Skip to Content
LifeLife
  • Article
  • Open Access

17 April 2025

Transient Overexpression of the Pepper WRKY2 Gene in Nicotiana benthamiana Markedly Delays the Systemic Necrosis Caused by Tobacco Mosaic Virus

,
,
,
and
Plant Protection Institute, HUN-REN Centre for Agricultural Research, Fehérvári Str. 132-144, 1116 Budapest, Hungary
*
Author to whom correspondence should be addressed.
This article belongs to the Section Plant Science

Abstract

The role of WRKY transcription factor proteins in plant defense reactions against fungal and bacterial pathogens is well studied, but less information is available about plant–virus interactions. We observed the rapid and strong activation of the transcription factor gene, CaWRKY2, in pepper leaves following inoculation with Obuda pepper virus (ObPV). In contrast, CaWRKY2 was only weakly induced by pepper mild mottle virus (PMMoV) inoculation. To carry out a functional analysis of CaWRKY2, the gene was transiently overexpressed in Nicotiana benthamiana leaves by agroinfiltration. Four days later, CaWRKY2-overexpressing and empty vector control leaves were inoculated with tobacco mosaic virus (TMV). Transiently overexpressing CaWRKY2 did not affect the replication rate of TMV in the inoculated leaves. However, TMV inoculation up-regulated the expression of a pathogenesis-related gene (NbPR-1b) and a lipoxygenase (NbLOX1) gene significantly more strongly in N. benthamiana leaves overexpressing CaWRKY2 than in empty vector control leaves. Intriguingly, CaWRKY2 overexpression delayed (by 3 days) the development of systemic necrosis and plant death caused by TMV in N. benthamiana. These results suggest that CaWRKY2 is able to hinder the spread of TMV from inoculated leaves towards vascular tissues and systemic leaves in N. benthamiana.

1. Introduction

In virus-infected plants, numerous biochemical defense reactions are activated. If these reactions are robust and rapid, virus infection is unsuccessful (incompatible interaction or resistance). In resistant plants, the invading virus is rapidly perceived by cell surface receptors or by resistance proteins (R-proteins) [1]. Upon recognition, signals are transmitted to the nucleus mainly by kinase cascades, leading to the extensive reprogramming of gene expression patterns and ultimately to the production of antimicrobial proteins and metabolites [2,3]. On the other hand, during compatible plant–virus interactions (in susceptible plants), only late and weak host defense reactions occur, which allow the rapid multiplication and systemic spreading of the virus [4,5].
The reprogramming of host plant transcriptome is regulated by a complex, multilayered regulatory network in which various transcription factors play critical roles [6]. WRKY transcription factors are promising research targets due to their involvement in various plant–pathogen interactions [7,8,9]. WRKYs are encoded by large multigene families in plants. Their protein sequences contain one or two characteristic Trp-Arg-Lys-Tyr (WRKY) amino acid motif(s) and zinc finger motif(s). WRKYs are classified into three groups, and the large one, group II, is further divided into five subgroups according to the number of WRKY motifs and the type of zinc finger motifs they have [7,10]. WRKYs specifically recognize and bind to the W-box motif [canonical sequence: (C/T)TGAC(C/T)] or to its variants within the promoters of target genes [7,11]. The binding of WRKY proteins to the promoters of their numerous target genes can positively or negatively regulate their transcription. Intriguingly, W-box DNA elements can also constitutively be occupied by WRKY proteins in untreated plants [12].
In pepper (Capsicum annuum L.), the role of WRKYs has been extensively studied. The genome-wide identification of pepper WRKY genes has been carried out by several research groups, which caused some trouble in the nomenclature of WRKYs. In different reports, 71, 61, 62, and 72 WRKY genes were identified in the pepper genome [13,14,15,16]. Considerable attention has been focused on the role of WRKYs during different pepper–tobamovirus interactions due to the economic importance of these viruses. The early up-regulation of WRKY-a, WRKY-b, and WRKY-d genes was observed during the incompatible interaction between pepper and the P0 strain of tobacco mosaic virus (TMV) [17,18,19]. In addition, the marked induction of CaWRKY1 and CaWRKY2 genes was observed during the incompatible interaction between Capsicum chinense harboring the L3 resistance gene and the P1,2 pathotype of pepper mild mottle virus (PMMoV) [20,21]. In compatible interactions between pepper and tobamoviruses, the induction of WRKY genes was usually negligible [17,19]. Functional studies that elucidate the exact role of pepper WRKYs are scarce. Gene silencing experiments proved that WRKY-a, WRKY-b, and WRKY-d are positive regulators of antiviral defense [8,18,19]. On the other hand, the overexpression of CaWRKY1 in transgenic Nicotiana tabacum cv. Xanthi-nc (genotype NN) plants resulted in diminished resistance against TMV [21].
Previously, we found that the inoculation of pepper leaves with Obuda pepper virus (ObPV) led to the appearance of hypersensitive necrotic lesions, while a PMMoV strain caused only very mild chlorotic symptoms [22,23]. ObPV strongly induced the expression of fatty acid desaturase, lipoxygenase, and divinyl ether synthase genes [24,25,26]. In addition, ObPV led to a strong accumulation of defense hormones [27] and elevated glucose, fructose, and glucose-6-phosphate levels [28]. Recently, we carried out a transcriptome-wide RNA-Seq gene expression analysis in ObPV- and PMMoV-inoculated pepper leaves. This analysis revealed that numerous pepper genes encoding transcription factors, including several WRKYs, especially the CaWRKY2 gene, were strongly up-regulated by ObPV.
The present study was conducted with the aim of gaining a more detailed picture of the role of CaWRKY2 in plant–virus interactions. Firstly, we measured the effects of ObPV and PMMoV on the expression of CaWRKY2 in infected pepper leaves. We also carried out a functional analysis of the CaWRKY2 gene by its transient overexpression in N. benthamiana. In leaves transiently expressing the CaWRKY2 gene, we measured the TMV multiplication rate and the expression of defense-related genes. In addition, we investigated the effect of CaWRKY2 overexpression on TMV induced systemic necrosis.

