AMPK Promotes Larval Metamorphosis of Mytilus coruscus
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. cDNA Full-Length Cloning and Identification of Three McAMPK Subunits
2.3. Sequence Analysis of McAMPK Genes
2.4. Pharmacologic Experiment of Larval Metamorphosis
2.5. RNAi
2.6. Larval Metamorphosis and RNAi
2.7. qRT-PCR Analysis of RNAi
2.8. Statistical Analysis
3. Results
3.1. Characterization of McAMPK Genes Subsection
3.2. Multiple Sequence Alignments and Phylogenetic Analysis of McAMPKs
3.3. AMPK Inhibitor and Activators Regulate M. Coruscus Larval Metamorphosis
3.4. Validation of RNAi Effect of McAMPK Genes
3.5. siRNA Transfection of McAMPK Genes Inhibits M. Coruscus Larval Metamorphosis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Yang, J.; Feng, D.; Liu, J.; Xu, J.; Chen, K.; Li, Y.; Zhu, Y.; Liang, X.; Lu, Y. Chromosome-level genome assembly of the hard-shelled mussel Mytilus coruscus, a widely distributed species from the temperate areas of East Asia. Gigascience 2021, 10, giab024. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Li, S.; Li, Y.; Liu, Z.; Liang, X.; Bao, W.; Liu, J. Effects of neuroactive compounds, ions and organic solvents on larval metamorphosis of the mussel Mytilus coruscus. Aquaculture 2013, 396–399, 106–112. [Google Scholar] [CrossRef]
- Bishop, C.D.; Erezyilmaz, D.F.; Flatt, T.; Georgiou, C.D.; Hadfield, M.G.; Heyland, A.; Hodin, J.; Jacobs, M.W.; Maslakova, S.A.; Pires, A.; et al. What is metamorphosis? Integr. Comp. Biol. 2006, 46, 655–661. [Google Scholar] [CrossRef] [PubMed]
- Ishizuya-Oka, A. Amphibian organ remodeling during metamorphosis: Insight into thyroid hormone-induced apoptosis. Dev. Growth Differ. 2011, 53, 202–212. [Google Scholar] [CrossRef] [PubMed]
- McMenamin, S.K.; Parichy, D.M. Metamorphosis in teleosts. Curr. Top. Dev. Biol. 2013, 103, 127–165. [Google Scholar] [PubMed]
- Liang, X.; Chen, K.; Li, Y.; Bao, W.; Yoshida, A.; Osatomi, K.; Yang, J. An α2-adrenergic receptor is involved in larval metamorphosis in the mussel, Mytilus coruscus. Biofouling 2019, 35, 986–996. [Google Scholar] [CrossRef] [PubMed]
- Espinel-Velasco, N.; Aguera, A.; Lamare, M. Sea urchin larvae show resilience to ocean acidification at the time of settlement and metamorphosis. Mar. Environ. Res. 2020, 159, 104977. [Google Scholar] [CrossRef]
- Dubrovsky, E.B. Hormonal cross talk in insect development. Trends Endocrinol. Metab. 2005, 16, 6–11. [Google Scholar] [CrossRef]
- Joyce, A.; Vogeler, S. Molluscan bivalve settlement and metamorphosis: Neuroendocrine inducers and morphogenetic responses. Aquaculture 2018, 487, 64–82. [Google Scholar] [CrossRef]
- Zhu, Y.; Zhang, Y.; Liu, Y.; Li, Y.; Yoshida, A.; Osatomi, K.; Yang, J.; Liang, X. Nitric oxide negatively regulates larval metamorphosis in hard-shelled mussel (Mytilus coruscus). Front. Mar. Sci. 2020, 7, 356. [Google Scholar] [CrossRef]
- He, J.; Wu, Z.; Chen, L.; Dai, Q.; Hao, H.; Su, P.; Ke, C.; Feng, D. Adenosine triggers larval settlement and metamorphosis in the mussel Mytilopsis sallei through the ADK-AMPK-FoxO pathway. ACS Chem. Biol. 2021, 16, 1390–1400. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.; Kundu, M.; Viollet, B.; Guan, K.L. AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1. Nat. Cell Biol. 2011, 13, 132–141. [Google Scholar] [CrossRef] [PubMed]
