The N-Terminal Domain of Spike Protein Is Not the Enteric Tropism Determinant for Transmissible Gastroenteritis Virus in Piglets
Abstract
1. Introduction
2. Materials and Methods
2.1. Cells and Viruses
2.2. Amplification of TGEV cDNAs and Sequence Analysis
2.3. Construction of the TGEV Subclones
2.4. Assembly of Full-length TGEV Infectious Clone
2.5. Rescue of the TGEV-GFP Infectious Clone in PK-15 Cells
2.6. sgRNA Generation and Evaluation of Its Transcript Integrity and Quantity
2.7. Specific Cleavage of pTGEV-GFP BAC by the CRISPR/Cas9 System In Vitro
2.8. Construction and Recovery of the Recombinant Virus Containing the S_NTD224 Mutation
2.9. Growth Curves of Viruses
2.10. Viral Fluorescent Plaque Assay
2.11. Animal Experiments with Piglets
2.12. Ethics Statement
3. Results
3.1. Design of a TGEV Infectious Clone and Rescue of the Recombinant Virus
3.2. Establishment of a Novel Approach for Coronavirus Gene Editing Using the CRISPR-Cas9 System
3.3. Recovery and Characteristics of the Mutant Virus TGEV-GFP-ΔS_NTD in PK-15 Cells
3.4. S_NTD224 Is Not the Enteric Tropism Determinant for TGEV
4. Discussion
4.1. Efficient Targeted CoV Gene Editing
4.2. S_NTD224 of TGEV Had a Mild Influence on TGEV Virulence but Was Not the Enteric Tropism and Virulence Determinant
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- De Wit, E.; van Doremalen, N.; Falzarano, D.; Munster, V.J. SARS and MERS: Recent insights into emerging coronaviruses. Nat. Rev. Microbiol. 2016, 14, 523–534. [Google Scholar] [CrossRef] [Scilit]
- Lai, C.C.; Jou, M.J.; Huang, S.Y.; Li, S.W.; Wan, L.; Tsai, F.J.; Lin, C.W. Proteomic analysis of up-regulated proteins in human promonocyte cells expressing severe acute respiratory syndrome coronavirus 3C-like protease. Proteomics 2007, 7, 1446–1460. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Masters, P.S.; Kuo, L.; Ye, R.; Hurst, K.R.; Koetzner, C.A.; Hsue, B. Genetic and molecular biological analysis of protein-protein interactions in coronavirus assembly. Adv. Exp. Med. Biol. 2006, 581, 163–173. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Woo, P.C.; Lau, S.K.; Lam, C.S.; Lau, C.C.; Tsang, A.K.; Lau, J.H.; Bai, R.; Teng, J.L.; Tsang, C.C.; Wang, M.; et al. Discovery of seven novel Mammalian and avian coronaviruses in the genus deltacoronavirus supports bat coronaviruses as the gene source of alphacoronavirus and betacoronavirus and avian coronaviruses as the gene source of gammacoronavirus and deltacoronavirus. J. Virol. 2012, 86, 3995–4008. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Drosten, C.; Gunther, S.; Preiser, W.; van der Werf, S.; Brodt, H.R.; Becker, S.; Rabenau, H.; Panning, M.; Kolesnikova, L.; Fouchier, R.A.; et al. Identification of a novel coronavirus in patients with severe acute respiratory syndrome. N. Engl. J. Med. 2003, 348, 1967–1976. [Google Scholar] [CrossRef] [Scilit]
- Kuiken, T.; Fouchier, R.A.; Schutten, M.; Rimmelzwaan, G.F.; van Amerongen, G.; van Riel, D.; Laman, J.D.; de Jong, T.; van Doornum, G.; Lim, W.; et al. Newly discovered coronavirus as the primary cause of severe acute respiratory syndrome. Lancet 2003, 362, 263–270. [Google Scholar] [CrossRef] [Scilit]
- Danielsson, N.; ECDC Internal Response Team; Catchpole, M. Novel coronavirus associated with severe respiratory disease: Case definition and public health measures. Euro Surveill. 2012, 17, 20282. [Google Scholar] [CrossRef] [Scilit]