2. Materials and Methods

2.1. Plants and Virus Inoculations

Seeds of the pepper (Capsicum annuum L.) cultivar TL 1791 harboring the L3 resistance gene [29] were planted into soil and grown under greenhouse conditions (25 °C; photoperiod of 16 h; 160 μmol m−2 s−1 radiation; relative humidity of 75–80%). Two-month-old plants were used for the experiments. ObPV and PMMoV inoculations of pepper leaves were carried out as described earlier [22,23]. The ObPV strain was isolated in Hungary (formerly used synonym: Ob strain of tomato mosaic virus) (GenBank L11665 and NC_003852) [22]. The L3-resistance-breaking strain of PMMoV was isolated in Louisiana, USA (formerly used synonym: Samsun latent strain of tobacco mosaic virus) [22,30]. The genome of this PMMoV strain has not been sequenced yet. Mock inoculations were also carried out as controls (treatment without any virus to test the effect of the slight mechanical injury caused during virus inoculation). Following inoculations, the plants were kept in a growth chamber at 22 °C with a 16 h photoperiod. Total RNA content was extracted from pepper leaves at 4, 8, 24, 48, and 72 h post-inoculation (hpi) from the virus-inoculated leaves and from the corresponding mock-inoculated control leaves.
N. benthamiana plants were grown in a greenhouse for six weeks, and they were used to perform the transient overexpression of CaWRKY2 by agroinfiltration. Four days after agroinfiltration, three middle leaves of CaWRKY2-overexpressing plants as well as of control plants carrying an empty expression vector were inoculated with the TMV-U1 strain. No abrasive was necessary for successful infection. In parallel experiments, N. benthamiana plants were also mock inoculated. TMV-infected and mock-inoculated control plants were kept in a growth chamber at 22 °C with 16/8 h light/dark cycles. Total RNA was extracted from N. benthamiana leaves after various time periods in all treatments.

2.2. RNA Extraction and Gene Expression Analysis by RT-PCR

Total RNA was extracted from infected and control pepper or N. benthamiana leaves. Leaf tissues (0.1 g) were ground under liquid nitrogen and RNA was extracted with an RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). Reverse transcription (RT) of 2.5 μg total RNA was carried out with a RevertAid H Minus First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Waltham, MA, USA) using an oligo(dT) primer. For the RT-PCR measurement of TMV coat protein gene transcript, RT was carried out with the reverse primer of the specific primer pair designed for the TMV coat protein gene (Table 1). PCRs were conducted with a PTC 200 DNA Engine extended with an ALS-1296 sample holder (Bio-Rad, Hercules, CA, USA) as described earlier [25]. The oligonucleotide primer pairs used in our studies are shown in Table 1. In the experiments with N. benthamiana, the expression of an actin gene served as a constitutive control (Table 1). Relatively low cycle numbers (22–28 cycles) were used to maintain initial differences in target transcript amounts (semiquantitative PCR conditions). Following PCR, 1% agarose gel was used to separate the reaction products, and GelRed nucleic acid stain (Biotium, Hayward, CA, USA) was used to visualize the products.
Table 1. Sequences of primer pairs in 5′ to 3′ directions used for semi-quantitative PCR and qPCR investigations. Gene identification numbers are shown in parenthesis (databases: NCBI and Solanaceae Genomics Network).

2.3. Analysis of Gene Expression Using Quantitative Real-Time RT-qPCR

To quantify the changes in CaWRKY2 expression in virus-inoculated pepper leaves, RT-qPCR assays were conducted by using a DNA Engine Opticon 2 instrument (MJ Research, Waltham, MA, USA). The qPCR reaction mixture contained 2.5 μL of 10-fold diluted cDNA (0.75 μL of 5 μM), 0.375 μM of each primer (Table 1), and the iQ SYBR Green 2× Supermix (Bio -Rad, Hercules, CA, USA) in a final volume of 15 μL. The reaction parameters were as follows: initial denaturation at 95 °C for 6 min; and then 40 cycles of 95 °C for 30 s; 30 s at specific annealing temperatures, then 72 °C for 30 s; and finally, measurement of the fluorescence intensity of SYBRGreen dye at 84 °C for 15 s. After qPCR, the specificity of the product was checked by detecting a melting curve from 55 °C to 90 °C. The pepper ubiquitin-conjugating enzyme 3 gene (CaUBI-3) was selected as the housekeeping control gene (Table 1). Alterations in transcript abundance were calculated using the method of Livak and Schmittgen [33].
Changes in gene expression levels in CaWRKY2-overexpressing and control N. benthamiana leaves were analyzed by qPCR as described above. Specific primers are shown in Table 1. An actin gene served as a constitutive, housekeeping control gene (Table 1). All analyses were carried out in three independent experiments.