- Hoyer-Hansen, M.; Bastholm, L.; Szyniarowski, P.; Campanella, M.; Szabadkai, G.; Farkas, T.; Bianchi, K.; Fehrenbacher, N.; Elling, F.; Rizzuto, R.; et al. Control of macroautophagy by calcium, calmodulin-dependent kinase kinase-β, and Bcl-2. Mol. Cell. 2007, 25, 193–205. [Google Scholar] [CrossRef] [PubMed]
- Herzig, S.; Shaw, R.J. AMPK: Guardian of metabolism and mitochondrial homeostasis. Nat. Rev. Mol. Cell Biol. 2018, 19, 121–135. [Google Scholar] [CrossRef]
- Hardie, D.G.; Ross, F.A.; Hawley, S.A. AMPK: A nutrient and energy sensor that maintains energy homeostasis. Nat. Rev. Mol. Cell Biol. 2012, 13, 251–262. [Google Scholar] [CrossRef]
- Mihaylova, M.M.; Shaw, R.J. The AMPK signalling pathway coordinates cell growth, autophagy and metabolism. Nat. Cell Biol. 2011, 13, 1016–1023. [Google Scholar] [CrossRef]
- Hindupur, S.K.; Gonzalez, A.; Hall, M.N. The opposing actions of target of rapamycin and AMP-activated protein kinase in cell growth control. Cold Spring Harb. Perspect. Biol. 2015, 7, a019141. [Google Scholar] [CrossRef]
- Bultot, L.; Guigas, B.; Von Wilamowitz-Moellendorff, A.; Maisin, L.; Vertommen, D.; Hussain, N.; Beullens, M.; Guinovart, J.J.; Foretz, M.; Viollet, B.; et al. AMP-activated protein kinase phosphorylates and inactivates liver glycogen synthase. Biochem. J. 2012, 443, 193–203. [Google Scholar] [CrossRef]
- Ke, R.; Xu, Q.; Li, C.; Luo, L.; Huang, D. Mechanisms of AMPK in the maintenance of ATP balance during energy metabolism. Cell Biol. Int. 2018, 42, 384–392. [Google Scholar] [CrossRef]
- Zhao, J.; Xu, Q. Influence of soybean meal on intestinal mucosa metabolome and effects of adenosine monophosphate-activated protein kinase signaling pathway in mirror carp (Cyprinus carpio Songpu). Front. Mar. Sci. 2022, 9, 844716. [Google Scholar] [CrossRef]
- Chan, A.Y.; Dyck, J.R. Activation of AMP-activated protein kinase (AMPK) inhibits protein synthesis: A potential strategy to prevent the development of cardiac hypertrophy. Can. J. Physiol. Pharmacol. 2005, 83, 24–28. [Google Scholar] [CrossRef] [PubMed]
- Rashid, S.; Wong, C.; Roy, R. Developmental plasticity and the response to nutrient stress in Caenorhabditis elegans. Dev. Biol. 2021, 475, 265–276. [Google Scholar] [CrossRef] [PubMed]
- Marzano, M.; Herzmann, S.; Elsbroek, L.; Sanal, N.; Tarbashevich, K.; Raz, E.; Krahn, M.P.; Rumpf, S. AMPK adapts metabolism to developmental energy requirement during dendrite pruning in Drosophila. Cell Rep. 2021, 37, 110024. [Google Scholar] [CrossRef] [PubMed]
- Videla, J.A.; Chaparro, O.R.; Thompson, R.J.; Concha, I.I. Role of biochemical energy reserves in the metamorphosis and early juvenile development of the oyster Ostrea chilensis. Mar. Biol. 1998, 132, 635–640. [Google Scholar] [CrossRef]
- Chen, Z.; Zhang, H.; Wang, H.; Matsumura, K.; Wong, Y.; Ravasi, T.; Qian, P. Quantitative proteomics study of larval settlement in the Barnacle Balanus amphitrite. PLoS ONE 2014, 9, e88744. [Google Scholar] [CrossRef]
- Wang, C.; Bao, W.; Gu, Z.; Li, Y.; Liang, X.; Ling, Y.; Cai, S.; Shen, H.; Yang, J. Larval settlement and metamorphosis of the mussel Mytilus coruscus in response to natural biofilms. Biofouling 2012, 28, 249–256. [Google Scholar] [CrossRef]