- Sun, R.Q.; Cai, R.J.; Chen, Y.Q.; Liang, P.S.; Chen, D.K.; Song, C.X. Outbreak of Porcine epidemic diarrhea in suckling Piglets, China. Emerg. Infect. Dis. 2012, 18, 161–163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stevenson, G.W.; Hoang, H.; Schwartz, K.J.; Burrough, E.R.; Sun, D.; Madson, D.; Cooper, V.L.; Pillatzki, A.; Gauger, P.; Schmitt, B.J.; et al. Emergence of Porcine epidemic diarrhea virus in the United States: Clinical signs, lesions, and viral genomic sequences. J. Vet. Diagn. Investig. 2013, 25, 649–654. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fehr, A.R.; Perlman, S. Coronaviruses: An overview of their replication and pathogenesis. Methods Mol. Biol. 2015, 1282, 1–23. [Google Scholar] [CrossRef] [Scilit]
- Niederwerder, M.C.; Hesse, R.A. Swine enteric coronavirus disease: A review of 4 years with Porcine epidemic diarrhoea virus and Porcine deltacoronavirus in the United States and Canada. Transbound Emerg. Dis. 2018, 65, 660–675. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Laude, H.; Rasschaert, D.; Delmas, B.; Godet, M.; Gelfi, J.; Charley, B. Molecular biology of transmissible gastroenteritis virus. Vet. Microbiol. 1990, 23, 147–154. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Hasoksuz, M.; Spiro, D.; Halpin, R.; Wang, S.; Stollar, S.; Janies, D.; Hadya, N.; Tang, Y.; Ghedin, E.; et al. Complete genomic sequences, a key residue in the spike protein and deletions in nonstructural protein 3b of US strains of the virulent and attenuated coronaviruses, transmissible gastroenteritis virus and porcine respiratory coronavirus. Virology 2007, 358, 424–435. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Delmas, B.; Gelfi, J.; L’Haridon, R.; Vogel, L.K.; Sjostrom, H.; Noren, O.; Laude, H. Aminopeptidase N is a major receptor for the entero-pathogenic coronavirus TGEV. Nature 1992, 357, 417–420. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Delmas, B.; Gelfi, J.; Sjostrom, H.; Noren, O.; Laude, H. Further characterization of aminopeptidase-N as a receptor for coronaviruses. Adv. Exp. Med. Biol. 1993, 342, 293–298. [Google Scholar] [CrossRef] [Scilit]
- Schultze, B.; Krempl, C.; Ballesteros, M.L.; Shaw, L.; Schauer, R.; Enjuanes, L.; Herrler, G. Transmissible gastroenteritis coronavirus, but not the related porcine respiratory coronavirus, has a sialic acid (N-glycolylneuraminic acid) binding activity. J. Virol. 1996, 70, 5634–5637. [Google Scholar] [PubMed]
- Ballesteros, M.L.; Sanchez, C.M.; Enjuanes, L. Two amino acid changes at the N-terminus of transmissible gastroenteritis coronavirus spike protein result in the loss of enteric tropism. Virology 1997, 227, 378–388. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, L.; Hayes, J.; Lewis, P.; Parwani, A.V.; Chang, K.O.; Saif, L.J. Molecular characterization and pathogenesis of transmissible gastroenteritis coronavirus (TGEV) and porcine respiratory coronavirus (PRCV) field isolates co-circulating in a swine herd. Arch. Virol. 2000, 145, 1133–1147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hulswit, R.J.; de Haan, C.A.; Bosch, B.J. Coronavirus Spike Protein and Tropism Changes. Adv. Virus Res. 2016, 96, 29–57. [Google Scholar]