2.4. The Construction of Gateway Vectors Carrying the CaWRKY2 Gene

We constructed an entry vector and subsequently an expression vector carrying the CaWRKY2 gene (1647 bp) by using the Gateway vector system (Figure S1, Thermo Fisher Scientific, Waltham, MA, USA) [34,35,36]. As a first step, the open reading frame (ORF) of CaWRKY2 (GenBank: DQ402421), including the stop codon, was amplified by RT-PCR using an ORF-specific primer pair (5′ WRKY2-OSP: GGAGATAGAACCATGGCTGCTTCAAGTTTCTCAT, 3′ WRKY2-OSP: CCTCCGGATCCTCAGCAAAGCAATGACTCCATA). These primers contain CaWRKY2-specific sequences (highlighted in bold letters) and linker sequences (normal letters) [37]. In this RT-PCR, total RNA extracted from ObPV-inoculated pepper leaves at 72 hpi was used. The PCR program consisted of using a temperature of 94 °C for 3 min, and then 35 cycles as follows: 94 °C for 1 min, annealing temperature (55 °C) for 1 min, 72 °C for 3 min, and finally, incubation at 72 °C for 10 min. The PCR product (the CaWRKY2 gene flanked by linker sequences) was separated on 0.5% agarose gel, purified by a Gene JET Gel Extraction Kit (Thermo Fisher Scientific, Waltham, MA, USA), and the resulting DNA sample was used as template for a second PCR.
The second PCR reaction was carried out with a universal primer pair (uni attB primers) containing linker sequences as well as specific adapter sequences (attB sites), which allow for the insertion of CaWRKY2 into a Gateway vector (5′ uni attB1: GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGAAGGAGATAGAACCATG, 3′ uni attB2: GGGGACCACTTTGTACAAGAAAGCTGGGTCACCGCCTCCGGATC). The attB sites are highlighted in bold letters, while the linker sequences are underlined. The PCR program consisted of using a temperature of 94 °C for 5 min, and then 35 cycles as follows: 94 °C for 1 min, annealing temperature (55 °C) for 1 min, 72 °C for 3 min, and finally, incubation at 72 °C for 10 min. The product of the second PCR reaction (the CaWRKY2 gene flanked by two attB sites) was separated on a 0.5% agarose gel and purified. Next, the entry vector (pENTR) was constructed by transferring the product of the second PCR into the Gateway pDONR ZEO vector carrying two attP sites by using the Gateway BP clonase II enzyme mix (Thermo Fisher Scientific, Waltham, MA, USA). After recombination of the matching attB and attP sites, the CaWRKY2 gene was flanked by two attL sites within the entry vector. The vector plasmids were introduced into competent Escherichia coli cells (TOP10 strain). The E. coli cells were spread on low-salt LB agar medium containing zeocin and incubated at 37 °C overnight, and then the positive colonies were selected by colony PCR with the plasmid-specific M13 primer pair (Table 1). The PCR program consisted of using a temperature of 94 °C for 2 min, and then 25 cycles as follows: 94 °C for 0:45 min, 52 °C for 0:45 min, 72 °C for 2:30 min, and finally, incubation at 72 °C for 10 min. From the positive E. coli TOP10 colonies, the entry vector plasmids carrying the CaWRKY2 gene were purified by MiniPrep Express Matrix (MP Biomedicals, Irvine, CA, USA). The purified plasmid carrying CaWRKY2 was sequenced to verify the cloning product.
From the purified entry vector, the CaWRKY2 gene was shuttled into the pEarleyGate 100 vector carrying two attR sites (destination vector, pDEST) by using the Gateway LR clonase II enzyme mix (Thermo Fisher Scientific, Waltham, MA, USA). This vector contains CaMV 35S constitutive promoter (cauliflower mosaic virus 35S RNA promoter) and OCS terminator (Octopine synthase terminator). After recombination of the matching attL and attR sites, CaWRKY2 was again flanked by attB sites in the resulting expression vector [34,36]. The success of cloning was verified by PCR, and the expression vector plasmid was introduced into competent E. coli cells using heat shock and then propagated and purified as described above. For ‘empty vector’ control plants, the empty pEarlyGate 100 vector was used without CaWRKY2.

2.5. Agroinfiltration of N. benthamiana Leaves

Purified plasmids carrying the expression vector containing the CaWRKY2 gene as well as the empty expression vector as control were transferred into A. tumefaciens by electroporation. The A. tumefaciens LBA4404 strains carrying the plasmid pEarleyGate 100 containing CaWRKY2 or the empty expression vector were grown overnight on LB plates at 27 °C supplemented with appropriate antibiotics. The bacteria were suspended in infiltration buffer (1.95 g MES (2-[N-morpholino]ethanesulfonicacid) and 2 g MgCl2.6 H2O in 1 L distilled water, pH 5.6). Bacterial cell densities were adjusted with a spectrophotometer to an optical density of 0.4 at 600 nm (OD600) and supplemented with acetosyringone (final concentration 150 µM). After three hours of incubation at room temperature, the bacterial suspensions were injected into plant leaves using a needleless syringe.
Three middle leaves of two-month-old N. benthamiana plants were infiltrated with A. tumefaciens carrying the plasmid containing CaWRKY2 as well as with A. tumefaciens carrying the empty expression vector. The transformed plants were kept in growth chambers at 22 °C with 16 h illumination/8 h dark conditions. For gene expression studies, total RNA was extracted from the transformed leaves at various time periods after transformation.

2.6. Statistical Analysis

Generally, three independent biological experiments were carried out. Numerical data represent the mean of three independent parallel experiments ± standard error. The significant difference between mean values obtained in virus-inoculated and mock-inoculated control leaves were evaluated by Student’s t-test. Differences were considered to be significant at p < 5%.

3. Results

3.1. The Effects of ObPV and PMMoV on the Expression of CaWRKY2 in Infected Pepper Leaves

The ObPV inoculation of pepper leaves resulted in the appearance of necrotic lesions (hypersensitive reaction) at 3 days post-inoculation, while PMMoV-inoculated leaves showed no visible symptoms, in accordance with earlier studies [22,23]. Total RNA was extracted from ObPV-, PMMoV-, and mock-inoculated pepper leaves at 4, 8, 24, 48, and 72 hpi, and changes in the expression of CaWRKY2 were analyzed by RT-qPCR. ObPV inoculation led to a significant induction of CaWRKY2 expression at 24 hpi, and the expression gradually rose further, reaching a 28-fold increase at 72 hpi as compared to the mock control (Figure 1). In contrast, PMMoV caused only a late and weak increase in CaWRKY2 expression (7-fold induction at 72 hpi), while mock inoculation did not show any effect (Figure 1). These results are in accordance with our earlier RNA-Seq results [5].
Figure 1. The effects of Obuda pepper virus (ObPV), pepper mild mottle virus (PMMoV), and mock-inoculations on the transcript abundance of the CaWRKY2 gene in inoculated pepper leaves at various time points following inoculation as detected by RT-qPCR with the specific primer pair CaWRKY2 (Table 1). The expression of a ubiquitin gene (UBI-3) was examined as a control housekeeping gene. The PCR conditions and GenBank accession numbers of all genes are shown in Table 1. The open, gray, and black columns represent mock-, ObPV-, and PMMoV-inoculated leaves, respectively. The mean values of three independent experiments ± SD are shown. The symbols *, **, and *** show significant differences between mock- and virus-inoculated plants at p < 5%, < 1%, and < 0.1%, respectively.