- Li, Y.; Cheng, Y.; Chen, K.; Cheng, Z.; Zhu, X.; Cardoso, J.C.R.; Liang, X.; Zhu, Y.; Power, D.M.; Yang, J. Thyroid hormone receptor: A new player in epinephrine-induced larval metamorphosis of the hard-shelled mussel. Gen. Comp. Endocrinol. 2020, 287, 113347. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
- He, Z.; Mao, F.; Lin, Y.; Li, J.; Zhang, X.; Zhang, Y.; Xiang, Z.; Noor, Z.; Zhang, Y.; Yu, Z. Molecular characteristics of AMPK and its role in regulating the phagocytosis of oyster hemocytes. Fish Shellfish Immunol. 2019, 93, 416–427. [Google Scholar] [CrossRef]
- Yang, J.; Satuito, C.G.; Bao, W.; Kitamura, H. Induction of metamorphosis of pediveliger larvae of the mussel Mytilus galloprovincialis Lamarck, 1819 using neuroactive compounds, KCl, NH4Cl and organic solvents. Biofouling 2008, 24, 461–470. [Google Scholar] [CrossRef]
- Zhou, G.; Myers, R.; Li, Y.; Chen, Y.; Shen, X.; Fenyk-Melody, J.; Wu, M.; Ventre, J.; Doebber, T.; Fujii, N.; et al. Role of AMP-activated protein kinase in mechanism of metformin action. J. Clin. Investig. 2001, 108, 1167–1174. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.; Yang, G.; Kim, Y.; Kim, J.; Ha, J. AMPK activators: Mechanisms of action and physiological activities. Exp. Mol. Med. 2016, 48, e224. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Jiao, Z.; Zheng, L.; Zhang, Y.; Xie, S.; Wang, Z.; Wu, J. Structural insight into the autoinhibition mechanism of AMP-activated protein kinase. Nature 2009, 459, 1146–1149. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Wang, Y.; Bao, C.; Xu, Y.; Shen, H.; Chen, J.; Yan, J.; Chen, Y. Metformin interacts with AMPK through binding to γ subunit. Mol. Cell Biochem. 2012, 368, 69–76. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.; Zandkarimi, F.; Zhang, Y.; Meena, J.K.; Kim, J.; Zhuang, L.; Tyagi, S.; Ma, L.; Westbrook, T.F.; Steinberg, G.R.; et al. Energy-stress-mediated AMPK activation inhibits ferroptosis. Nat. Cell Biol. 2020, 22, 225–234. [Google Scholar] [CrossRef] [PubMed]
- Rao, E.; Zhang, Y.; Li, Q.; Hao, J.; Egilmez, N.K.; Suttles, J.; Li, B. AMPK-dependent and independent effects of AICAR and compound C on T-cell responses. Oncotarget 2016, 7, 33783–33795. [Google Scholar] [CrossRef]
- Saito, S.; Furuno, A.; Sakurai, J.; Park, H.R.; Shin-Ya, K.; Tomida, A. Compound C prevents the unfolded protein response during glucose deprivation through a mechanism independent of AMPK and BMP signaling. PLoS ONE 2012, 7, e45845. [Google Scholar] [CrossRef]
- Yang, J.; Li, Y.; Bao, W.; Satuito, C.G.; Kitamura, H. Larval metamorphosis of the mussel Mytilus galloprovincialis Lamarck, 1819 in response to neurotransmitter blockers and tetraethylammonium. Biofouling 2011, 27, 193–199. [Google Scholar] [CrossRef]
- Yuan, D.; Zhou, S.; Liu, S.; Li, K.; Zhao, H.; Long, S.; Liu, H.; Xie, Y.; Su, Y.; Yu, F.; et al. The AMPK-PP2A axis in insect fat body is activated by 20-hydroxyecdysone to antagonize insulin/IGF signaling and restrict growth rate. Proc. Natl. Acad. Sci. USA 2020, 117, 9292–9301. [Google Scholar] [CrossRef]
- Evans, J.J.; Xiao, C.; Robertson, R.M. AMP-activated protein kinase protects against anoxia 2 in Drosophila melanogaster. PLoS ONE 2017, 8, 30–39. [Google Scholar] [CrossRef]
- O’Neill, H.M.; Maarbjerg, S.J.; Crane, J.D.; Jeppesen, J.; Jorgensen, S.B.; Schertzer, J.D.; Shyroka, O.; Kiens, B.; van Denderen, B.J.; Tarnopolsky, M.A.; et al. AMP-activated protein kinase (AMPK) β1β2 muscle null mice reveal an essential role for AMPK in maintaining mitochondrial content and glucose uptake during exercise. Proc. Natl. Acad. Sci. USA 2011, 108, 16092–16097. [Google Scholar] [CrossRef] [PubMed]