- Sanchez, C.M.; Izeta, A.; Sanchez-Morgado, J.M.; Alonso, S.; Sola, I.; Balasch, M.; Plana-Duran, J.; Enjuanes, L. Targeted recombination demonstrates that the spike gene of transmissible gastroenteritis coronavirus is a determinant of its enteric tropism and virulence. J. Virol. 1999, 73, 7607–7618. [Google Scholar] [PubMed]
- Usami, Y.; Fukai, K.; Ichikawa, Y.; Okuda, Y.; Shibata, I.; Motoyama, C.; Imai, K.; Kirisawa, R. Virological and serological studies of porcine respiratory coronavirus infection on a Japanese farm. J. Vet. Med. Sci. 2008, 70, 929–936. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Almazan, F.; Dediego, M.L.; Galan, C.; Escors, D.; Alvarez, E.; Ortego, J.; Sola, I.; Zuniga, S.; Alonso, S.; Moreno, J.L.; et al. Construction of a severe acute respiratory syndrome coronavirus infectious cDNA clone and a replicon to study coronavirus RNA synthesis. J. Virol. 2006, 80, 10900–10906. [Google Scholar] [CrossRef] [Scilit]
- Yount, B.; Curtis, K.M.; Baric, R.S. Strategy for systematic assembly of large RNA and DNA genomes: Transmissible gastroenteritis virus model. J. Virol. 2000, 74, 10600–10611. [Google Scholar] [CrossRef] [Scilit]
- Yount, B.; Curtis, K.M.; Fritz, E.A.; Hensley, L.E.; Jahrling, P.B.; Prentice, E.; Denison, M.R.; Geisbert, T.W.; Baric, R.S. Reverse genetics with a full-length infectious cDNA of severe acute respiratory syndrome coronavirus. Proc. Natl. Acad. Sci. USA 2003, 100, 12995–13000. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jengarn, J.; Wongthida, P.; Wanasen, N.; Frantz, P.N.; Wanitchang, A.; Jongkaewwattana, A. Genetic manipulation of Porcine epidemic diarrhoea virus recovered from a full-length infectious cDNA clone. J. Gen. Virol. 2015, 96, 2206–2218. [Google Scholar] [CrossRef] [Scilit]
- Almazan, F.; DeDiego, M.L.; Sola, I.; Zuniga, S.; Nieto-Torres, J.L.; Marquez-Jurado, S.; Andres, G.; Enjuanes, L. Engineering a replication-competent, propagation-defective Middle East respiratory syndrome coronavirus as a vaccine candidate. mBio 2013, 4, e00650-13. [Google Scholar] [CrossRef] [Scilit]
- Almazan, F.; Gonzalez, J.M.; Penzes, Z.; Izeta, A.; Calvo, E.; Plana-Duran, J.; Enjuanes, L. Engineering the largest RNA virus genome as an infectious bacterial artificial chromosome. Proc. Natl. Acad. Sci. USA 2000, 97, 5516–5521. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beall, A.; Yount, B.; Lin, C.M.; Hou, Y.; Wang, Q.; Saif, L.; Baric, R. Characterization of a pathogenic full-length cDNA clone and transmission model for Porcine epidemic diarrhea virus strain PC22A. mBio 2016, 7, e01451-15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fan, B.; Yu, Z.; Pang, F.; Xu, X.; Zhang, B.; Guo, R.; He, K.; Li, B. Characterization of a pathogenic full-length cDNA clone of a virulent Porcine epidemic diarrhea virus strain AH2012/12 in China. Virology 2017, 500, 50–61. [Google Scholar] [CrossRef] [Scilit]
- Garcia, D.M.; Costa, S.; Sarraseca, J.; de la Roja, N.; Garcia, J.; Garcia, I.; Rodriguez, M.J. Generation of porcine reproductive and respiratory syndrome (PRRS) virus-like-particles (VLPs) with different protein composition. J. Virol. Methods 2016, 236, 77–86. [Google Scholar] [CrossRef] [Scilit]
- Almazan, F.; Sola, I.; Zuniga, S.; Marquez-Jurado, S.; Morales, L.; Becares, M.; Enjuanes, L. Coronavirus reverse genetic systems: Infectious clones and replicons. Virus Res. 2014, 189, 262–270. [Google Scholar] [CrossRef] [Scilit]
