Next Article in Journal
Formins in Human Disease
Previous Article in Journal
Mesenchymal Stem Cell-Derived Extracellular Vesicles in Tendon and Ligament Repair—A Systematic Review of In Vivo Studies
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Arginine Regulates TOR Signaling Pathway through SLC38A9 in Abalone Haliotis discus hannai

1
The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China, 5 Yushan Road, Qingdao 266003, China
2
The Key Laboratory of Aquaculture Nutrition and Feeds, Ministry of Agriculture and Rural Affairs, Fisheries College, Ocean University of China, 5 Yushan Road, Qingdao 266003, China
*
Author to whom correspondence should be addressed.
Cells 2021, 10(10), 2552; https://doi.org/10.3390/cells10102552
Submission received: 22 August 2021 / Revised: 10 September 2021 / Accepted: 17 September 2021 / Published: 27 September 2021

Abstract

Arginine plays an important role in the regulation of the target of the rapamycin (TOR) signaling pathway, and Solute Carrier Family 38 Member 9 (SLC38A9) was identified to participate in the amino acid-dependent activation of TOR in humans. However, the regulations of arginine on the TOR signaling pathway in abalone are still unclear. In this study, slc38a9 of abalone was cloned, and the slc38a9 was knocked down and overexpressed to explore its function in the regulation of the TOR signaling pathway. The results showed that knockdown of slc38a9 decreased the expression of tor, ribosomal s6 protein kinase (s6k) and eukaryotic translation initiation factor 4e (eif4e) and inhibited the activation of the TOR signaling pathway by arginine. Overexpression of slc38a9 up-regulated the expression of TOR-related genes. In addition, hemocytes of abalone were treated with 0, 0.2, 0.5, 1, 2 and 4 mmol/L of arginine, and abalones were fed diets with 1.17%, 1.68% and 3.43% of arginine, respectively, for 120 days. Supplementation of arginine (0.5–4 mmol/L) increased the expressions of slc38a9, tor, s6k and eif4e in hemocytes, and abalone fed with 1.68% of dietary arginine showed higher mRNA levels of slc38a9, tor, s6k and eif4e and phosphorylation levels of TOR, S6 and 4E-BP. In conclusion, the TOR signaling pathway of abalone can be regulated by arginine, and SLC38A9 plays an essential role in this regulation.

1. Introduction

Arginine (Arg) is an essential amino acid for fish and neonatal mammals [1,2]. It is not only used as raw materials for protein synthesis but also as signal molecules to effectively regulate the synthesis and degradation of proteins [3,4]. Arginine is also involved in the secretion of several hormones, such as stimulating the somatotropic axis manifested by the secretion of growth hormone and insulin-like growth factor I [5,6]. In addition, it promotes the secretion of insulin, which could promote the absorption of glucose and amino acids [7,8]. In addition, arginine has several physiological functions, including the synthesis of urea, glutamic acid, creatine, proline, polyamines and nitric oxide (NO), inflammation and innate immune responses [1,9].
Protein synthesis is the foundation and key process of animal growth and development, which is limited by translation initiation [10,11]. The target of the rapamycin (TOR) signaling pathway is one of the most important pathways regulating protein metabolism by amino acids [12]. TOR regulates protein synthesis and initiates translation through stimulating ribosomal s6 protein kinase (S6K) activity and simultaneously inhibiting the binding of the eukaryotic translation initiation factor 4E-binding protein (4E-BP) to eukaryotic translation initiation factor 4E (eIF4E) [13,14,15]. In mammals, arginine regulates the mTOR signaling pathway at the transcriptional and protein levels both in vivo and in vitro [16,17,18,19,20]. In fish, arginine has been shown to regulate the expression of TOR-related genes and promote protein synthesis in grass carp (Ctenopharyngodon idellus) [21], hybrid grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂) [22], blunt snout bream (Megalobrama amblycephala) [11], gibel carp (Carassis auratus gibelio) [23] and Jian carp (Cyprinus carpio var. Jian) [24]. However, no significant difference was observed in the expression of tor, s6k and 4e-bp in tiger puffer (Takifugu rubripes) fed with different dietary arginine levels [25].
Amino acids serve as key stimuli of the TOR signaling pathway, but the mechanism of amino acids regulating the TOR signaling pathway was not fully understood. In mammals, Rag GTPases mediate the amino acid induced re-localization of TOR to the lysosomal surface, and Ragulator is responsible for tethering Rag GTPases to the lysosome and interacts with them in an amino acid- and v-ATPase-dependent manner [26,27]. In recent years, solute carrier family 38 member 9 (SLC38A9) was identified as a novel component of the Rag-Ragulator machinery, which plays an important role in sensing and transmitting amino acid signals to the TOR signaling pathway [28,29]. In HEK-293T cells, knockdown of SLC38A9 inhibited the activation of TOR by arginine, and overexpression of SLC38A9 made TOR signaling insensitive to amino acid starvation in human and mouse cells [28,30]. These studies indicated that SLC38A9 plays a crucial role in the activation of the TOR signaling pathway by amino acids, particularly arginine, but evidence is lacking in aquatic animals.
Abalone (Haliotis discus hannai) is large marine mollusks of archeogastropod [31]. Previous studies showed that the mRNA levels of TOR-related genes were regulated by dietary protein or lipid levels [32,33]. However, the regulation of amino acids on the TOR signaling pathway of abalone is still unclear. In the present study, the slc38a9 of abalone was knocked down and overexpressed to better understand the molecular function and mechanism of SLC38A9 in the regulation of the TOR signaling pathway. The effect of arginine on the TOR signaling pathway was explored in vivo and in vitro. These multi-level characterizations provide a better mechanistic understanding of the regulation of the TOR signaling pathway by amino acids in marine invertebrates and provide evidence for the traces of evolution of TOR.

2. Materials and Methods

2.1. Ethical Statement

This study involved in vivo and in vitro experiments, and all care and handling of abalones were approved by the Animal Care and Use Committee of Ocean University of China (Approval No. OUC-SMP-2020-0126, January, 2020).

2.2. Molecular Cloning, Sequence Analysis and Tissue Distribution of slc38a9 in Abalone

2.2.1. Experimental Animals and Sample Collection

Abalones (Weight: 20.0 ± 0.2 g) were obtained from an aquafarm in Weihai, Shandong province, China. They were temporarily cultured in a re-circulating water system with an ultraviolet sterilization lamp for 2 weeks. Before sampling, abalones were anesthetized with 5% of ethanol. The foot muscle was gashed with a scalpel to collect the hemolymph, and then muscle, mental, gill, intestine, gonad and digestive gland were isolated. All samples were frozen in liquid nitrogen and kept in −80 °C.

2.2.2. Total RNA Extraction and Reverse Transcription

The RNA from the digestive gland was extracted using FastPure®Cell/Tissue Total RNA isolation Kit V2 (RC112-01 50 rxn, Vazyme, Nanjing, China). Other tissues were lysed with RNAiso Plus Kit (9109; Takara Biotech, Beijing, China) to extract the total RNA. The purity and concentration of the total RNA were quantified by Nanodrop 2000/2000C spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) based on the ratio of A260/A280, and the integrity was tested by 1.5% denaturing agarose gel electrophoresis. Then RNA was treated with DNase and reverse transcribed into cDNA using the Prime ScriptTM RT reagent Kit (RR047A; Takara Biotech, Beijing, China).

2.2.3. Molecular Cloning of slc38a9

The method of slc38a9 cloning was referred to Wang et al. [34]. The mRNA sequence of slc38a9 was obtained from the transcriptome database (unpublished data), and the primers were designed by Oligo 7 software (Molecular Biology Insights, Inc., Colorado Springs, CO) and synthesized by Sangon Biotech (Shanghai, China) (Table 1). cDNA of abalone muscle was used as a template for PCR, and the products were detected by 1% agarose gel electrophoresis. The target band was recovered using the SanPrep Column DNA Gel Extraction Kit (Sangon Biotech, Shanghai, China). The recovered product was linked to a blunt cloning vector and transferred to Trans1-T1 phage resistant chemically competent cells (TransGen Biotech, Beijing, China). The bacteria solution was culture expanded and applied evenly on LB solid medium containing ampicillin. Positive colonies were selected after overnight culture and verified using colony PCR, the correct colonies were selected and sequenced by Sangon Biotech (Shanghai, China).

2.2.4. Sequence Analysis of slc38a9

Blast retrieval and comparison of the complete sequence were performed on National Center for Biotechnology Information (Available online: https://www.ncbi.nlm.nih.gov/orffinder/, accessed on 8 May 2020). The amino acid sequence of abalone slc38a9 was deduced and analyzed by ExPASy expert protein analysis system (Available online: http://web.expasy.org/protparam/, accessed on 8 May 2020), and sequences of other species were downloaded from the NCBI database. Multiple alignment of these amino acid sequences was performed by DNAMAN 6.0 (Lynnon Biosoft, San Ramon, CA, USA). Phylogenetic analysis was carried out by the neighbor-joining method using MEGA X, and bootstrap values (%) of 1000 replicates were calculated for each node of the consensus tree obtained. SignalP 4.1 (Available online: http://www.cbs.dtu.dk/services/SignalP/, accessed on 8 October 2020) was used to detect the signal peptide, and transmembrane domains were predicted using the TMHMM Server v.2.0 (Available online: http://www.cbs.dtu.dk/services/TMHMM/, accessed on 21 October 2020). Furthermore, the secondary and three-dimensional structures of the sequence were predicted by PredictProtein (Available online:http://www.predictprotein.org/, accessed on 21 October 2020) and SWISS-MODEL (Available online: https://swissmodel.expasy.org/, accessed on 21 October 2020).