- Woods, A.; Johnstone, S.R.; Dickerson, K.; Leiper, F.C.; Fryer, L.G.; Neumann, D.; Schlattner, U.; Wallimann, T.; Carlson, M.; Carling, D. LKB1 is the upstream kinase in the AMP-activated protein kinase cascade. Curr. Biol. 2003, 13, 2004–2008. [Google Scholar] [CrossRef]
- Hawley, S.A.; Selbert, M.A.; Goldstein, E.G.; Edelman, A.M.; Carling, D.; Hardie, D.G. 5′-AMP activates the AMP-activated protein kinase cascade, and Ca2+/calmodulin activates the calmodulin-dependent protein kinase I cascade, via three independent mechanisms. J. Biol. Chem. 1995, 270, 27186–27191. [Google Scholar] [CrossRef] [PubMed]
- Hawley, S.A.; Boudeau, J.; Reid, J.L.; Mustard, K.J.; Udd, L.; Mäkelä, T.P.; Alessi, D.R.; Hardie, D.G. Complexes between the LKB1 tumor suppressor, STRAD α/β and MO25 α/β are upstream kinases in the AMP-activated protein kinase cascade. J. Biol. 2003, 2, 28. [Google Scholar] [CrossRef] [PubMed]
- Zeng, L.; Liu, B.; Wu, C.; Lei, J.; Xu, M.; Zhu, A.; Zhang, J.; Hong, W. Molecular characterization and expression analysis of AMPK α subunit isoform genes from Scophthalmus maximus responding to salinity stress. Fish Physiol. Biochem. 2016, 42, 1595–1607. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Fang, L.; Wu, Q.; Li, D.; Huo, Z.; Yan, X. Genome-wide identification and characterization of the AMPK genes and their distinct expression patterns in response to air exposure in the Manila clam (Ruditapes philippinarum). Genes Genom. 2020, 42, 1–12. [Google Scholar] [CrossRef]
- Wu, W.; Sun, J.; Ji, H.; Yu, H.; Zhou, J. AMP-activated protein kinase in the grass carp Ctenopharyngodon idellus: Molecular characterization, tissue distribution and mRNA expression in response to overwinter starvation stress. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2020, 246–247, 110457. [Google Scholar] [CrossRef]
- Sanz, P. AMP-activated protein kinase: Structure and regulation. Curr. Protein Pept. Sci. 2008, 9, 478–492. [Google Scholar] [CrossRef]
- Liu, X.; Chhipa, R.R.; Nakano, I.; Dasgupta, B. The AMPK inhibitor compound C is a potent AMPK-independent antiglioma agent. Mol. Cancer Ther. 2014, 13, 596–605. [Google Scholar] [CrossRef]
- Zou, H.; Zou, H.; Li, X.; Qiu, Q.; Geng, N.; Zhang, B.; Yan, G.; Zhang, Z.; Zhang, S.; Yao, B.; et al. Metformin-induced AMPK activation suppresses larval growth and molting probably by disrupting 20E synthesis and glycometabolism in fall webworm, Hyphantria cunea Drury. Pestic. Biochem. Physiol. 2022, 183, 105083. [Google Scholar] [CrossRef]
- Lin, S.; Hardie, D.G. AMPK: Sensing glucose as well as cellular energy status. Cell Metab. 2018, 27, 299–313. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.H.; Koh, H.; Kim, M.; Kim, Y.; Lee, S.Y.; Karess, R.E.; Lee, S.H.; Shong, M.; Kim, J.M.; Kim, J.; et al. Energy-dependent regulation of cell structure by AMP-activated protein kinase. Nature 2007, 447, 1017–1020. [Google Scholar] [CrossRef] [PubMed]
- Lippai, M.; Csikos, G.; Maroy, P.; Lukacsovich, T.; Juhasz, G.; Sass, M. SNF4Aγ, the Drosophila AMPK γ subunit is required for regulation of developmental and stress-induced autophagy. Autophagy 2008, 4, 476–486. [Google Scholar] [CrossRef] [PubMed]
