang, Malaysia | Hap01 (5) |
| TT | 5°27’2″ N | 100°18’24″ E | Private residence | Tanjung Tokong, Penang, Malaysia | Hap01 (4), Hap07 (1) |
| BLA | 5°19’49″ N | 100°17’36″ E | Private residence | Bayan Lepas, Penang, Malaysia | Hap04 (5) |
| JT | 5°25’04.7″ N | 100°19’46.0″ E | Worker’s hostel | Georgetown, Penang, Malaysia | Hap01 (5) |
| NI | 5°20’27.6″ N | 100°18’06.7″ E | Worker’s hostel | Bayan Lepas, Penang, Malaysia | Hap01 (2), Hap04 (3) |
| PJ | 5°20’18.1″ N | 100°18’09.1″ E | Worker’s hostel | Gelugor, Penang, Malaysia | Hap01 (3), Hap04 (2) |
| MC | 5°24’12.2″ N | 100°20’03.4″ E | Private residence | Georgetown, Penang, Malaysia | Hap01 (5) |
| BM | 5°18’48.6″ N | 100°27’42.6″ E | Worker’s hostel | Bukit Mertajam, Penang, Malayisa | Hap01 (5) |
| SJ | 5°23’08.4″ N | 100°24’21.7″ E | Private residence | Seberang Perai, Penang, Malaysia | Hap04 (5) |
| BPT | 5°13’25.8″ N | 103°06’27.8″ E | Private residence | Bukit Payong, Terengganu, Malaysia | Hap04 (5) |
| KJO | 1°39’06.3″ N | 103°36’58.4″ E | Worker’s hostel | Kulai, Johor, Malaysia | Hap01 (5) |
| PJO | 1°22’08.5″ N | 104°06’25.9″ E | Worker’s hostel | Pengerang, Johor, Malaysia | Hap01 (5) |
| Locus | Primer Sequences (5′–3′) | Repeat Motif | Locus Size (bp) | NA | PIC | HE | HO |
|---|---|---|---|---|---|---|---|
| Bhe27 | GGGCTGATGAAGAAATATAGCAC GGGTTGGGTAAGTTGTGGC | (CT)8 | 385 | 6 | 0.51 | 0.42 | 0.32 |
| Bhe14 | GGAGTTGTTGGGTTAAGGAGTG TCATTCAGGCGATCAAGCC | (ATT)10 | 162 | 7 | 0.74 | 0.64 | 0.56 |
| Bhe34 | TGGGATGTGCAATGTGACC AATGACAGGCCCGAAGTCC | (ATC)6 | 252 | 5 | 0.04 | 0.16 | 0.11 |
| Bhe07 | GCAGTCAAAGACAGTTAGCC GTTGTGGCGTTGTTACGGG | (AC)9 | 310 | 6 | 0.53 | 0.50 | 0.44 |
| Bhe38 | TCGCCTTACACTTCTCGTAG TTTGCATCCCGCTACCCTG | (AAAT)5 | 384 | 6 | 0.55 | 0.52 | 0.46 |
| Bhe40 | CCTTGCCATATCAGCACGTT TGGTGTAATGAACGACCTCTGG | (AAT)16 | 171 | 12 | 0.79 | 0.56 | 0.45 |
| Bhe12 | AACGGATTGGCCTATGAGC CGCACTTGAATAAACAGCCG | (AG)13 | 315 | 8 | 0.81 | 0.61 | 0.50 |
| Bhe22 | ACTCATTTAGGCTCCAGCAAC TGTATCGCGTAGACCCGC | (CT)8 | 331 | 4 | 0.35 | 0.35 | 0.07 |
| Mean | 6.75 | 0.54 | 0.47 | 0.36 |
| Pop | N | HO | HE | HWE | G–W | FIS | r (SEM) | A |
|---|---|---|---|---|---|---|---|---|
| JT | 20 | 0.64 | 0.66 | Bhe27 | 0.12 | 0.47 | 0. 361 (0.016) | 3.75 |
| BLD | 20 | 0.52 | 0.55 | Bhe22 | 0.13 | 0.06 | 0.124 (0.019) | 3.88 |
| NI | 17 | 0.36 | 0.47 | - | 0.09 | 0.23 | 0.494 (0.018) | 2.63 |
| MC | 20 | 0.41 | 0.49 | Bhe22 | 0.10 | 0.17 | 0.390 (0.016) | 2.88 |
| BM | 20 | 0.40 | 0.49 | Bhe22 | 0.13 | 0.18 | 0.326 (0.019) | 3.88 |
| SJ | 17 | 0.33 | 0.60 | Bhe14, Bhe38, Bhe40 | 0.10 | 0.46 | 0.295 (0.019) | 3.13 |
| BLA | 20 | 0.34 | 0.49 | Bhe07, Bhe22 | 0.10 | 0.31 | 0.320 (0.020) | 3.13 |
| TT | 20 | 0.29 | 0.40 | Bhe22 | 0.10 | 0.27 | 0.361 (0.020) | 3.00 |
| PJ | 20 | 0.35 | 0.55 | Bhe12 | 0.09 | 0.37 | 0.331 (0.019) | 2.75 |
| BPT | 20 | 0.35 | 0.37 | - | 0.06 | 0.06 | 0.844 (0.007) | 1.88 |
| FKL | 20 | 0.45 | 0.52 | Bhe22 | 0.11 | 0.14 | 0.226 (0.019) | 3.25 |
| MJ | 20 | 0.44 | 0.55 | Bhe07, Bhe22 | 0.11 | 0.22 | 0.231 (0.017) | 3.25 |