2.2.5. Tissue Distribution of slc38a9

Six abalones were used for the tissue distribution analysis of slc38a9, the expression levels of slc38a9 in seven tissues (hemolymph, muscle, mental, gill, intestine, gonad and digestive gland) of abalone were detected by quantitative real-time PCR.

2.3. Function Analysis of slc38a9

2.3.1. Synthesis and Injection of slc38a9 siRNA

The sequence of negative control siRNA (siRNA-NC) and synthesis of siRNA was conducted by Wang et al. [34]. Four siRNAs (siRNA-108, siRNA-236, siRNA-347 and siRNA-469) targeting different encoding regions of slc38a9 were designed by BLOCK-iT™ RNAi Designer (Available online: http://rnaidesigner.thermofisher.com/rnaiexpress/, accessed on 20 May 2020) (Table 2). Primers of these siRNAs were synthesized by Sangon Biotech and siRNA duplexes were synthesized using the T7 RNAi Transcription Kit (TR102-01, Vazyme, Nanjing, China). The concentration of all the siRNAs was uniformly adjusted to 300 ng/μL.
Abalones (Weight: 19.8 ± 0.3 g) were acclimatized to the laboratory environment for two weeks before the experiment. To explore the efficiency of these siRNAs, six groups (6 abalones each group) of abalones were injected intramuscularly with 100 μL PBS, siRNA-NC, siRNA-108, siRNA-236, siRNA-347 or siRNA-469. Abalones injected with PBS served as the control group. The muscles of each the abalone were sampled 12 h after injection. Then 60 abalones were randomly divided into two groups and injected with 100 μL siRNA-NC or siRNA-347, respectively. The muscles were sampled at 0, 6, 12, 24 and 48 h after injection (6 abalones each time) to explore the efficiency of siRNA at different times.

2.3.2. Overexpression Plasmid Construction and Injection

The overexpression plasmid was constructed according to the protocols described by Liu et al. [35]. The sequence of the slc38a9 open reading frame (ORF) was obtained according to the step in Section 2.2.3. Homologous arms of Bam HI region in pcDNA3.1 were added to the slc38a9 by the PCR of the templates of slc38a9 with the forward primer slc38a9-HR-F (5′ cttggtaccgagctcggatccATGGGGAGAGGAAGTCGCA 3′) and the reverse primer slc38a9-HR-R (5′ ccacactggactagtggatccTGTTGTATGGCCGATGATGAGG 3′). The target gene sequence was linked to the pcDNA3.1 digested with the Bam H I enzyme, and then transferred to Trans-T competent cells. The extracted plasmid is sequenced to verify that the sequence is attached to the vector. The bacteria successfully linked to the target gene were expanded by shaking the flask culture overnight, and adequate plasmid was collected using the EasyPure HiPure Plasmid MaxiPrep Kit (TransGen Biotech, Beijing, China). The concentration of the plasmid was eventually diluted to 300 ng/μL.
Abalones (Weight: 19.8 ± 0.3 g) were randomly divided into three groups (6 abalones each group) and injected intramuscularly with 100 μL PBS, pcDNA3.1 or pcDNA3.1-slc38a9. Abalones injected with PBS served as the control group. The muscles of abalone were sampled at 12 h after injection.

2.3.3. Oral Administration of Arginine after siRNA Injection

Two groups (12 abalones each group) of abalones (Weight: 19.8 ± 0.3 g) were injected with 100 μL siRNA-NC or siRNA-slc38a9, respectively. After 12 h, abalones of each group were subdivided into two groups and orally administered with 100 μL of arginine (0.6 M) (Sigma, St. Louis, MO, USA) or PBS, and abalones injected with siRNA-NC and fed with PBS served as the control group. Muscles were collected 3 h later and immediately frozen in liquid nitrogen, then stored frozen at −80 °C for the following analysis.

2.3.4. siRNA Injection and Feeding

In regard to the feeding model, 200 abalones (weight: 19.8 ± 0.3 g) were randomly divided into two groups. For one group, abalones were fed with basal diet (1.23% arginine), and the other group was fed with the diet with arginine added (1.72% arginine). The diet formula is shown in Table 3, and abalones fed with the basal diet served as the control (Con) group. After a 2-week feeding, abalones of each group were divided into two sub-groups and injected with 100 μL of siRNA-NC or siRNA-slc38a9. After 12 h, abalones were fed with the original diet again. Muscles of abalone were sampled at 0, 2, 3, 6, 9, 12 and 24 h after feeding, and 6 abalones were sampled from each sub-group at each time point.

2.4. Arginine Treatment of Abalone In Vitro and In Vivo

2.4.1. Primary Cells Culture and Arginine Treatment

Abalones (Weight: 20.0 ± 0.2 g) were temporarily cultured in the re-circulating water system with an ultraviolet sterilization lamp. After that, abalones were anesthetized with 5% of ethanol. The body surface was wiped and sterilized with 75% ethanol. Foot muscle was gashed with a sterile scalpel, and then the hemolymph was collected and placed into the anticoagulant tube immediately. The complete medium consisted of Leibovitz’s L-15 Medium (Thermo Fisher Scientific, Waltham, MA, USA), 15% fetal bovine serum (FBS) (Bioind, Kibbuiz, Israel), and four antibiotics (100 uL/mL penicillin-streptomycin, 250 μg/mL gentamicin and 2 μg/mL amphotericin) (Solarbio, Beijing, China). The hemolymph was mixed with the complete medium in a ratio of 1:3 and plated into 6-well plates (Corning, Lowell, MA, USA) and then incubated at 22 °C.
Before the experiment, cells were washed with phosphate buffer solution (PBS) (HyClone, Logan, UT, USA) for three times and then cultured in the DMEM medium without arginine (Thermo Fisher Scientific, Waltham, MA, USA). After 12 h, cells were washed with PBS for another time and cultured in the DMEM medium with antibiotics and different arginine concentrations (0, 0.2, 0.5, 1, 2 and 4 mmol/L), respectively, (three replicates per concentration). Cells were sampled 9 h later.

2.4.2. Feeding Trial

Abalones (Weight: 15.7 ± 0.03 g) were obtained from a fishery company in Pingtan, Fujian, China. Three experimental diets with different levels of arginine (1.17%, 1.68% and 3.43%) were designed (Table 4). Abalones were randomly assigned into nine tanks (60 abalones per tank, and three tanks for one group) and fed with the experimental diets for 120 days. Abalones were fed every two days (15:00–17:00). During the 120-day feeding trial, the water temperature was 24.4 ± 4.3 °C, pH was 7.63 ± 0.74 and the dissolved oxygen was higher than 6.9 mg·L−1. After the feeding trial, abalones were fasted for 72 h before sampling. The muscles and digestive gland from each abalone were collected and immediately frozen in liquid nitrogen, then stored at −80 °C.

2.5. Sample Analysis

2.5.1. Quantitative Real-Time PCR

The expressions of slc38a9 and TOR-related genes of abalone were detected by qRT-PCR using the 2× ChamQ Universal SYBR qPCR Master Mix (Q711–02, Vazyme Biotech, Nanjing, China). The cDNA of abalone tissue was used as the template for qRT-PCR. All the primers were designed by Oligo 7 software according to the sequence from NCBI and synthesized by Sangon Biotech (Shanghai, China), and the primer sequences are listed in Table 1. The qRT-PCR condition was as follows: one cycle of 95 °C for 30 s, followed by 40 cycles of 95 °C for 10 s, 58 °C for 30 s, a cycle 95 °C for 15 s and 60 °C for 60 s. β-actin gene was used as the reference gene to normalize the mRNA expression levels. The Ct values were calculated by using 2−ΔΔCt method to quantitate the relative expression levels of target genes.

2.5.2. Western Blot Analysis

Abalone muscles (30–40 mg) were homogenized and lysed in RIPA (Solarbio Science and Technology Co., Ltd., Beijing, China) with protease inhibitor and phosphatase inhibitor (Thermo Fisher scientific, Waltham, MA, USA). The homogenates were set on ice for 10 min and then centrifuged at 4 °C to collect the supernatant. Protein concentrations were determined using the BCA protein assay kit (Beyotime Biotechnology, Shanghai, China) according to the manufacturer’s instructions, and then all the samples were adjusted to the same concentration. Equal amounts of protein were subjected to SDS-PAGE gel electrophoresis and then electrophoretically transferred to PDVF membrane. The PVDF membrane was blocked with 5% non-fat powdered milk for 1h and incubated with the antibody overnight at 4 °C. The primary antibodies used are as follows: phospho-mTOR (Ser2448) (2971), mTOR (2972), phospho-S6 (Ser235/236) (4858), S6 (2217), phospho-4E-BP1 (Thr37/46) (2855) and 4E-BP1 (9644) were purchased from Cell Signaling Technology Inc (Danvers, MA, USA). Then the PVDF membranes were washed 3 times and incubated with HRP-labeled Goat Anti-Rabbit/Mouse IgG (Beyotime Biotechnology, Shanghai, China) for 1 h at room temperature and enhanced chemiluminescence by Beyo ECL Plus reagents (Beyotime Biotechnology, Shanghai, China). The bands were quantified by densitometry using ImageJ software (Ver. 1.53, National Institutes of Health, Bethesda, MD, USA). GAPDH (AB-P-R001, Goodhere Biotechnology, Hangzhou, China) was the reference protein to normalize the target protein abundance and the phosphorylation level was calculated by the intensity ratio of phosphorylated protein to total protein.