- Li, C.; Li, Z.; Zou, Y.; Wicht, O.; van Kuppeveld, F.J.; Rottier, P.J.; Bosch, B.J. Manipulation of the Porcine epidemic diarrhea virus genome using targeted RNA recombination. PLoS ONE 2013, 8, e69997. [Google Scholar] [CrossRef] [Scilit]
- Muth, D.; Meyer, B.; Niemeyer, D.; Schroeder, S.; Osterrieder, N.; Muller, M.A.; Drosten, C. Transgene expression in the genome of Middle East respiratory syndrome coronavirus based on a novel reverse genetics system utilizing red-mediated recombination cloning. J. Gen. Virol. 2017, 98, 2461. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Casais, R.; Thiel, V.; Siddell, S.G.; Cavanagh, D.; Britton, P. Reverse genetics system for the avian coronavirus infectious bronchitis virus. J. Virol. 2001, 75, 12359–12369. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Beurden, S.J.; Berends, A.J.; Kramer-Kuhl, A.; Spekreijse, D.; Chenard, G.; Philipp, H.C.; Mundt, E.; Rottier, P.J.M.; Verheije, M.H. A reverse genetics system for avian coronavirus infectious bronchitis virus based on targeted RNA recombination. Virol. J. 2017, 14, 109. [Google Scholar] [CrossRef] [Scilit]
- Gonzalez, J.M.; Penzes, Z.; Almazan, F.; Calvo, E.; Enjuanes, L. Stabilization of a full-length infectious cDNA clone of transmissible gastroenteritis coronavirus by insertion of an intron. J. Virol. 2002, 76, 4655–4661. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bickerton, E.; Keep, S.M.; Britton, P. Reverse genetics system for the avian coronavirus infectious bronchitis virus. Methods Mol. Biol. 2017, 1602, 83–102. [Google Scholar] [CrossRef] [Scilit]
- Masters, P.S.; Rottier, P.J. Coronavirus reverse genetics by targeted RNA recombination. Curr. Top. Microbiol. Immunol. 2005, 287, 133–159. [Google Scholar] [CrossRef] [Scilit]
- Jiang, W.; Bikard, D.; Cox, D.; Zhang, F.; Marraffini, L.A. RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat. Biotechnol. 2013, 31, 233–239. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mali, P.; Yang, L.; Esvelt, K.M.; Aach, J.; Guell, M.; DiCarlo, J.E.; Norville, J.E.; Church, G.M. RNA-guided human genome engineering via Cas9. Science 2013, 339, 823–826. [Google Scholar] [CrossRef] [Scilit]
- Tong, Y.; Charusanti, P.; Zhang, L.; Weber, T.; Lee, S.Y. CRISPR-Cas9 based engineering of actinomycetal genomes. ACS Synth. Biol. 2015, 4, 1020–1029. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jinek, M.; Chylinski, K.; Fonfara, I.; Hauer, M.; Doudna, J.A.; Charpentier, E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 2012, 337, 816–821. [Google Scholar] [CrossRef] [Scilit]
- Karvelis, T.; Gasiunas, G.; Siksnys, V. Programmable DNA cleavage in vitro by Cas9. Biochem. Soc. Trans. 2013, 41, 1401–1406. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, W.; Zhao, X.; Gabrieli, T.; Lou, C.; Ebenstein, Y.; Zhu, T.F. Cas9-assisted targeting of chromosome segments CATCH enables one-step targeted cloning of large gene clusters. Nat. Commun. 2015, 6, 8101. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Tao, W.; Wen, S.; Li, Z.; Yang, A.; Deng, Z.; Sun, Y. In vitro CRISPR/Cas9 system for efficient targeted DNA editing. mBio 2015, 6, e01714-15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Curtis, K.M.; Yount, B.; Baric, R.S. Heterologous gene expression from transmissible gastroenteritis virus replicon particles. J. Virol. 2002, 76, 1422–1434. [Google Scholar] [CrossRef] [Scilit]