3.2. Overexpression of CaWRKY2 in Transformed N. benthamiana Leaves

We constructed a Gateway expression vector containing the entire coding sequence of CaWRKY2, including its stop codon. The PCR products were cloned into the pEarleyGate 100 vector driven by the constitutive CaMV 35S promoter. The A. tumefaciens strain carrying the CaWRKY2 gene was infiltrated into the leaves of mature N. benthamiana plants. To verify the success of this genetic transformation, total RNA was isolated from N. benthamiana leaves transformed with the vector carrying CaWRKY2 or the empty expression vector at various time points after transformation.
By using the total RNA extracts, RT-qPCR analyses were carried out to detect the expression of CaWRKY2. The RT-qPRC experiments showed that CaWRKY2 was strongly expressed 3 days after agroinfiltration; the expression remained high from 3 to 6 days, and then it sharply fell at 7 and 10 days (Figure 2). No CaWRKY2 expression was observed in the N. benthamiana leaves transformed with the empty expression vector. These results indicate that transient gene expression was successful even though we did not use any silencing suppressor because we wanted to infect the transformed leaves by TMV in later experiments.
Figure 2. Expression of CaWRKY2 gene in transiently transformed N. benthamiana leaves. CaWRKY2 expression detected by RT-qPCR 3–10 days after agroinfiltration with specific primer pair CaWRKY2rt (Table 1). Means of three independent parallel experiments ± SD are shown.

3.3. TMV Inoculation of N. benthamiana Leaves Expressing CaWRKY2

Leaves of N. benthamiana plants transformed with an expression vector carrying CaWRKY2 or with an empty expression vector were infected with the TMV-U1 strain 4 days after agroinfiltration. In parallel control experiments, mock inoculations were also performed. Upon TMV inoculation, diffuse necrotic areas appeared on the inoculated leaves 3 days post-inoculation (dpi), in accordance with earlier observations [38]. Later, the virus spread into the vascular tissues, resulting in the bending of the plant stem. Ultimately, systemic necrosis developed, which led to plant death at 7 dpi, as described earlier [38]. The transient overexpression of CaWRKY2 did not significantly affect the number of necrotic lesions on the TMV-inoculated leaves (results not shown). There were no visible lesions on the mock-inoculated leaves.
In the next experiments, we wanted to examine whether the multiplication rate of TMV in the inoculated N. benthamiana leaves is modified by the transient overexpression of the CaWRKY2 gene. Four days after agroinfiltration, the leaves expressing CaWRKY2 or carrying the empty vector were inoculated with TMV, and the replication rates of TMV were compared between the two treatments at various time points after TMV inoculation. TMV replication was monitored by measuring the transcript abundance of the TMV coat protein gene (CP) by semi-quantitative RT-PCR using the specific primer pair TMV-CP (Table 1). The transcript abundance of TMV-CP markedly increased from 1 dpi to 4 dpi in both the CaWRKY2-overexpressing and empty control leaves (Figure 3). However, the overexpression of CaWRKY2 did not alter the multiplication of TMV in the inoculated N. benthamiana leaves (Figure 3). The expression of the constitutive control actin gene was not modified by TMV either (Figure 3).
Figure 3. The monitoring of TMV replication in N. benthamiana leaves overexpressing CaWRKY2 and in control leaves carrying an empty expression vector at various time points after TMV inoculation. The expression of the coat protein gene (CP) of TMV was detected by RT-PCR with the specific primer pair TMV-CP (Table 1). The expression of an actin was also detected as a constitutive control gene. The representative results of three independent parallel experiments are shown.

3.4. Induction of Defense Genes in N. benthamiana Leaves by TMV Inoculation

We wanted to explore the effects of TMV inoculation on the expression of defense genes in N. benthamiana leaves overexpressing CaWRKY2 as well as in control leaves carrying an empty expression vector. Nine defense-related N. benthamiana genes were used for the experiments: two 1-aminocyclopropane-1-carboxylate synthases (ACS2 and ACS6), two glutathione S-transferases (GSTF and GSTU1) [31], a 9-lipoxygenase (LOX1), three pathogenesis-related genes (PR-1a, PR-1b, and PR10), and a WRKY gene (WRKY1). The expression of these genes was examined by semi-quantitative RT-PCR with specific and degenerate primer pairs (Table 1). TMV inoculation markedly induced the expression of two genes (LOX1 and PR-1b) but did not significantly influence the expression of ACS2, ACS6, GSTF, GSTU1, PR-1a, PR10, and WRKY1. The expression of a tobacco actin, examined as a household control gene, was not significantly altered by either virus inoculation or by mock inoculation. The expression levels of LOX1 and PR-1b were also examined by RT-qPCR with specific primer pairs (Table 1). TMV inoculation significantly increased the expression of both genes in N. benthamiana leaves overexpressing CaWRKY2 as compared to TMV-inoculated control leaves carrying an empty expression vector (Figure 4). At 2 days post TMV inoculation, the expression of the PR-1b and LOX1 genes were 2.4-fold and 2.1-fold higher in the CaWRKY2 overexpressing leaves than in the empty vector control leaves, respectively (Figure 4). Interestingly, the expression of PR-1b was stronger in N. benthamiana leaves overexpressing CaWRKY2 than in control leaves carrying an empty expression vector, also without TMV inoculation (at 0 dpi) (Figure 4).
Figure 4. The effect of TMV inoculation on the transcript abundance of PR-1b and LOX1 genes in N. benthamiana leaves overexpressing CaWRKY2 and in empty vector control leaves at various time points after TMV inoculation, as detected by RT-qPCR. The expression values were normalized to those of the constitutive control actin gene (Table 1) and then related to empty vector leaf samples at 0 dpi. The mean values of three independent experiments ± SD are shown. The symbols * and ** show significant differences between CaWRKY2-overexpressing and empty vector control plants at p < 5% and <1%, respectively.