2.6. Statistical Analysis

All data were analyzed by SPSS 25.0 software (IBM Corp., Armonk, NY, USA) and presented as mean ± SEM. Normality test and homogeneity of variances were performed before statistical analysis. T-test was used for the analysis of the two sets of data. Data with more than 2 sets were analyzed by one-way analysis of variance (ANOVA) followed by the Tukey’s multiple range test. Probabilities of p < 0.05 were considered statistically significant.

3. Results

3.1. Molecular Cloning, Sequence Analysis and Tissue Distribution of slc38a9 in Abalone

3.1.1. Characterization and Phylogenetic Analysis of the slc38a9

The nucleotide sequence of cDNA and deduced amino acid sequence of slc38a9 are shown in Figure 1. The sequence has been uploaded to NCBI (Accession No. MW390888). The full length of slc38a9 sequence contains 1832 nucleotides, including an ORF of 1578bp. It codes a polypeptide of 525 amino acids with a molecular weight of 58.8 kDa and a theoretical isoelectric point (pI) of 7.20. The secondary structure was mainly alpha-helix, and the deduced protein includes 11 transmembrane domains. No signal peptide was found of the sequence. The predicted tertiary structure of abalone SLC38A9 protein is shown in Figure 2C.
Multiple alignment and phylogenetic tree for slc38a9 and other counterparts are shown in Figure 2A,B. The results showed that slc38a9 of abalone had significant homology with mollusk, including Crassostrea gigas, Crassostrea virginica, Mytilus coruscus, Pecten maximus, Mizuhopecten yessoensis, Pomacea canaliculata. Among these, M. yessoensis had the highest sequence consistency with abalone. All mollusk species formed a clade separate from zebrafish, mice and humans.

3.1.2. Expression Analysis of slc38a9 in Different Tissues of Abalone

Transcript levels of slc38a9 in different tissues including muscle, hemocytes, mantle, gill, gonad, digestive gland and intestine were investigated to determine the tissue-specific expression profile of slc38a9 in abalone. The result showed that slc38a9 was widely expressed in all tested tissues, and it was most highly expressed in the gonad (p < 0.05), followed by intestine, gill, digestive gland and mantle. The lowest expressions were found in hemocytes and muscle (Figure 2D).

3.2. Function Analysis of slc38a9

3.2.1. Expressions of TOR Pathway Related Genes after siRNA Injection

The silencing efficiency of four siRNA was measured to screen the most effective one. Compared with the control group, siRNA-NC had no significant effect on the mRNA level of slc38a9 (p > 0.05), and the relative expression level of slc38a9 was significantly decreased in all groups injected with siRNA-slc38a9 (p < 0.05). The silencing efficiencies of siRNA-108, siRNA-347 and siRNA-469 were about 60% without significant difference among the three (p > 0.05), silencing efficiency of siRNA-236 was 40% (Figure 3A). To determine the time with the highest efficiency of siRNA, abalones were sampled at different time after injection. The result showed that the relative expression of slc38a9 was significantly inhibited at 6 h after injection, the inhibition efficiency was highest at 12 h after injection, and the relative expression was still significantly inhibited at 48 h (p < 0.05) (Figure 3B).
Compared with the control group, the relative expression levels of tor, s6k and eif4e were significantly reduced after the injection of siRNA-slc38a9 (p < 0.05), but there was no significant change in mRNA level of 4e-bp (p > 0.05) (Figure 3C).

3.2.2. Expressions of TOR Pathway Related Genes after Injection with pcDNA3.1-slc38a9

Compared with the control group, intramuscular injection of pcDNA3.1 plasmid had no significant influence on the relative expression of slc38a9 (p > 0.05), and the relative expression of slc38a9 was up-regulated by pcDNA3.1-slc38a9 plasmid injection significantly (p < 0.05). The mRNA levels of tor, s6k and eif4e were significantly increased after the intramuscular injection of pcDNA3.1-slc38a9 plasmid (p < 0.05) (Figure 4).

3.2.3. Expressions of TOR Pathway Related Genes after Injection of siRNA and Oral Administration of Arginine

Compared with the control group, oral administration of arginine significantly increased the expression levels of slc38a9, tor, s6k and eif4e in the muscles of abalone (p < 0.05). siRNA-mediated knockdown of slc38a9 significantly inhibited the activation of the TOR signaling pathway by arginine and decreased the expression of tor, s6k and eif4e (p < 0.05) (Figure 5).

3.2.4. Expressions of TOR Pathway Related Genes after Feeding and siRNA Injection

Compared with the basal diet, the arginine-added diet increased the transcript levels of slc38a9, tor, s6k and eif4e in abalone (p < 0.05). The expression of slc38a9 had a peak after 6 h of feeding, and the expression levels of other genes reached the peak at 9 h (Figure 6). Furthermore, feeding after siRNA-slc38a9 injection also up-regulated the expression levels of slc38a9, tor, s6k and eif4e (p < 0.05); however, the expression levels of these genes were significantly lower than that in abalone without siRNA injection (p < 0.05).

3.3. Arginine Treatment of Abalone In Vitro and In Vivo

3.3.1. Expressions of TOR Pathway Related Genes in Hemocyte Treated with Different Concentrations of Arginine

The relative expression levels of slc38a9, s6k and eif4e were increased significantly when the concentration of arginine was 0.5–4 mmol/L (p < 0.05), and there was no significant difference among them (p > 0.05). Compared with the control group, the addition of arginine up-regulated the relative expression of tor (p < 0.05). Furthermore, 1–4 mmol/L arginine significantly increased the relative expression of 4e-bp (p < 0.05) (Figure 7).

3.3.2. Expressions of TOR Pathway Related Genes Affected by Dietary Arginine

As presented in Figure 8A, the relative expression levels of slc38a9 and tor in muscle of abalone fed with 1.68% and 3.43% of dietary arginine were significantly higher than those fed diet with 1.17% of arginine (p < 0.05). Compared with 1.17% and 3.43% of dietary arginine, diet with 1.68% of arginine significantly increased the expression of s6k in abalone (p < 0.05). The relative expression levels of eif4e in muscle of abalone fed with 1.68% of dietary arginine were significantly higher than those fed with 1.17% of dietary arginine (p < 0.05). In addition, there was no significant difference in the mRNA level of 4e-bp in abalone fed with different levels of dietary arginine (p > 0.05).
As for the digestive gland, the relative expression levels of tor and eif4e in abalone fed with 1.68% and 3.43% of dietary arginine were significantly higher than those fed with diet with 1.17% of arginine (p < 0.05). Compared with 1.17% of dietary arginine, 1.68% of dietary arginine significantly improved mRNA levels of slc38a9 and s6k in digestive gland (p < 0.05). Dietary arginine level had no significant effect on the expression of 4e-bp in the digestive gland (p > 0.05) (Figure 8B).

3.3.3. Expressions of TOR Pathway Related Proteins Affected by Dietary Arginine

The phosphorylation levels of TOR (Ser2448) in muscle of abalone fed with 1.68% of dietary arginine were significantly increased compared to those in abalone fed with 1.17% of dietary arginine (p < 0.05). Abalone fed 1.68% of dietary arginine showed the highest phosphorylation level of S6 (Ser235/236). Meanwhile, 1.68% of dietary arginine significantly increased the phosphorylation levels of 4E-BP1 (Thr37/46) compared with the other two groups (p < 0.05) (Figure 8C,D).