- Sola, I.; Alonso, S.; Zuniga, S.; Balasch, M.; Plana-Duran, J.; Enjuanes, L. Engineering the transmissible gastroenteritis virus genome as an expression vector inducing lactogenic immunity. J. Virol. 2003, 77, 4357–4369. [Google Scholar] [CrossRef] [Scilit]
- St-Jean, J.R.; Desforges, M.; Almazan, F.; Jacomy, H.; Enjuanes, L.; Talbot, P.J. Recovery of a neurovirulent human coronavirus OC43 from an infectious cDNA clone. J. Virol. 2006, 80, 3670–3674. [Google Scholar] [CrossRef] [Scilit]
- Zeng, L.P.; Gao, Y.T.; Ge, X.Y.; Zhang, Q.; Peng, C.; Yang, X.L.; Tan, B.; Chen, J.; Chmura, A.A.; Daszak, P.; et al. Bat severe acute respiratory syndrome-like coronavirus WIV1 encodes an extra accessory protein, ORFX, involved in modulation of the host immune response. J. Virol. 2016, 90, 6573–6582. [Google Scholar] [CrossRef] [Scilit]
- Costantini, V.; Lewis, P.; Alsop, J.; Templeton, C.; Saif, L.J. Respiratory and fecal shedding of porcine respiratory coronavirus (PRCV) in sentinel weaned pigs and sequence of the partial S-gene of the PRCV isolates. Arch. Virol. 2004, 149, 957–974. [Google Scholar] [CrossRef] [Scilit]
- Furuuchi, S.; Shimizu, M.; Shimizu, Y. Field trials on transmissible gastroenteritis live virus vaccine in newborn Piglets. Natl. Inst. Anim. Health Q. (Tokyo) 1978, 18, 135–142. [Google Scholar]
- Wesley, R.D.; Woods, R.D.; Cheung, A.K. Genetic basis for the pathogenesis of transmissible gastroenteritis virus. J. Virol. 1990, 64, 4761–4766. [Google Scholar] [PubMed]
- Almazan, F.; Marquez-Jurado, S.; Nogales, A.; Enjuanes, L. Engineering infectious cDNAs of coronavirus as bacterial artificial chromosomes. Methods Mol. Biol. 2015, 1282, 135–152. [Google Scholar] [CrossRef] [Scilit]
- Wu, N.C.; Young, A.P.; Al-Mawsawi, L.Q.; Olson, C.A.; Feng, J.; Qi, H.; Luan, H.H.; Li, X.; Wu, T.T.; Sun, R. High-throughput identification of loss-of-function mutations for anti-interferon activity in the influenza A virus NS segment. J. Virol. 2014, 88, 10157–10164. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, N.C.; Young, A.P.; Al-Mawsawi, L.Q.; Olson, C.A.; Feng, J.; Qi, H.; Chen, S.H.; Lu, I.H.; Lin, C.Y.; Chin, R.G.; et al. High-throughput profiling of influenza A virus hemagglutinin gene at single-nucleotide resolution. Sci. Rep. 2014, 4, 4942. [Google Scholar] [CrossRef] [Scilit]
- Du, Y.; Xin, L.; Shi, Y.; Zhang, T.H.; Wu, N.C.; Dai, L.; Gong, D.; Brar, G.; Shu, S.; Luo, J.; et al. Genome-wide identification of interferon-sensitive mutations enables influenza vaccine design. Science 2018, 359, 290–296. [Google Scholar] [CrossRef] [Scilit]
- Schwegmann-Wessels, C.; Bauer, S.; Winter, C.; Enjuanes, L.; Laude, H.; Herrler, G. The sialic acid binding activity of the S protein facilitates infection by porcine transmissible gastroenteritis coronavirus. Virol. J. 2011, 8, 435. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hou, Y.; Lin, C.M.; Yokoyama, M.; Yount, B.L.; Marthaler, D.; Douglas, A.L.; Ghimire, S.; Qin, Y.; Baric, R.S.; Saif, L.J.; et al. Deletion of a 197-amino-acid region in the N-terminal domain of spike protein attenuates Porcine epidemic diarrhea virus in Piglets. J. Virol. 2017, 91, e00227-17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deng, F.; Ye, G.; Liu, Q.; Navid, M.T.; Zhong, X.; Li, Y.; Wan, C.; Xiao, S.; He, Q.; Fu, Z.F.; et al. Identification and comparison of receptor binding characteristics of the spike protein of two Porcine epidemic diarrhea virus strains. Viruses 2016, 8, 55. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peng, G.; Sun, D.; Rajashankar, K.R.; Qian, Z.; Holmes, K.V.; Li, F. Crystal structure of mouse coronavirus receptor-binding domain complexed with its murine receptor. Proc. Natl. Acad. Sci. USA 2011, 108, 10696–10701. [Google Scholar] [CrossRef] [Scilit]