3.5. Effect of Overexpression of CaWRKY2 on TMV-Induced Systemic Necrosis

TMV infection is known to result in systemic necrosis, complete plant death, in N. benthamiana approx. 7 days after TMV inoculation [38]. We investigated the effect of CaWRKY2 overexpression on this rapid systemic necrosis by visual observation in six independent experiments. Although the transient expression of CaWRKY2 did not modify the local effects of TMV inoculation in the inoculated leaves, CaWRKY2 overexpression had an impact on the systemic effects of TMV. We observed a rapid systemic necrosis in the case of empty vector control N. benthamiana plants, causing complete death of the plant one week after TMV infection as expected (Figure 5). However, intriguingly, the transient overexpression of CaWRKY2 delayed the systemic necrosis by about 3 days, and plant death occurred approximately 10 days post TMV inoculation (Figure 5). Nevertheless, the transient overexpression of CaWRKY2 was not able to prevent TMV-inoculated systemic death at later time points. No local or systemic symptoms were observed in the mock-inoculated plants.
Figure 5. Systemic necrosis caused by TMV inoculation in N. benthamiana plants transformed with CaWRKY2 gene or with empty expression vector at 7, 8, and 9 days after TMV inoculation (dpi). TMV inoculation was performed on three previously agroinfiltrated leaves. Experiment was performed in six replicates with same results.

4. Discussion

Transcriptional reprogramming in virus-infected plants is an essential element of their resistance to viruses. This process is largely mediated by transcription factor proteins. Transcription factors can up- or down-regulate a large number of target genes simultaneously [39]. The identification of those transcription factors, which are rapidly and strongly activated, specifically in resistant plants, may provide novel insights into the molecular mechanisms of antiviral resistance. For our investigations, we selected the pepper WRKY2 transcription factor that belongs to group I of WRKYs (GenBank accession DQ402421; [20]). Interestingly, in the N-terminal region of the CaWRKY2 protein sequence, five Ser-Pro motifs can be found, which form a cluster (SP-cluster). Within the SP cluster, Ser residues can serve as phosphorylation sites for MAP kinase (MAPK) enzymes. Adjacent to the SP-cluster, a MAPK docking site (D-domain) was also identified in CaWRKY2, which presumably facilitates the interaction between the MAPK and WRKY proteins [40]. Phosphorylation of the SP cluster in the NbWRKY8 protein increased both its DNA binding and its transcriptional activity [41]. An SP cluster and a D-domain were also identified in the pepper WRKY-a sequence [8]. MAPK cascades can activate WRKYs not only post-transcriptionally but also transcriptionally [40,42].
In our initial experiments, we compared the changes in the expression of the CaWRKY2 gene between resistant and susceptible pepper–tobamovirus interactions by RT-qPCR. ObPV inoculation of a pepper cultivar harboring the L3 resistance gene (incompatible interaction) led to the rapid and robust up-regulation of CaWRKY2. In contrast, PMMoV inoculation of the same pepper cultivar (compatible interaction) resulted only in a weak and slow induction of CaWRKY2 (Figure 1). These expression patterns suggest that CaWRKY2 may play an important role in antiviral resistance. However, the exact function of CaWRKY2, like that of most WRKYs, is still elusive. Therefore, we decided to use a quick and simple method for the functional analysis of CaWRKY2, transiently overexpressing this gene in N. benthamiana leaves. Transient overexpression mediated by A. tumefaciens infiltration (agroinfiltration) is often employed as an alternative to stable transformants due to its rapidity and efficiency [43,44,45]. In our experiments, the transient overexpression of CaWRKY2 in N. benthamiana leaves proved to be straightforward and successful (Figure 2).
To learn more about the role of CaWRKY2 in antiviral plant defense, we inoculated N. benthamiana leaves overexpressing CaWRKY2 as well as control leaves with TMV. The expression of CaWRKY2 did not influence the local symptoms of TMV nor the multiplication rate of the virus in the inoculated leaves (Figure 3).
In the following experiments, we investigated the effect of TMV inoculation on the expression of various defense genes in N. benthamiana leaves overexpressing CaWRKY2. The expression of LOX1 and PR-1b was up-regulated by TMV inoculation in both the CaWRKY2-overexpressing leaves and in the control, empty vector leaves (Figure 4). However, the TMV-induced up-regulation of both genes was stronger in the CaWRKY2-overexpressing leaves than in the empty vector leaves (Figure 4). Interestingly, the overexpression of CaWRKY2 led to a significantly elevated expression of PR-1b also without TMV inoculation (Figure 4). Prior to our studies, it was already known that silencing WRKY genes resulted in the suppression of LOX expression in various plants, which showed that these WRKYs positively regulated LOX expression [8,46]. Pathogenesis-related 1 (PR-1) proteins, including PR-1b, were identified as TMV-inducible proteins in tobacco many years ago [47]. Despite long years of research work, their exact function is still elusive [9,48]. The constitutive overexpression of the PR-1b gene in tobacco leaves did not modify their resistance against TMV [49]. Nevertheless, the expression of PR-1 genes is often investigated as a marker of systemic acquired resistance (SAR) [9].
It is well known that TMV inoculation of N. benthamiana leaves leads to lethal systemic necrosis and plant death 7 days post-inoculation [38,50]. Recent studies showed that phloem is a key responsive tissue during TMV infection [51]. In our experiments, the transient overexpression of CaWRKY2 in N. benthamiana leaves delayed (by approx. 3 days) the systemic necrosis caused by TMV (Figure 5). However, it was ultimately observed that CaWRKY2 was unable to prevent plant death. It is conceivable that the overexpression of WRKY2 inhibits the cell-to-cell movement of TMV that occurs through the plasmodesmata. Overexpression of the NbWRKY40 gene (II-a group WRKY) in N. benthamiana led to an increased deposition of callose in the neck of plasmodesmata via the elevation of endogenous salicylic acid levels. Presumably, this effect contributed to the elevated resistance of these mutant plants against tomato mosaic virus (ToMV) [9]. We hypothesize that in our experiments, CaWRKY2 activates biochemical reactions that hinder the movement of TMV into the vascular tissues or into systemic leaves. In our future experiments, we will therefore investigate the effects of transformation with CaWRKY2 in the vascular tissues or in the systemic leaves of TMV-infected N. benthamiana plants.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/life15040669/s1. Figure S1. Construction of Gateway vectors carrying CaWRKY2 gene.