4. Discussion

SLC38A9 is characterized as a lysosomal membrane amino acid transporter with 11 transmembrane domains and a member of the solute carrier family 38 in human, which has the dual role of transporting amino acids and interacting with other proteins to activate TOR [28,30,36]. The present results showed that the slc38a9 contains an open reading frame of 1578bp and codes a polypeptide of 525 amino acids with a molecular weight of 58.8 kDa. The sequence analysis in the present study confirmed that SLC38A9 protein has 11 transmembrane domains and no signal peptide, which is in agreement with the results in human [28]. The multiple alignment and phylogenetic tree analysis showed that the slc38a9 sequence of abalone shares a higher degree of similarity with mollusks such as oyster and scallop, and all mollusk species formed a clade separate from other species, which indicated that slc38a9 of abalone has high homology with mollusk. In addition, the present study showed that slc38a9 was expressed in all the analyzed tissues, which is consistent with the expression pattern of the SLC38 family in human and closely related mammals [37]. Transporters of the SLC38 family are particularly expressed in cells with active growth and amino acid metabolism, and SLC38A9 is especially expressed in testis, adrenal gland, thyroid and parathyroid [37,38]. Similarly, this study found that slc38a9 had the highest expression in the gonad of abalone. Moreover, the transport of arginine is one of the important functions of slc38a9; arginine is involved in the sperm formation process and is a basic component of sperm nuclear protein, and it can also improve sperm motility and protect the integrity of sperm structure and function [39,40]. As a metabolite of arginine, NO is essential for sustaining oocyte quality for optimal fertilization and development [41]. The high expression of slc38a9 may suggest the active transport and utilization of arginine in gonads. Furthermore, the intestine is the main organ of amino acid absorption [42,43], and it may be the reason why slc38a9 is highly expressed in the intestine in abalone.
Current research generally believes that amino acids regulate the TOR signaling pathway through the Rag-GTPases complex [26,44]. SLC38A9 was identified as a novel component of the Rag-Ragulator machinery and plays an important role in the regulation of the TOR signaling pathway in human cells [28,30]. In HEK-293T cells, the depletion of SLC38A9 decreased the phosphorylation of S6K and 4EBP1, and the phosphorylation of S6K was increased when SLC38A9 was overexpressed [28]. In the present study, the slc38a9 was artificially regulated by siRNA knockdown or overexpression to confirm the function and the underlying mechanism of SLC38A9 in the regulation of TOR by arginine in abalone. The results showed that knockdown of slc38a9 inhibited the expression of tor, s6k and eif4e, and the overexpression of slc38a9 activated the TOR signaling pathway, which is manifested as the increased relative expression level of tor, s6k and eif4e. These results are consistent with studies in human [28,30], suggesting that SLC38A9 plays a positive role in the regulation of the TOR signaling pathway of abalone. Furthermore, studies in human and mouse cells indicated that SLC38A9 is required for the amino acid-dependent TOR activation, and arginine is one of the main activators of this process [30,36]. In HEK-293T cells, siRNA-mediated knockdown of SLC38A9 inhibited the amino acid-induced mTORC1 activation, and knocked out of SLC38A9 suppressed the activation of mTOR by arginine at all concentrations [29,30]. In human HEK293E, HeLa, LN229 cells and mouse embryonic fibroblasts, overexpression of SLC38A9 could activate mTORC1 and sustain its activity during amino acid starvation [28,30]. Consistent with these studies, the present results showed that knockdown of slc38a9 did partially inhibit the activation of the TOR signaling pathway by arginine, as detected by the mRNA level of tor and its established substrate s6k and eif4e. Therefore, SLC38A9 is essential in the activation of the TOR signaling pathway by arginine.
The TOR signaling pathway plays a crucial role in maintaining cellular and physiological homeostasis [45,46]. Indispensable amino acids have remarkable effects on regulating the TOR pathway, including the regulation of S6K and 4E-BP to promote protein synthesis and initiate translation [47,48,49], and arginine is essential for the activation of TOR [50]. In the present study, 0.5–4 mmol/L arginine significantly increased the expressions of tor, s6k and eif4e in the hemocytes of abalone. It is consistent with the result in bovine mammary epithelial cells [19]. In addition, the present results demonstrated that 1.68% of dietary arginine could activate the TOR signaling pathway in muscle and digestive gland, which is evidenced by the increased relative expression level of tor, s6k and eif4e. Similarly, previous studies in fish species have shown that optimal dietary arginine increased the expression of tor and s6k [11,21,22,23,24]. Furthermore, dietary arginine levels had no significant effect on the mRNA level of 4e-bp, which is consistent with studies in tiger puffer, hybrid grouper, blunt snout bream and gibel carp [11,22,23,25], but different results have also been reported in juvenile Jian carp [24], as it suggested that the regulation of arginine on 4E-BP in aquatic animals is complex and requires further relevant study. In the present study, the phosphorylation levels of TOR, 4E-BP and S6 were detected for a comprehensive understanding of the regulation of arginine on the TOR signaling pathway. As 4E-BP is the binding protein of eIF4E, phosphorylation of 4E-BP releases eIF4E and initiates translation [51], and dietary arginine supplementation promoted the formation of the eIF4E·eIF4G complex and reduced the amount of the 4E-BP1·eIF4E complex in skeletal muscle of piglets [20]. Arginine increased the abundance of phosphorylated mTOR, S6K and 4E-BP1 proteins in porcine and ovine trophectoderm cells and brown adipocyte precursor cells [16,17,18]. S6 is the primary substrate of S6K, and it is directly regulated by S6K to regulate protein synthesis [52], the abundance of phosphorylated S6 and S6K was increased by arginine in porcine trophectoderm cells [53]. The present study showed that 1.68% dietary arginine increased phosphorylation levels of TOR, S6 and 4E-BP in muscle. It showed a similar trend in mammals [17,18,20], suggesting that 1.68% dietary arginine activated the TOR signaling pathway at the protein phosphorylation level. Furthermore, excessive metabolism of amino acids may result in excessive energy cost and toxicity, 3.43% dietary arginine may exceed the tolerance level of arginine in abalone, resulting in an imbalance of amino acid, thereby inhibiting the activity of related genes and metabolic processes. Taken together, appropriate levels of arginine activated the TOR signaling pathway, which is evidenced by the increased expression levels of tor, s6k and eif4e in hemocytes, muscle and digestive gland. A total of 1.68% of dietary arginine increased the abundance of phosphorylated TOR, 4E-BP and S6 in muscle. These results suggested a promotion of protein synthesis in abalone.
The gene transcription of several members from the SLC superfamily are transcriptionally affected by amino acid levels [51,54]. Ingestion of essential amino acids increased the mRNA levels of SLC38A9 in human [55]. In piglets, the relative expression of neutral amino acid transporter slc1a5 was increased by L-glutamate, and leucine increased the expression of slc6a14, slc6a19 and slc7a9 [56,57]. An optimal level of dietary arginine up-regulated the expressions of cationic amino acid transporters in spotted grouper (Epinephelus coioides) [58] and tiger puffer (Takifugu rubripes) [25]. Similarly, the present study showed that 1.68% and 3.43% of dietary arginine increased the relative expression levels of slc38a9 in muscles and digestive gland of abalone (p < 0.05). The result indicated that appropriate arginine could increase the activation of amino acid transporter, which can promote the transport and utilization of arginine. In addition, the expression of slc38a9 is consistent with the expression trend of TOR-related genes, which supported the regulation of the TOR signaling pathway by SLC38A9.
The TOR signaling pathway has also emerged as a key regulator of autophagy and inflammatory response [49], and deregulation of TOR underlies the pathogenesis of metabolic disorders, cancer, neurodegeneration and aging [59,60]. SLC38A9 mediates the transport of essential amino acids out of lysosomes, which is required for the growth of pancreatic cancer cells, and loss of SLC38A9 or its transport function strongly inhibited tumor formation [61]. Furthermore, pancreatic cancers have more than 90% KRAS mutation and KRAS is one of the most frequently mutated oncogenes of the RAS family, and it is reported that combinatorial therapies with TOR inhibitors will be necessary against RAS-driven cancers [62]. An antagonist of SLC38A9 (NOVELTY) was developed for the treatment of proliferative disease and metabolic disorder associated with TOR activation [63]. The present study in abalone demonstrated that SLC38A9 is conservative in regulating the TOR signaling pathway and provided further evidence that SLC38A9 may be used as a promising anticancer target against related cancers. Moreover, amino acids and TOR were reported to mediate nutritional checkpoints in the cell cycle, which were usually inactivated and/or overridden in cancer cells [64,65]. Arginine depletion is considered as a viable option for cancer treatment, it results in the induction of cell growth arrest at several checkpoints [66,67], and the present study also showed that arginine deficiency inhibited the TOR signaling pathway. Therefore, exploring the role of arginine and the regulation of TOR might have some potential for therapeutic exploitation.

5. Conclusions

In conclusion, the sequence of slc38a9 in abalone was cloned. It shows high sequence homology to other mollusks and is widely expressed in various tissues. SLC38A9 plays a positive role in the regulation of the TOR signaling pathway, and it is essential in the activation of TOR by arginine. Moreover, appropriate levels of arginine increased the activity of the TOR signaling pathway and slc38a9 in vivo and in vitro (Figure 9). This study provides insights into the potential mechanism of the regulation of the TOR signaling pathway by arginine and the molecular basis for the promotion of dietary amino acids on protein synthesis and growth.

Author Contributions

Conceptualization, Y.L. and W.Z.; methodology, Y.L., Y.G., D.H., J.L. and M.P.; formal analysis, Y.L., H.Y. and L.W.; investigation, Y.L. and H.Y.; resources, K.M.; data curation, Y.L. and W.Z.; writing—original draft preparation, Y.L.; writing—review and editing, Y.G., D.H., J.L., M.P. and W.Z.; supervision, K.M.; funding acquisition, W.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Key R&D Program of China (grant number 2018YFD0900400) and the Earmarked Fund for Modern Agro-industry Technology Research System (grant number CARS-49).