| LVKL | 20 | 0.36 | 0.42 | - | 0.10 | 0.13 | 0.495 (0.017) | 3.13 |
| KJO | 20 | 0.23 | 0.38 | Bhe40, Bhe12 | 0.09 | 0.40 | 0.358 (0.020) | 2.63 |
| PJO | 17 | 0.29 | 0.45 | - | 0.09 | 0.36 | 0.342 (0.019) | 2.63 |
| TPL | 20 | 0.27 | 0.44 | Bhe14, Bhe22 | 0.10 | 0.39 | 0.444 (0.020) | 3.13 |
| CC | 20 | 0.30 | 0.41 | Bhe07, Bhe38 | 0.10 | 0.28 | 0.495 (0.017) | 3.13 |
| BMV | 20 | 0.71 | 0.62 | Bhe22 | 0.11 | −0.15 | 0.275 (0.019) | 3.25 |
| Mean | 19.5 | 0.39 | 0.49 | - | 0.10 | 0.24 | 0.373 (0.018) | 3.07 |
| Source of Variation | df | Sum of Square | Variance Component | Total Variance (%) | Fixation Index | p-Value |
|---|---|---|---|---|---|---|
| Among populations | 17 | 740.65 | 1.03 | 28.50 | FST = 0.28 | <0.001 |
| Among individuals within populations | 333 | 1088.86 | 0.68 | 18.67 | FIS = 0.26 | <0.001 |
| Within individuals | 351 | 672.50 | 1.92 | 52.83 | FIT = 0.46 | <0.001 |
| Cluster | Infestation Unit | Proportion of Admixture (Total Sample) |
|---|---|---|
| 1 | BMV | 0 (20) |
| 2 | TPL | 0 (20) |
| 3 | CC | 0 (20) |
| 4 | MJ | 0.05 (20) |
| 5 | LVKL | 0 (20) |
| 6 | FKL | 0 (20) |
| 7 | BLD | 0.05 (20) * |
| 8 | TT | 0 (20) |
| 9 | BLA | 0.10 (20) * |
| 10 | JT | 0 (20) |
| 11 | NI | 0 (17) |
| 12 | PJ | 0 (20) |
| 13 | MC | 0 (20) |
| 14 | BM | 0 (20) |
| 15 | SJ | 0 (17) |
| 16 | BPT | 0 (20) |
| 17 | KJO | 0 (20) |
| PJO | 0 (17) |
| mtDNA Sequence | n | h | Hd | π (k) | θs | θg |
|---|---|---|---|---|---|---|
| COI | 90 | 5 | 0.483 ± 0.049 | 0.00095 (0.546) | 0.00171 | 0.986 |
| 16S rRNA | 90 | 3 | 0.168 ± 0.052 | 0.00051 (0.171) | 0.00118 | 0.394 |
| COI + 16S rRNA | 90 | 7 | 0.593 ± 0.046 | 0.00079 (0.718) | 0.00152 | 1.380 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wan Mohammad, W.N.F.; Soh, L.-S.; Wan Ismail, W.N.; Veera Singham, G. Infestation Pattern and Population Dynamics of the Tropical Bed Bug, Cimex hemipterus (F.) (Hemiptera: Cimicidae) Based on Novel Microsatellites and mtDNA Markers. Insects 2020, 11, 472. https://doi.org/10.3390/insects11080472
Wan Mohammad WNF, Soh L-S, Wan Ismail WN, Veera Singham G. Infestation Pattern and Population Dynamics of the Tropical Bed Bug, Cimex hemipterus (F.) (Hemiptera: Cimicidae) Based on Novel Microsatellites and mtDNA Markers. Insects. 2020; 11(8):472. https://doi.org/10.3390/insects11080472
Chicago/Turabian StyleWan Mohammad, Wan Nur Fatanah, Li-Shen Soh, Wan Nurainie Wan Ismail, and G. Veera Singham. 2020. "Infestation Pattern and Population Dynamics of the Tropical Bed Bug, Cimex hemipterus (F.) (Hemiptera: Cimicidae) Based on Novel Microsatellites and mtDNA Markers" Insects 11, no. 8: 472. https://doi.org/10.3390/insects11080472
APA StyleWan Mohammad, W. N. F., Soh, L.-S., Wan Ismail, W. N., & Veera Singham, G. (2020). Infestation Pattern and Population Dynamics of the Tropical Bed Bug, Cimex hemipterus (F.) (Hemiptera: Cimicidae) Based on Novel Microsatellites and mtDNA Markers. Insects, 11(8), 472. https://doi.org/10.3390/insects11080472