- Peng, G.; Xu, L.; Lin, Y.L.; Chen, L.; Pasquarella, J.R.; Holmes, K.V.; Li, F. Crystal structure of bovine coronavirus spike protein lectin domain. J. Biol. Chem. 2012, 287, 41931–41938. [Google Scholar] [CrossRef] [Scilit]
- Wesley, R.D.; Lager, K.M. Increased litter survival rates, reduced clinical illness and better lactogenic immunity against TGEV in gilts that were primed as neonates with porcine respiratory coronavirus (PRCV). Vet. Microbiol. 2003, 95, 175–186. [Google Scholar] [CrossRef] [Scilit]
- Underdahl, N.R.; Mebus, C.A.; Torres-Medina, A. Recovery of transmissible gastroenteritis virus from chronically infected experimental pigs. Am. J. Vet. Res. 1975, 36, 1473–1476. [Google Scholar]
- VanCott, J.L.; Brim, T.A.; Simkins, R.A.; Saif, L.J. Isotype-specific antibody-secreting cells to transmissible gastroenteritis virus and porcine respiratory coronavirus in gut- and bronchus-associated lymphoid tissues of suckling pigs. J. Immunol. 1993, 150, 3990–4000. [Google Scholar]






| Primer | Sequence |
|---|---|
| ssDNAa-F | TTAATACGACTCACTATA GGCTCCACAAAATCAATTGA GTTTTAGA GCTAGA |
| ssDNAb-F | TTAATACGACTCACTATA GGTCTTGGTATGAAGCGTAG GTTTTAGA GCTAGA |
| ssDNA-R | AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAA CGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC |
| Primer | Sequence |
|---|---|
| rec-672SF | GATGGCTCCACAAAATCAA |
| δS-NTDR | GTAGTACCATTTTTATTTCCATAAATCAATGGCATTACG |
| δS-NTDF | AATAAAAATGGTACTACCGTAG |
| rec-672SR | TGGGTTGACCATAACCAC |
| PrimerF | GACGCAGACTTCAGTGTTAC |
| PrimerR | TCAGAACGAATACAGTACAC |
| F1 | AGGGTAAGTTGCTCATTAGAAATAATGG |
| R1 | CTTCTTCAAAGCTAGGGACTG |
| F2 | TTGTGGTTTTGGTCGTAATGCC |
| R2 | GGCTGTTTGGTAACTAATTTACCA |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, G.; Liang, R.; Liu, Z.; Shen, Z.; Shi, J.; Shi, Y.; Deng, F.; Xiao, S.; Fu, Z.F.; Peng, G. The N-Terminal Domain of Spike Protein Is Not the Enteric Tropism Determinant for Transmissible Gastroenteritis Virus in Piglets. Viruses 2019, 11, 313. https://doi.org/10.3390/v11040313
Wang G, Liang R, Liu Z, Shen Z, Shi J, Shi Y, Deng F, Xiao S, Fu ZF, Peng G. The N-Terminal Domain of Spike Protein Is Not the Enteric Tropism Determinant for Transmissible Gastroenteritis Virus in Piglets. Viruses. 2019; 11(4):313. https://doi.org/10.3390/v11040313
Chicago/Turabian StyleWang, Gang, Rui Liang, Ziwei Liu, Zhou Shen, Jiale Shi, Yuejun Shi, Feng Deng, Shaobo Xiao, Zhen F. Fu, and Guiqing Peng. 2019. "The N-Terminal Domain of Spike Protein Is Not the Enteric Tropism Determinant for Transmissible Gastroenteritis Virus in Piglets" Viruses 11, no. 4: 313. https://doi.org/10.3390/v11040313
APA StyleWang, G., Liang, R., Liu, Z., Shen, Z., Shi, J., Shi, Y., Deng, F., Xiao, S., Fu, Z. F., & Peng, G. (2019). The N-Terminal Domain of Spike Protein Is Not the Enteric Tropism Determinant for Transmissible Gastroenteritis Virus in Piglets. Viruses, 11(4), 313. https://doi.org/10.3390/v11040313