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Ethics Committee Ocean University of China (Approval No. OUC-SMP-2020-0126, January, 2020).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknowledgments

We thank Wenhao Fan Hao Chen and Li Sun for their help in the feeding of abalone.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Wu, G.; Bazer, F.W.; Davis, T.A.; Kim, S.W.; Li, P.; Marc, R.J.; Carey, S.M.; Smith, S.B.; Spencer, T.E.; Yin, Y. Arginine metabolism and nutrition in growth, health and disease. Amino. Acids. 2009, 37, 153–168. [Google Scholar] [CrossRef] [PubMed]
  2. Li, P.; Mai, K.; Trushenski, J.; Wu, G. New developments in fish amino acid nutrition: Towards functional and environmentally oriented aquafeeds. Amino. Acids. 2009, 37, 43–53. [Google Scholar] [CrossRef]
  3. Wu, G. Functional amino acids in growth, reproduction, and health. Adv. Nutr. 2010, 1, 31–37. [Google Scholar] [CrossRef]
  4. Jobgen, W.S.; Fried, S.K.; Fu, W.J.; Meininger, C.J.; Wu, G. Regulatory role for the arginine-nitric oxide pathway in metabolism of energy substrates. J. Nutr. Biochem. 2006, 17, 571–588. [Google Scholar] [CrossRef]
  5. Pohlenz, C.; Buentello, A.; Miller, T.; Small, B.C.; MacKenzie, D.S.; Gatlin, D.M. Effects of dietary arginine on endocrine growth factors of channel catfish, Ictalurus punctatus. Comp. Biochem. Physiol. A Mol Integr. Physiol. 2013, 166, 215–221. [Google Scholar] [CrossRef]
  6. Wang, L.; Wu, J.; Wang, C.; Li, J.; Zhao, Z.; Luo, L.; Du, X.; Xu, Q. Dietary arginine requirement of juvenile hybrid sturgeon (Acipenser schrenckii♀ × Acipenser baerii♂). Aquac. Res. 2017, 48, 5193–5201. [Google Scholar] [CrossRef]
  7. Andoh, T. Stress inhibits insulin release induced by feeding and arginine injection in barfin flounder Verasper moseri. Fish. Sci. 2014, 80, 311–316. [Google Scholar] [CrossRef]
  8. Sink, T.D.; Lochmann, R.T. Insulin Response of Largemouth Bass to Glucose, Amino Acid, and Diet Stimulation. N. Am. J. Aquac. 2007, 69, 429–434. [Google Scholar] [CrossRef]
  9. Chen, Q.; Zhao, H.; Huang, Y.; Cao, J.; Wang, G.; Sun, Y.; Li, Y. Effects of dietary arginine levels on growth performance, body composition, serum biochemical indices and resistance ability against ammonia-nitrogen stress in juvenile yellow catfish (Pelteobagrus fulvidraco). Anim. Nutr. 2016, 2, 204–210. [Google Scholar] [CrossRef] [PubMed]
  10. Rønnestad, I.; Thorsen, A.; Finn, R.N. Fish larval nutrition: A review of recent advances in the roles of amino acids. Aquaculture 1999, 177, 201–216. [Google Scholar] [CrossRef]
  11. Liang, H.; Ren, M.; Habte-Tsion, H.M.; Ge, X.; Xie, J.; Mi, H.; Xi, B.; Miao, L.; Liu, B.; Zhou, Q.; et al. Dietary arginine affects growth performance, plasma amino acid contents and gene expressions of the TOR signaling pathway in juvenile blunt snout bream, Megalobrama amblycephala. Aquaculture 2016, 461, 1–8. [Google Scholar] [CrossRef]
  12. Scot, R.K.; Leonard, S.J. Control of protein synthesis by amino acid availability. Curr. Opin. Clin. Nutr. Metab. Care 2002, 5, 63–67. [Google Scholar]
  13. Wullschleger, S.; Loewith, R.; Hall, M.N. TOR signaling in growth and metabolism. Cell 2006, 124, 471–484. [Google Scholar] [CrossRef] [PubMed]
  14. Kilberg, M.S.; Pan, Y.X.; Chen, H.; Leung-Pineda, V. Nutritional control of gene expression: How mammalian cells respond to amino acid limitation. Annu. Rev. Nutr. 2005, 25, 59–85. [Google Scholar] [CrossRef] [PubMed]
  15. Chotechuang, N.; Azzout-Marniche, D.; Bos, C.; Chaumontet, C.; Gausseres, N.; Steiler, T.; Gaudichon, C.; Tome, D. mTOR, AMPK, and GCN2 coordinate the adaptation of hepatic energy metabolic pathways in response to protein intake in the rat. Am. J. Physiol. Endocrinol. Metab. 2009, 297, E1313–E1323. [Google Scholar] [CrossRef]
  16. Kim, J.Y.; Burghardt, R.C.; Wu, G.; Johnson, G.A.; Spencer, T.E.; Bazer, F.W. Select nutrients in the ovine uterine lumen. VIII. Arginine stimulates proliferation of ovine trophectoderm cells through MTOR-RPS6K-RPS6 signaling cascade and synthesis of nitric oxide and polyamines. Biol. Reprod. 2011, 84, 70–78. [Google Scholar] [CrossRef]
  17. Kong, X.; Tan, B.; Yin, Y.; Gao, H.; Li, X.; Jaeger, L.A.; Bazer, F.W.; Wu, G. L-Arginine stimulates the mTOR signaling pathway and protein synthesis in porcine trophectoderm cells. J. Nutr. Biochem. 2012, 23, 1178–1183. [Google Scholar] [CrossRef]
  18. Ma, X.; Han, M.; Li, D.; Hu, S.; Gilbreath, K.R.; Bazer, F.W.; Wu, G. L-Arginine promotes protein synthesis and cell growth in brown adipocyte precursor cells via the mTOR signal pathway. Amino. Acids. 2017, 49, 957–964. [Google Scholar] [CrossRef]
  19. Wang, M.; Xu, B.; Wang, H.; Bu, D.; Wang, J.; Loor, J.J. Effects of Arginine concentration on the in vitro expression of Casein and mTOR pathway related genes in mammary epithelial cells from dairy cattle. PLoS ONE 2014, 9, e95985. [Google Scholar] [CrossRef]
  20. Yao, K.; Yin, Y.; Chu, W.; Liu, Z.; Deng, D.; Li, T.; Huang, R.; Zhang, J.; Tan, B.; Wang, W.; et al. Dietary Arginine Supplementation Increases mTOR Signaling Activity in Skeletal Muscle of Neonatal Pigs. J. Nutr. 2008, 138, 867–872. [Google Scholar] [CrossRef]
  21. Chen, J.; Zhang, D.; Tan, Q.; Liu, M.; Hu, P. Arginine affects growth and integrity of grass carp enterocytes by regulating TOR signaling pathway and tight junction proteins. Fish Physiol. Biochem. 2019, 45, 539–549. [Google Scholar] [CrossRef]
  22. Wu, M.; Wu, X.; Lu, S.; Gao, Y.; Yao, W.; Li, X.; Dong, Y.; Jin, Z. Dietary arginine affects growth, gut morphology, oxidation resistance and immunity of hybrid grouper (Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂) juveniles. Br. J. Nutr. 2018, 120, 269–282. [Google Scholar] [CrossRef]
  23. Tu, Y.; Xie, S.; Han, D.; Yang, Y.; Jin, J.; Zhu, X. Dietary arginine requirement for gibel carp (Carassis auratus gibelio var. CAS ⅠⅠⅠ ) reduces with fish size from 50g to 150g associated with modulation of genes involved in TOR signaling pathway. Aquaculture 2015, 449, 37–47. [Google Scholar] [CrossRef]
  24. Chen, G.; Feng, L.; Kuang, S.; Liu, Y.; Jiang, J.; Hu, K.; Jiang, W.; Li, S.; Tang, L.; Zhou, X. Effect of dietary arginine on growth, intestinal enzyme activities and gene expression in muscle, hepatopancreas and intestine of juvenile Jian carp (Cyprinus carpio var. Jian). Br. J. Nutr. 2012, 108, 195–207. [Google Scholar] [CrossRef]
  25. Wei, Y.; Zhang, Q.; Jia, L.; Xu, H.; Liang, M. Effects of dietary arginine levels on growth, intestinal peptide and amino acid transporters, and gene expressions of the TOR signaling pathway in tiger puffer, Takifugu rubripes. Aquaculture 2021, 532, 736086. [Google Scholar] [CrossRef]
  26. Sancak, Y.; Peterson, T.R.; Shaul, Y.D.; Lindquist, R.A.; Thoreen, C.C.; Bar-Peled, L.; Sabatini, D.M. The Rag GTPases bind raptor and mediate amino acid signaling to mTORC1. Science 2008, 320, 1496–1501. [Google Scholar] [CrossRef] [PubMed]
  27. Bar-Peled, L.; Schweitzer, L.D.; Zoncu, R.; Sabatini, D.M. Ragulator is a GEF for the rag GTPases that signal amino acid levels to mTORC1. Cell 2012, 150, 1196–1208. [Google Scholar] [CrossRef]
  28. Jung, J.; Genau, H.M.; Behrends, C. Amino Acid-Dependent mTORC1 Regulation by the Lysosomal Membrane Protein SLC38A9. Mol. Cell Biol. 2015, 35, 2479–2494. [Google Scholar] [CrossRef] [PubMed]
  29. Rebsamen, M.; Pochini, L.; Stasyk, T.; de Araujo, M.E.; Galluccio, M.; Kandasamy, R.K.; Snijder, B.; Fauster, A.; Rudashevskaya, E.L.; Bruckner, M.; et al. SLC38A9 is a component of the lysosomal amino acid sensing machinery that controls mTORC1. Nature 2015, 519, 477–481. [Google Scholar] [CrossRef] [PubMed]