Author Contributions

Conceptualization, G.G. and B.B.; methodology, C.J., Á.S., Z.B. and G.G.; investigation, C.J. and G.G. data analysis, C.J. and G.G. writing—original draft preparation, C.J. and G.G.; writing—review and editing C.J., Á.S., Z.B., B.B. and G.G.; funding acquisition, G.G. All authors have read and agreed to the published version of the manuscript.

Funding

The authors gratefully acknowledge the funding provided by the Hungarian National Research, Development and Innovation Office (K 124131) for this research.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

All of the available data are presented in the manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Teixeira, R.M.; Ferreira, M.A.; Raimundo, G.A.S.; Loriato, V.A.P.; Reis, P.A.B.; Fontes, E.P.B. Virus perception at the cell surface: Revisiting the roles of receptor-like kinases as viral pattern recognition receptors. Mol. Plant Pathol. 2019, 20, 1196–1202. [Google Scholar] [CrossRef] [Scilit]
  2. Kachroo, P.; Chandra-Shekara, A.C.; Klessig, D.F. Plant signal transduction and defense against viral pathogens. Adv. Virus Res. 2006, 66, 161–191. [Google Scholar] [CrossRef] [Scilit]
  3. Zanardo, L.; Souza, G.; Alves, M. Transcriptomics of plant–virus interactions: A review. Theor. Exp. Plant Physiol. 2019, 31, 103–125. [Google Scholar] [CrossRef] [Scilit]
  4. Pacheco, R.; García-Marcos, A.; Manzano, A.; de Lacoba, M.G.; Camañes, G.; García-Agustín, P.; Díaz-Ruíz, J.R.; Tenllado, F. Comparative analysis of transcriptomic and hormonal responses to compatible and incompatible plant-virus interactions that lead to cell death. Mol. Plant-Microbe Interact. MPMI 2012, 25, 709–723. [Google Scholar] [CrossRef] [Scilit]
  5. Kalapos, B.; Juhász, C.; Balogh, E.; Kocsy, G.; Tóbiás, I.; Gullner, G. Transcriptome profiling of pepper leaves by RNA-Seq during an incompatible and a compatible pepper-tobamovirus interaction. Sci. Rep. 2021, 11, 20680. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Birkenbihl, R.P.; Liu, S.; Somssich, I.E. Transcriptional events defining plant immune responses. Curr. Opin. Plant Biol. 2017, 38, 1–9. [Google Scholar] [CrossRef] [Scilit]
  7. Rushton, P.J.; Somssich, I.E.; Ringler, P.; Shen, Q.J. WRKY transcription factors. Trends Plant Sci. 2010, 15, 247–258. [Google Scholar] [CrossRef] [Scilit]
  8. Huh, S.U.; Lee, G.-J.; Jung, J.H.; Kim, Y.; Kim, Y.J.; Paek, K.-H. Capsicum annuum transcription factor WRKYa positively regulates defense response upon TMV infection and is a substrate of CaMK1 and CaMK2. Sci. Rep. 2015, 5, 7981. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Jiang, Y.; Zheng, W.; Li, J.; Liu, P.; Zhong, K.; Jin, P.; Xu, M.; Yang, J.; Chen, J. NbWRKY40 Positively Regulates the Response of Nicotiana benthamiana to Tomato Mosaic Virus via Salicylic Acid Signaling. Front. Plant Sci. 2020, 11, 603518. [Google Scholar] [CrossRef] [Scilit]
  10. Wani, S.H.; Anand, S.; Singh, B.; Bohra, A.; Joshi, R. WRKY transcription factors and plant defense responses: Latest discoveries and future prospects. Plant Cell Rep. 2021, 40, 1071–1085. [Google Scholar] [CrossRef] [Scilit]
  11. Arndt, L.C.; Heine, S.; Wendt, L.; Wegele, E.; Schomerus, J.T.; Schulze, J.; Hehl, R. Genomic distribution and context dependent functionality of novel WRKY transcription factor binding sites. BMC Genom. 2022, 23, 673. [Google Scholar] [CrossRef] [Scilit]
  12. Turck, F.; Zhou, A.; Somssich, I.E. Stimulus-Dependent, Promoter-Specific Binding of Transcription Factor WRKY1 to Its Native Promoter and the Defense-Related Gene PcPR1-1 in Parsley. Plant Cell. 2004, 16, 2573–2585. [Google Scholar] [CrossRef] [Scilit]
  13. Diao, W.-P.; Wang, S.-B.; Liu, J.-B.; Pan, B.-G.; Guo, G.-J.; Wei, G. Genome-wide analysis of the WRKY transcription factor family in pepper. Acta Hortic. Sin. 2015, 42, 2183. [Google Scholar] [CrossRef]
  14. Cheng, Y.; Yao, Z.P.; Ruan, M.Y.; Ye, Q.J.; Wang, R.Q.; Zhou, G.Z.; Luo, J. In silico identification and characterization of the WRKY gene superfamily in pepper (Capsicum annuum L.). Genet. Mol. Res. GMR 2016, 15, 1–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Zheng, J.; Liu, F.; Zhu, C.; Li, X.; Dai, X.; Yang, B.; Zou, X.; Ma, Y. Identification, expression, alternative splicing and functional analysis of pepper WRKY gene family in response to biotic and abiotic stresses. PLoS ONE 2019, 14, e0219775. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Cheng, W.; Jiang, Y.; Peng, J.; Guo, J.; Lin, M.; Jin, C.; Huang, J.; Tang, W.; Guan, D.; He, S. The transcriptional reprograming and functional identification of WRKY family members in pepper’s response to Phytophthora capsici infection. BMC Plant Biol. 2020, 20, 256. [Google Scholar] [CrossRef] [Scilit]