Prime Name | (5′-3′ Sequence) | Comment |
---|---|---|
ORF-McAMPKα-F | TCTTGGTGAAACACTAGGAACTGG | ORF |
ORF-McAMPKα-R | TAGGTGGAGTCTGAGATTTGTTGGC | ORF |
ORF-McAMPKβ-F | CAGGGAGCTGATATGGTTTA | ORF |
ORF-McAMPKβ-R | GAGGAGGAAGAATAGGTGGT | ORF |
ORF-McAMPKγ-F | CAGGGTCAACAGGATTACGAG | ORF |
ORF-McAMPKγ-R | TTGAACTATCCCAGAGAGGTG | ORF |
RACE-McAMPKα-R1 | GGAGCAGCATAATTAGGTGAACC | 5′ RACE |
RACE-McAMPKα-R2 | TCCGTAGGAGTACTTATCACCTGG | 5′ RACE |
RACE-McAMPKα-F1 | ACTGCCAACAAATCTCAGACTCC | 3′ RACE |
RACE-McAMPKα-F2 | TGAGGGAATCGTCAGTAGCATC | 3′ RACE |
RACE-McAMPKβ-R1 | GAGGAAGAATAGGTGGTCCAGTG | 5′ RACE |
RACE-McAMPKβ-R2 | TATCCTTTCCGCCACCTTCC | 5′ RACE |
RACE-McAMPKβ-F1 | GCCCACTGTGAACCAACCTTATTAC | 3′ RACE |
RACE-McAMPKγ-R1 | CGTAATCCTGTTGACCCTGACC | 5′ RACE |
RACE-McAMPKγ-R2 | AGCAAACGCACTGAGGTCCT | 5′ RACE |
RACE-McAMPKγ-F1 | ATATAATGGTGTGAGGGCAGC | 3′ RACE |
RACE-McAMPKγ-F2 | ATCGGCTGTCCCTGTAGTAGA | 3′ RACE |
q-McAMPKα-F | CTACAACAGCACAAATCAGAG | qRT-PCR |
q-McAMPKα-R | CATATGGATCACCATTCAAC | qRT-PCR |
q-McAMPKβ-F | AGTATTCAATGGGAGGTGGCG | qRT-PCR |
q-McAMPKβ-R | CAGGCTCTGAAGGGTTGTGCT | qRT-PCR |
q-McAMPKγ-F | ATAATGGTGTGAGGGCAGC | qRT-PCR |
q-McAMPKγ-R | CCAGGTAGCAATTTTGTGT | qRT-PCR |
EF-1α-RT-F | CACCACGAGTCTCTCCCTGA | qRT-PCR |
EF-1α-RT-R | GCTGTCACCACAGACCATTCC | qRT-PCR |
Inducer | Function on AMPK | Manufacture and Cat. No. | Concentration (mM) | |
---|---|---|---|---|
Stock Solution | Test Solution | |||
AMP | Activator. Binding to AMPK γ to activate AMPK holoenzyme [31,32,33]. | MCE, HY-A0181 | 5 | 0.1, 1, 2.5 |
Metformin | Activator. It can directly interact with AMPK by binding to AMPK γ [34]. | MCE, HY-B0627 | 5 | 0.1, 1, 4 |
AICAR | Activator. An adenosine analogue, its function is similar to AMP [35,36]. | MCE, HY-13417 | 5 | 0.1, 0.5, 2 |
Compound C | Inhibitor. Suppressed the phosphorylation of AMPK [36,37]. | MCE, HY-13418A | 1 | 5 × 10−5 |
siRNA | siRNA Sequence (5′-3′) | Comment |
---|---|---|
siRNA-AMPKα | GCGGUGAACUCUUUGAUUATT | RNAi |
siRNA-AMPKβ | GGUGGCGGAAGGAUAUUUATT | RNAi |
siRNA-AMPKγ | GCAGAUCAUUCCUUCAAUATT | RNAi |
siRNA-NC | UUCUCCGAACGUGUCACGUTT | RNAi |
Group | siRNA (μg/mL) | Electroporation | EPI (10−4 M) | AMP (0.5 mM) |
---|---|---|---|---|
Blank | 0 | - | - | - |
EPI | 0 | - | + | - |
Control | 0 | + | - | - |
AMP | 0 | - | - | + |
Control+AMP | 0 | + | - | + |
siNC+AMP | 1.2 | + | - | + |
siAMPKα+AMP | 0.8 | + | - | + |
siAMPKβ+AMP | 0.8 | + | - | + |
siAMPKγ+AMP | 1.2 | + | - | + |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, W.; Wang, Y.; Hu, X.; Zhou, Z.; Zhu, Y.; Liang, X.; Yang, J.-L. AMPK Promotes Larval Metamorphosis of Mytilus coruscus. Genes 2022, 13, 2384. https://doi.org/10.3390/genes13122384
Zhang W, Wang Y, Hu X, Zhou Z, Zhu Y, Liang X, Yang J-L. AMPK Promotes Larval Metamorphosis of Mytilus coruscus. Genes. 2022; 13(12):2384. https://doi.org/10.3390/genes13122384
Chicago/Turabian StyleZhang, Wen, Yuyi Wang, Xiaomeng Hu, Zhongsheng Zhou, Youting Zhu, Xiao Liang, and Jin-Long Yang. 2022. "AMPK Promotes Larval Metamorphosis of Mytilus coruscus" Genes 13, no. 12: 2384. https://doi.org/10.3390/genes13122384
APA StyleZhang, W., Wang, Y., Hu, X., Zhou, Z., Zhu, Y., Liang, X., & Yang, J.-L. (2022). AMPK Promotes Larval Metamorphosis of Mytilus coruscus. Genes, 13(12), 2384. https://doi.org/10.3390/genes13122384