  30. Wang, S.; Tsun, Z.Y.; Wolfson, R.L.; Shen, K.; Wyant, G.A.; Plovanich, M.E.; Yuan, E.D.; Jones, T.D.; Chantranupong, L.; Comb, W.; et al. Metabolism. Lysosomal amino acid transporter SLC38A9 signals arginine sufficiency to mTORC1. Science 2015, 347, 188–194. [Google Scholar] [CrossRef]
  31. Wu, C.; Zhang, W.; Mai, K.; Xu, W.; Wang, X.; Ma, H.; Liufu, Z. Transcriptional up-regulation of a novel ferritin homolog in abalone Haliotis discus hannai Ino by dietary iron. Comp. Biochem. Physiol. C Toxicol. Pharm. 2010, 152, 424–432. [Google Scholar] [CrossRef]
  32. Ma, S.; Guo, Y.; Sun, L.; Fan, W.; Liu, Y.; Liu, D.; Huang, D.; Li, X.; Zhang, W.; Mai, K. Over high or low dietary protein levels depressed the growth, TOR signaling, apoptosis, immune and anti-stress of abalone Haliotis discus hannai. Fish Shellfish Immunol. 2020, 106, 241–251. [Google Scholar] [CrossRef]
  33. Guo, Y.; Huang, D.; Chen, F.; Ma, S.; Zhou, W.; Zhang, W.; Mai, K. Lipid deposition in abalone Haliotis discus hannai affected by dietary lipid levels through AMPKα2/PPARα and JNK/mTOR/SREBP-1c pathway. Aquaculture 2021, 532, 736040. [Google Scholar] [CrossRef]
  34. Wang, L.; Guo, Y.; Pan, M.; Li, X.; Huang, D.; Liu, Y.; Wu, C.; Zhang, W.; Mai, K. Functions of Forkhead Box O on Glucose Metabolism in Abalone Haliotis discus hannai and Its Responses to High Levels of Dietary Lipid. Genes 2021, 12, 297. [Google Scholar] [CrossRef]
  35. Liu, J.; Pan, M.; Huang, D.; Guo, Y.; Yang, M.; Zhang, W.; Mai, K. Myostatin-1 Inhibits Cell Proliferation by Inhibiting the mTOR Signal Pathway and MRFs, and Activating the Ubiquitin-Proteasomal System in Skeletal Muscle Cells of Japanese Flounder Paralichthys olivaceus. Cells 2020, 9, 2376. [Google Scholar] [CrossRef]
  36. Scalise, M.; Galluccio, M.; Pochini, L.; Cosco, J.; Trotta, M.; Rebsamen, M.; Superti-Furga, G.; Indiveri, C. Insights into the transport side of the human SLC38A9 transceptor. Biochim Biophys Acta. Biomembr. 2019, 1861, 1558–1567. [Google Scholar] [CrossRef] [PubMed]
  37. Broer, S. The SLC38 family of sodium-amino acid co-transporters. Pflug. Arch. 2014, 466, 155–172. [Google Scholar] [CrossRef]
  38. Hellsten, S.V.; Eriksson, M.M.; Lekholm, E.; Arapi, V.; Perland, E.; Fredriksson, R. The gene expression of the neuronal protein, SLC38A9, changes in mouse brain after in vivo starvation and high-fat diet. PLoS ONE 2017, 12, e0172917. [Google Scholar] [CrossRef] [PubMed]
  39. Patel, A.B.; Srivastava, S.; Phadke, R.S.; Govil, G. Arginine Activates Glycolysis of Goat Epididymal Spermatozoa: An NMR Study. Biophys. J. 1998, 75, 1522–1528. [Google Scholar] [CrossRef][Green Version]
  40. Adnan; Mroueh, Effect of Arginine on Oligospermia. Fertil. Steril. 1970, 21, 217–219. [CrossRef]
  41. Goud, P.T.; Goud, A.P.; Diamond, M.P.; Gonik, B.; Abu-Soud, H.M. Nitric oxide extends the oocyte temporal window for optimal fertilization. Free Radic. Biol. Med. 2008, 45, 453–459. [Google Scholar] [CrossRef]
  42. Stein, E.D.; Chang, S.D.; Diamond, J.M. Comparison of different dietary amino acids as inducers of intestinal amino acid transport. Am. J. Physiol. 1987, 252, G626–G635. [Google Scholar] [CrossRef] [PubMed]
  43. Morales, A.; Barrera, M.A.; Araiza, A.B.; Zijlstra, R.T.; Bernal, H.; Cervantes, M. Effect of excess levels of lysine and leucine in wheat-based, amino acid-fortified diets on the mRNA expression of two selected cationic amino acid transporters in pigs. J Anim. Physiol. Anim. Nutr. 2013, 97, 263–270. [Google Scholar] [CrossRef] [PubMed]
  44. Kim, E.; Goraksha-Hicks, P.; Li, L.; Neufeld, T.P.; Guan, K.L. Regulation of TORC1 by Rag GTPases in nutrient response. Nat. Cell Biol. 2008, 10, 935–945. [Google Scholar] [CrossRef]
  45. Holz, M.K.; Ballif, B.A.; Gygi, S.P.; Blenis, J. mTOR and S6K1 mediate assembly of the translation preinitiation complex through dynamic protein interchange and ordered phosphorylation events. Cell 2005, 123, 569–580. [Google Scholar] [CrossRef] [PubMed]
  46. Laplante, M.; Sabatini, D.M. mTOR signaling in growth control and disease. Cell 2012, 149, 274–293. [Google Scholar] [CrossRef]
  47. Sancak, Y.; Bar-Peled, L.; Zoncu, R.; Markhard, A.L.; Nada, S.; Sabatini, D.M. Ragulator-Rag complex targets mTORC1 to the lysosomal surface and is necessary for its activation by amino acids. Cell 2010, 141, 290–303. [Google Scholar] [CrossRef]
  48. Hara, K.; Yonezawa, K.; Weng, Q.P.; Kozlowski, M.T.; Avruch, J. Amino acid Sufficiency and mTOR Regulate p70 S6 Kinase and eIF-4E BP1 through a Common Effector Mechanism. J. Biol. Chem. 1998, 273, 14484–14494. [Google Scholar] [CrossRef] [PubMed]
  49. Habte-Tsion, H.M. A review on fish immuno-nutritional response to indispensable amino acids in relation to TOR, NF-kappaB and Nrf2 signaling pathways: Trends and prospects. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2020, 241, 110389. [Google Scholar] [CrossRef]
  50. Carroll, B.; Maetzel, D.; Maddocks, O.D.; Otten, G.; Ratcliff, M.; Smith, G.R.; Dunlop, E.A.; Passos, J.F.; Davies, O.R.; Jaenisch, R.; et al. Control of TSC2-Rheb signaling axis by arginine regulates mTORC1 activity. Elife 2016, 5, e11058. [Google Scholar] [CrossRef]
  51. Taylor, P.M. Role of amino acid transporters in amino acid sensing. Am. J. Clin. Nutr. 2014, 99, 223S–230S. [Google Scholar] [CrossRef]
  52. Ruvinsky, I.; Meyuhas, O. Ribosomal protein S6 phosphorylation: From protein synthesis to cell size. Trends Biochem. Sci. 2006, 31, 342–348. [Google Scholar] [CrossRef] [PubMed]
  53. Kim, J.; Song, G.; Wu, G.; Gao, H.; Johnson, G.A.; Bazer, F.W. Arginine, leucine, and glutamine stimulate proliferation of porcine trophectoderm cells through the MTOR-RPS6K-RPS6-EIF4EBP1 signal transduction pathway. Biol. Reprod. 2013, 88, 113. [Google Scholar] [CrossRef] [PubMed]
  54. Hellsten, S.V.; Tripathi, R.; Ceder, M.M.; Fredriksson, R. Nutritional Stress Induced by Amino Acid Starvation Results in Changes for Slc38 Transporters in Immortalized Hypothalamic Neuronal Cells and Primary Cortex Cells. Front Mol. Biosci. 2018, 5, 45. [Google Scholar] [CrossRef]
  55. Graber, T.G.; Borack, M.S.; Reidy, P.T.; Volpi, E.; Rasmussen, B.B. Essential amino acid ingestion alters expression of genes associated with amino acid sensing, transport, and mTORC1 regulation in human skeletal muscle. Nutr. Metab. 2017, 14, 35. [Google Scholar] [CrossRef]
  56. Sun, Y.; Wu, Z.; Li, W.; Zhang, C.; Sun, K.; Ji, Y.; Wang, B.; Jiao, N.; He, B.; Wang, W.; et al. Dietary L-leucine supplementation enhances intestinal development in suckling piglets. Amino. Acids. 2015, 47, 1517–1525. [Google Scholar] [CrossRef]
  57. Lin, M.; Zhang, B.; Yu, C.; Li, J.; Zhang, L.; Sun, H.; Gao, F.; Zhou, G. L-Glutamate supplementation improves small intestinal architecture and enhances the expressions of jejunal mucosa amino acid receptors and transporters in weaning piglets. PLoS ONE 2014, 9, e111950. [Google Scholar] [CrossRef]
  58. Cui, X.; Han, F.; Chi, S.; Tan, B.; Dong, X.; Yang, Q.; Liu, H.; Zhang, S. Molecular cloning of the amino acid transporter b0,+AT cDNA from the orange-spotted grouper (Epinephelus coioides) and the effect of arginine on its expression. Aquac. Nutr. 2020, 26, 876–884. [Google Scholar] [CrossRef]
  59. Liu, G.Y.; Sabatini, D.M. mTOR at the nexus of nutrition, growth, ageing and disease. Nat. Rev. Mol. Cell Biol. 2020, 21, 183–203. [Google Scholar] [CrossRef]
  60. Huang, S. mTOR Signaling in Metabolism and Cancer. Cells 2020, 9, 2278. [Google Scholar] [CrossRef]
  61. Wyant, G.A.; Abu-Remaileh, M.; Wolfson, R.L.; Chen, W.W.; Freinkman, E.; Danai, L.V.; Vander Heiden, M.G.; Sabatini, D.M. mTORC1 Activator SLC38A9 Is Required to Efflux Essential Amino Acids from Lysosomes and Use Protein as a Nutrient. Cell 2017, 171, 642–654. [Google Scholar] [CrossRef] [PubMed]
  62. Mukhopadhyay, S.; Vander Heiden, M.G.; McCormick, F. The Metabolic Landscape of RAS-Driven Cancers from biology to therapy. Nat. Cancer 2021, 2, 271–283. [Google Scholar] [CrossRef]