  17. Park, C.-J.; Shin, Y.-C.; Lee, B.-J.; Kim, K.-J.; Kim, J.-K.; Paek, K.-H. A hot pepper gene encoding WRKY transcription factor is induced during hypersensitive response to Tobacco mosaic virus and Xanthomonas campestris. Planta 2006, 223, 168–179. [Google Scholar] [CrossRef] [Scilit]
  18. Lim, J.H.; Park, C.-J.; Huh, S.U.; Choi, L.M.; Lee, G.J.; Kim, Y.J.; Paek, K.-H. Capsicum annuum WRKYb transcription factor that binds to the CaPR-10 promoter functions as a positive regulator in innate immunity upon TMV infection. Biochem. Biophys. Res. Commun. 2011, 411, 613–619. [Google Scholar] [CrossRef] [Scilit]
  19. Huh, S.U.; Choi, L.M.; Lee, G.-J.; Kim, Y.J.; Paek, K.-H. Capsicum annuum WRKY transcription factor d (CaWRKYd) regulates hypersensitive response and defense response upon Tobacco mosaic virus infection. Plant Sci. Int. J. Exp. Plant Biol. 2012, 197, 50–58. [Google Scholar] [CrossRef] [Scilit]
  20. Oh, S.-K.; Yi, S.Y.; Yu, S.H.; Moon, J.S.; Park, J.M.; Choi, D. CaWRKY2, a chili pepper transcription factor, is rapidly induced by incompatible plant pathogens. Mol. Cells 2006, 22, 58–64. [Google Scholar] [CrossRef] [Scilit]
  21. Oh, S.-K.; Baek, K.-H.; Park, J.M.; Yi, S.Y.; Yu, S.H.; Kamoun, S.; Choi, D. Capsicum annuum WRKY protein CaWRKY1 is a negative regulator of pathogen defense. New Phytol. 2008, 177, 977–989. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Tobias, I.; Fraser, R.S.S.; Gerwitz, A. The gene-for-gene relationship between Capsicum annuum L. and tobacco mosaic virus: Effects on virus multiplication, ethylene synthesis and accumulation of pathogenesis-related proteins. Physiol. Mol. Plant Pathol. 1989, 35, 271–286. [Google Scholar] [CrossRef] [Scilit]
  23. Rys, M.; Juhász, C.; Surówka, E.; Janeczko, A.; Saja, D.; Tóbiás, I.; Skoczowski, A.; Barna, B.; Gullner, G. Comparison of a compatible and an incompatible pepper-tobamovirus interaction by biochemical and non-invasive techniques: Chlorophyll a fluorescence, isothermal calorimetry and FT-Raman spectroscopy. Plant Physiol. Biochem. 2014, 83, 267–278. [Google Scholar] [CrossRef] [Scilit]
  24. Gullner, G.; Künstler, A.; Király, L.; Pogány, M.; Tóbiás, I. Up-regulated expression of lipoxygenase and divinyl ether synthase genes in pepper leaves inoculated with Tobamoviruses. Physiol. Mol. Plant Pathol. 2010, 74, 387–393. [Google Scholar] [CrossRef] [Scilit]
  25. Juhász, C.; Tóbiás, I.; Ádám, A.L.; Kátay, G.; Gullner, G. Pepper 9- and 13-lipoxygenase genes are differentially activated by two tobamoviruses and by hormone treatments. Physiol. Mol. Plant Pathol. 2015, 92, 59–69. [Google Scholar] [CrossRef] [Scilit]
  26. Balogh, E.; Juhász, C.; Dankó, T.; Fodor, J.; Tóbiás, I.; Gullner, G. The expression of several pepper fatty acid desaturase genes is robustly activated in an incompatible pepper-tobamovirus interaction, but only weakly in a compatible interaction. Plant Physiol. Biochem. 2020, 148, 347–358. [Google Scholar] [CrossRef] [Scilit]
  27. Dziurka, M.; Janeczko, A.; Juhász, C.; Gullner, G.; Oklestková, J.; Novák, O.; Saja, D.; Skoczowski, A.; Tóbiás, I.; Barna, B. Local and systemic hormonal responses in pepper leaves during compatible and incompatible pepper-tobamovirus interactions. Plant Physiol. Biochem. 2016, 109, 355–364. [Google Scholar] [CrossRef] [Scilit]
  28. Janeczko, A.; Dziurka, M.; Gullner, G.; Kocurek, M.; Rys, M.; Saja, D.; Skoczowski, A.; Tóbiás, I.; Kornas, A.; Barna, B. Comparative studies of compatible and incompatible pepper–Tobamovirus interactions and the evaluation of effects of 24-epibrassinolide. Photosynthetica 2018, 56, 763–775. [Google Scholar] [CrossRef] [Scilit]
  29. Tomita, R.; Sekine, K.-T.; Mizumoto, H.; Sakamoto, M.; Murai, J.; Kiba, A.; Hikichi, Y.; Suzuki, K.; Kobayashi, K. Genetic basis for the hierarchical interaction between Tobamovirus spp. and L resistance gene alleles from different pepper species. Mol. Plant-Microbe Interact. MPMI 2011, 24, 108–117. [Google Scholar] [CrossRef] [Scilit]
  30. Greenleaf, W.H.; Cook, A.A.; Heyn, A. Resistance to Tobacco mosaic virus in Capsicum, with reference to the Samsun latent strain. Phytopathology 1964, 54, 1367–1371. [Google Scholar]
  31. Dean, J.D.; Goodwin, P.H.; Hsiang, T. Induction of glutathione S-transferase genes of Nicotiana benthamiana following infection by Colletotrichum destructivum and C. orbiculare and involvement of one in resistance. J. Exp. Bot. 2005, 56, 1525–1533. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Thangavelu, M.; Belostotsky, D.; Bevan, M.W.; Flavell, R.B.; Rogers, H.J.; Lonsdale, D.M. Partial characterization of the Nicotiana tabacum actin gene family: Evidence for pollen-specific expression of one of the gene family members. Mol. Gen. Genet. MGG 1993, 240, 290–295. [Google Scholar] [CrossRef] [Scilit]
  33. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods San Diego Calif. 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Hartley, J.L.; Temple, G.F.; Brasch, M.A. DNA cloning using in vitro site-specific recombination. Genome Res. 2000, 10, 1788–1795. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Earley, K.W.; Haag, J.R.; Pontes, O.; Opper, K.; Juehne, T.; Song, K.; Pikaard, C.S. Gateway-compatible vectors for plant functional genomics and proteomics. Plant J. Cell Mol. Biol. 2006, 45, 616–629. [Google Scholar] [CrossRef] [Scilit]
  36. Karimi, M.; Depicker, A.; Hilson, P. Recombinational cloning with plant gateway vectors. Plant Physiol. 2007, 145, 1144–1154. [Google Scholar] [CrossRef] [Scilit]
  37. Underwood, B.A.; Vanderhaeghen, R.; Whitford, R.; Town, C.D.; Hilson, P. Simultaneous high-throughput recombinational cloning of open reading frames in closed and open configurations. Plant Biotechnol. J. 2006, 4, 317–324. [Google Scholar] [CrossRef] [Scilit]
  38. Culver, J.N. Tobamovirus Cross Protection Using a Potexvirus Vector. Virology 1996, 226, 228–235. [Google Scholar] [CrossRef] [Scilit]
  39. Li, J.; Brader, G.; Palva, E.T. The WRKY70 transcription factor: A node of convergence for jasmonate-mediated and salicylate-mediated signals in plant defense. Plant Cell. 2004, 16, 319–331. [Google Scholar] [CrossRef] [Scilit]
  40. Ishihama, N.; Yoshioka, H. Post-translational regulation of WRKY transcription factors in plant immunity. Curr. Opin. Plant Biol. 2012, 15, 431–437. [Google Scholar] [CrossRef] [Scilit]
  41. Ishihama, N.; Yamada, R.; Yoshioka, M.; Katou, S.; Yoshioka, H. Phosphorylation of the Nicotiana benthamiana WRKY8 transcription factor by MAPK functions in the defense response. Plant Cell. 2011, 23, 1153–1170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Kim, C.Y.; Zhang, S. Activation of a mitogen-activated protein kinase cascade induces WRKY family of transcription factors and defense genes in tobacco. Plant J. Cell Mol. Biol. 2004, 38, 142–151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Kapila, J.; De Rycke, R.; Van Montagu, M.; Angenon, G. An Agrobacterium-mediated transient gene expression system for intact leaves. Plant Sci. 1997, 122, 101–108. [Google Scholar] [CrossRef] [Scilit]
  44. Wydro, M.; Kozubek, E.; Lehmann, P. Optimization of transient Agrobacterium-mediated gene expression system in leaves of Nicotiana benthamiana. Acta Biochim. Pol. 2006, 53, 289–298. [Google Scholar] [CrossRef] [Scilit]
  45. Bashandy, H.; Jalkanen, S.; Teeri, T.H. Within leaf variation is the largest source of variation in agroinfiltration of Nicotiana benthamiana. Plant Methods 2015, 11, 47. [Google Scholar] [CrossRef] [Scilit]
  46. Skibbe, M.; Qu, N.; Galis, I.; Baldwin, I.T. Induced Plant Defenses in the Natural Environment: Nicotiana attenuata WRKY3 and WRKY6 Coordinate Responses to Herbivory. Plant Cell. 2008, 20, 1984–2000. [Google Scholar] [CrossRef] [Scilit]
  47. van Loon, L.C.; van Strien, E.A. The families of pathogenesis-related proteins, their activities, and comparative analysis of PR-1 type proteins. Physiol. Mol. Plant Pathol. 1999, 55, 85–97. [Google Scholar] [CrossRef] [Scilit]
  48. Elvira, M.I.; Galdeano, M.M.; Gilardi, P.; García-Luque, I.; Serra, M.T. Proteomic analysis of pathogenesis-related proteins (PRs) induced by compatible and incompatible interactions of pepper mild mottle virus (PMMoV) in Capsicum chinense L3 plants. J. Exp. Bot. 2008, 59, 1253–1265. [Google Scholar] [CrossRef] [Scilit]
  49. Cutt, J.R.; Harpster, D.C.; Dixon, M.H.; Carr, J.P.; Dunsmuir, P.; Klessig, D.F. Disease response to tobacco mosaic virus in transgenic tobacco plants that constitutively express the pathogenesis-related PR1b gene. Virology 1989, 173, 89–97. [Google Scholar] [CrossRef] [Scilit]
  50. Lee, W.-S.; Fu, S.-F.; Li, Z.; Murphy, A.M.; Dobson, E.A.; Garland, L.; Chaluvadi, S.R.; Lewsey, M.G.; Nelson, R.S.; Carr, J.P. Salicylic acid treatment and expression of an RNA-dependent RNA polymerase 1 transgene inhibit lethal symptoms and meristem invasion during tobacco mosaic virus infection in Nicotiana benthamiana. BMC Plant Biol. 2016, 16, 15. [Google Scholar] [CrossRef] [Scilit]
  51. Collum, T.D.; Culver, J.N. Tobacco mosaic virus infection disproportionately impacts phloem associated translatomes in Arabidopsis thaliana and Nicotiana benthamiana. Virology 2017, 510, 76–89. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Article Metrics

Citations

Article Access Statistics

Multiple requests from the same IP address are counted as one view.