  63. Rebsamen, M.; Superti-Furga, G. Antagonists of slc38a9 and their use in therapy. WO2015173398, 19 November 2015. [Google Scholar]
  64. Saqcena, M.; Menon, D.; Patel, D.; Mukhopadhyay, S.; Chow, V.; Foster, D.A. Amino acids and mTOR mediate distinct metabolic checkpoints in mammalian G1 cell cycle. PLoS ONE 2013, 8, e74157. [Google Scholar] [CrossRef] [PubMed]
  65. Mukhopadhyay, S.; Saqcena, M.; Foster, D.A. Synthetic lethality in KRas-driven cancer cells created by glutamine deprivation. Oncoscience 2015, 2, 807–808. [Google Scholar] [CrossRef] [PubMed]
  66. Kumari, N.; Bansal, S. Arginine depriving enzymes: Applications as emerging therapeutics in cancer treatment. Cancer Chemother Pharm. 2021, 88, 565–594. [Google Scholar] [CrossRef]
  67. Du, T.; Han, J. Arginine Metabolism and Its Potential in Treatment of Colorectal Cancer. Front. Cell Dev. Biol. 2021, 9, 658861. [Google Scholar] [CrossRef]
Figure 1. Nucleotide and deduced amino acid sequences of Solute Carrier Family 38 Member 9 (slc38a9). The initiation codon (ATG) is shaded in grey and the asterisks (*) indicate the translation stop codon (TAG). The predicted transmembrane regions are indicated in rectangular boxes.
Figure 1. Nucleotide and deduced amino acid sequences of Solute Carrier Family 38 Member 9 (slc38a9). The initiation codon (ATG) is shaded in grey and the asterisks (*) indicate the translation stop codon (TAG). The predicted transmembrane regions are indicated in rectangular boxes.
Cells 10 02552 g001
Figure 2. Sequence, structural, phylogenetic, and distribution analysis results of SLC38A9 in abalone. (A) Multiple alignment of amino acid sequence of slc38a9, identity amino acids are shown in black and homologous amino acids in grey. (B) The phylogenetic tree of slc38a9 sequences, abalone is highlighted with “☆”. The numbers represent bootstrap percentages with the tree topology presented after 1000 replicates. The accession number was indicated after the species name. (C) Predicted tertiary structure of abalone SLC38A9 protein. (D) Tissues distribution of slc38a9 in abalone. Results are represented as mean ± SEM (n = 3 replicate experiments), and different lowercase letters (a < b < c) indicate significant differences among tissues (p < 0.05).
Figure 2. Sequence, structural, phylogenetic, and distribution analysis results of SLC38A9 in abalone. (A) Multiple alignment of amino acid sequence of slc38a9, identity amino acids are shown in black and homologous amino acids in grey. (B) The phylogenetic tree of slc38a9 sequences, abalone is highlighted with “☆”. The numbers represent bootstrap percentages with the tree topology presented after 1000 replicates. The accession number was indicated after the species name. (C) Predicted tertiary structure of abalone SLC38A9 protein. (D) Tissues distribution of slc38a9 in abalone. Results are represented as mean ± SEM (n = 3 replicate experiments), and different lowercase letters (a < b < c) indicate significant differences among tissues (p < 0.05).
Cells 10 02552 g002
Figure 3. siRNA-slc38a9 inhibits the expression of slc38a9 and the TOR signaling pathway. (A) The relative expression levels of slc38a9 in the muscle of abalones after injection with siRNA. (B) The relative expression levels of slc38a9 in muscle at different time after injection with siRNA-347. (C) The relative expression levels of target of rapamycin (tor), ribosomal s6 protein kinase (s6k), eukaryotic translation initiation factor 4e binding protein (4e-bp) and eukaryotic translation initiation factor 4e (eif4e) in muscle at 12 h after slc38a9 knockdown. Results are represented as mean ± SEM. Different lowercase letters (a < b < c) indicate significant differences among groups (p < 0.05), and asterisk (*) indicates a significant difference between the control and the experimental group (p < 0.05).
Figure 3. siRNA-slc38a9 inhibits the expression of slc38a9 and the TOR signaling pathway. (A) The relative expression levels of slc38a9 in the muscle of abalones after injection with siRNA. (B) The relative expression levels of slc38a9 in muscle at different time after injection with siRNA-347. (C) The relative expression levels of target of rapamycin (tor), ribosomal s6 protein kinase (s6k), eukaryotic translation initiation factor 4e binding protein (4e-bp) and eukaryotic translation initiation factor 4e (eif4e) in muscle at 12 h after slc38a9 knockdown. Results are represented as mean ± SEM. Different lowercase letters (a < b < c) indicate significant differences among groups (p < 0.05), and asterisk (*) indicates a significant difference between the control and the experimental group (p < 0.05).
Cells 10 02552 g003
Figure 4. Effect of slc38a9 overexpression on the TOR signaling pathway in abalone. The relative expression levels of (A) slc38a9, (B) tor, (C) s6k, (D) 4e-bp and (E) eif4e in abalones after injection with plasmid. Results are represented as mean ± SEM (n = 3 replicate experiments), and asterisk (*) indicates a significant difference compared with the control group (p < 0.05).
Figure 4. Effect of slc38a9 overexpression on the TOR signaling pathway in abalone. The relative expression levels of (A) slc38a9, (B) tor, (C) s6k, (D) 4e-bp and (E) eif4e in abalones after injection with plasmid. Results are represented as mean ± SEM (n = 3 replicate experiments), and asterisk (*) indicates a significant difference compared with the control group (p < 0.05).
Cells 10 02552 g004
Figure 5. Effect of slc38a9 knockdown on arginine-induced activation of the TOR signaling pathway in muscle. Abalones were orally administered arginine (0.1 mmol/L, 100 μL) or PBS after slc38a9 knockdown. The figures show the expression levels of (A) slc38a9, (B) tor, (C) s6k and (D) eif4e in muscles after oral administration. Results are represented as mean ± SEM (n = 3 replicate experiments), and asterisk (*) indicate a significant difference between the two groups (p < 0.05).
Figure 5. Effect of slc38a9 knockdown on arginine-induced activation of the TOR signaling pathway in muscle. Abalones were orally administered arginine (0.1 mmol/L, 100 μL) or PBS after slc38a9 knockdown. The figures show the expression levels of (A) slc38a9, (B) tor, (C) s6k and (D) eif4e in muscles after oral administration. Results are represented as mean ± SEM (n = 3 replicate experiments), and asterisk (*) indicate a significant difference between the two groups (p < 0.05).
Cells 10 02552 g005
Figure 6. Effect of slc38a9 knockdown on the activation of the TOR signaling pathway by dietary arginine. Abalones were fed with basal (1.23% arginine) and arginine-added (1.72% arginine) diets for two weeks before siRNA knockdown, abalones fed with basal diet served as the control group. After 12 h of siRNA injection, abalones were fed with the original diets. The figure shows the relative expression levels of (A) slc38a9, (B) tor, (C) s6k and (D) eif4e in muscle at different times after feeding. Results are represented as mean ± SEM, n = 3 replicate experiments. Different lowercase letters (a < b < c < d) indicate significant differences of the same group at different times, and capital letters (A < B < C < D) indicate the significance of different treatments at the same time (p < 0.05).
Figure 6. Effect of slc38a9 knockdown on the activation of the TOR signaling pathway by dietary arginine. Abalones were fed with basal (1.23% arginine) and arginine-added (1.72% arginine) diets for two weeks before siRNA knockdown, abalones fed with basal diet served as the control group. After 12 h of siRNA injection, abalones were fed with the original diets. The figure shows the relative expression levels of (A) slc38a9, (B) tor, (C) s6k and (D) eif4e in muscle at different times after feeding. Results are represented as mean ± SEM, n = 3 replicate experiments. Different lowercase letters (a < b < c < d) indicate significant differences of the same group at different times, and capital letters (A < B < C < D) indicate the significance of different treatments at the same time (p < 0.05).
Cells 10 02552 g006
Figure 7. Effect of arginine on TOR signaling pathway of abalone in vitro. The relative expression levels of (A) slc38a9, (B) tor, (C) s6k, (D) 4e-bp and (E) eif4e of hemocytes treated with different arginine levels (0, 0.2, 0.5, 1, 2 and 4 mmol/L). Results are represented as mean ± SEM (n = 3 replicate experiments), and different lowercase letters (a < b < c < d) indicate significant differences among groups (p < 0.05).
Figure 7. Effect of arginine on TOR signaling pathway of abalone in vitro. The relative expression levels of (A) slc38a9, (B) tor, (C) s6k, (D) 4e-bp and (E) eif4e of hemocytes treated with different arginine levels (0, 0.2, 0.5, 1, 2 and 4 mmol/L). Results are represented as mean ± SEM (n = 3 replicate experiments), and different lowercase letters (a < b < c < d) indicate significant differences among groups (p < 0.05).
Cells 10 02552 g007
Figure 8. Effect of arginine on TOR signaling pathway of abalone in vivo. The expression levels of slc38a9, tor, s6k, 4e-bp and eif4e in muscle (A) and digestive gland (B) of abalone fed diets with different arginine levels (1.17%, 1.68% and 3.43%) for 120 d. (C,D) The abundance of phosphorylated TOR, Ribosomal S6 (S6) and 4E-BP protein in muscle of abalone fed diets with different arginine levels for 120 d. Results are represented as mean ± SEM (n = 3 replicate experiments), and different lowercase letters (a < b < c) indicate significant differences among groups (p < 0.05).
Figure 8. Effect of arginine on TOR signaling pathway of abalone in vivo. The expression levels of slc38a9, tor, s6k, 4e-bp and eif4e in muscle (A) and digestive gland (B) of abalone fed diets with different arginine levels (1.17%, 1.68% and 3.43%) for 120 d. (C,D) The abundance of phosphorylated TOR, Ribosomal S6 (S6) and 4E-BP protein in muscle of abalone fed diets with different arginine levels for 120 d. Results are represented as mean ± SEM (n = 3 replicate experiments), and different lowercase letters (a < b < c) indicate significant differences among groups (p < 0.05).
Cells 10 02552 g008
Figure 9. The potential mechanism of arginine on the TOR signaling pathway of abalone H. discus hannai in the present study. Arginine activates TOR through SLC38A9, and then the phosphorylation of S6 and 4EBP and the expression of s6k and eif4e were activated to promote protein synthesis. The unidentified proteins in abalone are shown in grey.
Figure 9. The potential mechanism of arginine on the TOR signaling pathway of abalone H. discus hannai in the present study. Arginine activates TOR through SLC38A9, and then the phosphorylation of S6 and 4EBP and the expression of s6k and eif4e were activated to promote protein synthesis. The unidentified proteins in abalone are shown in grey.
Cells 10 02552 g009
Table 1. Sequences of primers for gene cloning and RT-PCR.
Table 1. Sequences of primers for gene cloning and RT-PCR.
NamePrimer Sequence (5′ to 3′)Accession No.
Gene Cloning
slc38a9F: GAGGCGGCTATGGGTCAAT
R: CTGAGAACAGGTCCGAGGT
MW390888
Real-Time PCR
torF: AGATTCCCTTCCGATTGACGA
R: GTACGGCCATCAGACTGTCC
MT473702
s6kF: GCCCCTGCTTTACTCGATG
R: CAGCTCTTCACACCCGGTA
MT497737
4e-bpF: ATCGGTCTTTCTTACTGGAATGTCG
R: AGGCTGTTCTTCAGGGTGGTC
MT497738
eif4eF: AGAATCAGCGTTGTATCACCT
R: TGCGAGAATCTTCCCATGCC
MW183129
slc38a9F: CGCCATGTCCTGATGCTC
R: TGGCATACGAGAACCCACA
MW390888
β-actinF: ACTCCATCATGAAGTGCGAT
R: TTCTGCATACGGTCAGCGAT
AY380809.1
Table 2. Sequences of siRNA-slc38a9 for different sites.
Table 2. Sequences of siRNA-slc38a9 for different sites.
SiteForward (5′-3′)Reverse (5′-3′)
siRNA-108GCTACTCAGTCGCTACAAATTTGTAGCGACTGAGTAGC
siRNA-236GCAGCATCATCACCATCTTAAGATGGTGATGATGCTGC
siRNA-347CCAGCTACAGAATACTCAATTGAGTATTCTGTAGCTGG
siRNA-469GCAGAAATAGGAGCAGTTATAACTGCTCCTATTTCTGC
Table 3. Ingredients and proximate analysis of the experimental diets.
Table 3. Ingredients and proximate analysis of the experimental diets.
IngredientsDietary Arginine Levels (%)
1.231.72
Casein2222
Gelatin55
Dextrin3535
Fish oil + Soybean oil a3.53.5
CM-cellulose66
Microcrystalline cellulose1.51
Sodium alginate2020
Mineral mix b4.54.5
Vitamin mix c22
Choline chloride0.50.5
Arginine 00.5
Proximate analysis (% dry matter)
Moisture28.828.4
Crude protein28.729.4
Crude lipid3.843.67
Arginine1.231.72
a Fish oil: soybean oil = 1:1. b Mineral premix (each/kg diet): NaCl, 0.4 g; MgSO4·7H2O, 6.0 g; NaH2PO4·2H2O, 10.0 g; KH2PO4, 12.8 g; Ca (H2PO4)2·H2O, 8.0 g; Fe-citrate, 1.0 g; calcium lactate, 1.4 g; ZnSO4·7H2O, 141 mg; MnSO4·H2O, 64.8 mg; CuSO4·5H2O, 12.4 mg; CoCl2·6H2O, 4 mg; KIO3, 1.2 mg; microcrystalline cellulose, 4.85 g. c Vitamin premix (each/kg diet): thiamine, 120 mg; riboflavin, 100 mg; folic acid, 30 mg; nicotinic acid, 800 mg; vitamin B6, 40 mg; calcium pantothenate, 200 mg; inositol, 4 g; biotin, 12.0 mg; vitamin C, 4 g; vitamin B12, 0.18 mg; vitamin A, 1.0 × 105 IU; vitamin D, 2.0 × 103 IU; vitamin E, 450 IU; vitamin K3, 80 mg; microcrystalline cellulose, 1.26 g.
Table 4. Ingredients and proximate analysis of the experimental diets.
Table 4. Ingredients and proximate analysis of the experimental diets.
IngredientsDietary Arginine Levels (%)
1.171.683.43
Fish meal333
Soy protein concentrate333
Corn gluten meal242424
Wheat gluten555
High gluten flour2525.225.2
Fish oil + Soybean oil a1.61.61.6
Calcium dihydrogen phosphate222
Choline chloride0.20.20.2
Mineral mixture b111
Vitamin mixture c111
Ethoxyquinoline0.10.10.1
Calcium propionate0.10.10.1
Vitamin C0.40.40.4
Kelp powder313131
L-arginine00.82.4
L-glycine2.41.60
Proximate Analysis (% dry matter)
Moisture4.445.324.52
Crude protein32.231.932.5
Crude lipid2.982.953.02
Ash17.616.817.6
Arginine1.171.683.43
a Fish oil: soybean oil = 1:1. b Mineral premix (each/100g premix): NaCl, 1 g; MgSO4·7H2O, 15 g; NaH2PO4·2H2O, 25 g; KH2PO4, 32 g; Ca (H2PO4)2·H2O, 20 g; Fe-citrate, 2.5 g; calcium lactate, 3.5 g; ZnSO4·7H2O, 0.35 g; MnSO4·H2O, 0.16 g; CuSO4·5H2O, 31 mg; CoCl2·6H2O, 1 mg; KIO3, 3 mg. c itamin premix (each/100g premix): thiamine, 1.2 g; riboflavin, 1 g; folic acid, 300 mg; nicotinic acid, 8 g; vitamin B6, 400 mg; calcium pantothenate, 2 g; inositol, 40 g; biotin, 120 mg; vitamin B12, 1.8 mg; vitamin A, 1.0 × 106 IU; vitamin D, 2 × 104 IU; vitamin E, 450 IU; vitamin K3, 800 mg; microcrystalline cellulose, 2.69 g.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Liu, Y.; Yu, H.; Guo, Y.; Huang, D.; Liu, J.; Pan, M.; Wang, L.; Zhang, W.; Mai, K. Arginine Regulates TOR Signaling Pathway through SLC38A9 in Abalone Haliotis discus hannai. Cells 2021, 10, 2552. https://doi.org/10.3390/cells10102552

AMA Style

Liu Y, Yu H, Guo Y, Huang D, Liu J, Pan M, Wang L, Zhang W, Mai K. Arginine Regulates TOR Signaling Pathway through SLC38A9 in Abalone Haliotis discus hannai. Cells. 2021; 10(10):2552. https://doi.org/10.3390/cells10102552

Chicago/Turabian Style

Liu, Yue, Haixia Yu, Yanlin Guo, Dong Huang, Jiahuan Liu, Mingzhu Pan, Liu Wang, Wenbing Zhang, and Kangsen Mai. 2021. "Arginine Regulates TOR Signaling Pathway through SLC38A9 in Abalone Haliotis discus hannai" Cells 10, no. 10: 2552. https://doi.org/10.3390/cells10102552

APA Style

Liu, Y., Yu, H., Guo, Y., Huang, D., Liu, J., Pan, M., Wang, L., Zhang, W., & Mai, K. (2021). Arginine Regulates TOR Signaling Pathway through SLC38A9 in Abalone Haliotis discus hannai. Cells, 10(10), 2552. https://doi.org/10.3390/cells10102552

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop