Production of a Soluble Recombinant Antibody Fragment against MMP9 Using Escherichia coli
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Construction of Anti-MMP9-scFv Gene
2.3. Expression and Purification of Protein
2.4. Enzyme-Linked Immunosorbent Assay
3. Results
3.1. Construction of an Anti-MMP9 scFv Coding Gene
3.2. Expression of Soluble Anti-MMP9 scFv
3.3. Antigen-Binding Efficiency of Anti-MMP9 scFv
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Fischer, T.; Riedl, R. Inhibitory Antibodies Designed for Matrix Metalloproteinase Modulation. Molecules 2019, 24, 2265. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gialeli, C.; Theocharis, A.D.; Karamanos, N.K. Roles of matrix metalloproteinases in cancer progression and their pharmacological targeting. FEBS J. 2011, 278, 16–27. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hassanzadeh-Makoui, R.; Razi, B.; Aslani, S.; Imani, D.; Tabaee, S.S. The association between Matrix Metallo-proteinases-9 (MMP-9) gene family polymorphisms and risk of Coronary Artery Disease (CAD): A systematic review and meta-analysis. BMC Cardiovasc. Disord. 2020, 20, 232. [Google Scholar] [CrossRef] [Scilit]
- Vandooren, J.; van den Steen, P.; Opdenakker, G. Biochemistry and molecular biology of gelatinase B or matrix metalloproteinase-9 (MMP-9): The next decade. Crit. Rev. Biochem. Mol. Biol. 2013, 48, 222–272. [Google Scholar] [CrossRef] [Scilit]
- Van Wart, H.E.; Birkedal-Hansen, H. The cysteine switch: A principle of regulation of metalloproteinase activity with potential applicability to the entire matrix metalloproteinase gene family. Proc. Natl. Acad. Sci. USA 1990, 87, 5578–5582. [Google Scholar] [CrossRef] [Scilit]
- Elkins, P.A.; Ho, Y.S.; Smith, W.W.; Janson, C.A.; D’Alessio, K.J.; McQueney, M.S.; Cummings, M.D.; Romanic, A.M. Structure of the C-terminally truncated human ProMMP9, a gelatin-binding matrix metalloproteinase. Acta Crystallogr. Sect. D Biol. Crystallogr. 2002, 58, 1182–1192. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Morini, M.; Mottolese, M.; Ferrari, N.; Ghiorzo, F.; Buglioni, S.; Mortarini, R.; Noonan, D.M.; Natali, P.G.; Albini, A. The alpha 3 beta 1 integrin is associated with mammary carcinoma cell metastasis, invasion, and gelatinase B (MMP-9) activity. Int. J. Cancer 2000, 87, 336–342. [Google Scholar] [CrossRef] [Scilit]
- van den Steen, P.; Dubois, B.; Nelissen, I.; Rudd, P.M.; Dwek, R.A.; Opdenakker, G. Biochemistry and Molecular Biology of Gelatinase B or Matrix Metalloproteinase-9 (MMP-9). Crit. Rev. Biochem. Mol. Biol. 2002, 37, 375–536. [Google Scholar] [CrossRef] [Scilit]
- Klein, T.; Bischoff, R. Physiology and pathophysiology of matrix metalloproteases. Amino Acids 2011, 41, 271–290. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, H. Matrix Metalloproteinase-9 (MMP-9) as a Cancer Biomarker and MMP-9 Biosensors: Recent Advances. Sensors 2018, 18, 3249. [Google Scholar] [CrossRef] [Scilit]
- Grant, M.; Wilson, J.; Rock, P.; Chapple, I. Induction of cytokines, MMP9, TIMPs, RANKL and OPG during orthodontic tooth movement. Eur. J. Orthod. 2012, 35, 644–651. [Google Scholar] [CrossRef] [Scilit]
- Mehner, C.; Hockla, A.; Miller, E.; Ran, S.; Radisky, D.C.; Radisky, E.S. Tumor cell-produced matrix metalloproteinase 9 (MMP-9) drives malignant progression and metastasis of basal-like triple negative breast cancer. Oncotarget 2014, 5, 2736–2749. [Google Scholar] [CrossRef] [Scilit]
- Marshall, D.C.; Lyman, S.K.; McCauley, S.; Kovalenko, M.; Spangler, R.; Liu, C.; Lee, M.; O’Sullivan, C.; Barry-Hamilton, V.; Ghermazien, H.; et al. Selective Allosteric Inhibition of MMP9 Is Efficacious in Preclinical Models of Ulcerative Colitis and Colorectal Cancer. PLoS ONE 2015, 10, e0127063. [Google Scholar] [CrossRef] [Scilit]
- Nelson, A.L. Antibody fragments: Hope and hype. mAbs 2010, 2, 77–83. [Google Scholar] [CrossRef] [Scilit]
- Crivianu-Gaita, V.; Thompson, M. Aptamers, antibody scFv, and antibody Fab′ fragments: An overview and comparison of three of the most versatile biosensor biorecognition elements. Biosens. Bioelectron. 2016, 85, 32–45. [Google Scholar] [CrossRef] [Scilit]
- Monnier, P.P.; Vigouroux, R.J.; Tassew, N.G. In Vivo Applications of Single Chain Fv (Variable Domain) (scFv) Fragments. Antibodies 2013, 2, 193–208. [Google Scholar] [CrossRef] [Scilit]
- Guglielmi, L.; Martineau, P. Expression of Single-Chain Fv Fragments in E. coli Cytoplasm. Methods Mol. Biol. 2009, 562, 215–224. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leong, S.S.; Chen, W.N. Preparing recombinant single chain antibodies. Chem. Eng. Sci. 2008, 63, 1401–1414. [Google Scholar] [CrossRef] [Scilit]
- Verma, R.; Boleti, E.; George, A. Antibody engineering: Comparison of bacterial, yeast, insect and mammalian expression systems. J. Immunol. Methods 1998, 216, 165–181. [Google Scholar] [CrossRef] [Scilit]
- Vlasak, J.; Ionescu, R. Fragmentation of monoclonal antibodies. mAbs 2011, 3, 253–263. [Google Scholar] [CrossRef] [Scilit]
- Kinman, A.W.L.; Pompano, R.R. Optimization of Enzymatic Antibody Fragmentation for Yield, Efficiency, and Binding Affinity. Bioconjugate Chem. 2019, 30, 800–807. [Google Scholar] [CrossRef] [Scilit]
- Appleby, T.C.; Greenstein, A.; Hung, M.; Liclican, A.; Velasquez, M.; Villaseñor, A.G.; Wang, R.; Wong, M.H.; Liu, X.; Papalia, G.A.; et al. Biochemical characterization and structure determination of a potent, selective antibody inhibitor of human MMP9. J. Biol. Chem. 2017, 292, 6810–6820. [Google Scholar] [CrossRef] [Scilit]
- Bendell, J.C.; Starodub, A.; Huang, X.; Maltzman, J.D.; Wainberg, Z.A.; Shah, M.A. A phase 3 randomized, double-blind, placebo-controlled study to evaluate the efficacy and safety of GS-5745 combined with mFOLFOX6 as first-line treatment in patients with advanced gastric or gastroesophageal junction adenocarcinoma. J. Clin. Oncol. 2017, 35, TPS4139. [Google Scholar] [CrossRef] [Scilit]
- Shah, M.A.; Starodub, A.N.; Sharma, S.; Berlin, J.; Patel, M.R.; Wainberg, Z.A.; Chaves, J.; Gordon, M.S.; Windsor, K.; Brachmann, C.B.; et al. Andecaliximab/GS-5745 Alone and Combined with mFOLFOX6 in Advanced Gastric and Gastroesophageal Junction Adenocarcinoma: Results from a Phase I Study. Clin. Cancer. Res. 2018, 24, 3829–3837. [Google Scholar] [CrossRef] [Scilit]
- Jeong, H.-J.; Kawamura, T.; Dong, J.; Ueda, H. Q-Bodies from Recombinant Single-Chain Fv Fragment with Better Yield and Expanded Palette of Fluorophores. ACS Sens. 2016, 1, 88–94. [Google Scholar] [CrossRef] [Scilit]
- Gutierrez-Gonzalez, M.; Farías, C.; Tello, S.; Pérez-Etcheverry, D.; Romero, A.; Zúñiga, R.; Ribeiro, C.H.; Lorenzo-Ferreiro, C.; Molina, M.C. Optimization of culture conditions for the expression of three different insoluble proteins in Escherichia coli. Sci. Rep. 2019, 9, 16850. [Google Scholar] [CrossRef] [Scilit]
- Rosano, G.L.; Ceccarelli, E.A. Recombinant protein expression in Escherichia coli: Advances and challenges. Front. Microbiol. 2014, 5, 172. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Villaverde, A.; Carrió, M.M. Protein aggregation in recombinant bacteria: Biological role of inclusion bodies. Biotechnol. Lett. 2003, 25, 1385–1395. [Google Scholar] [CrossRef] [Scilit]
- Sørensen, H.P.; Mortensen, K.K. Soluble expression of recombinant proteins in the cytoplasm of Escherichia coli. Microb. Cell Factories 2005, 4, 30. [Google Scholar] [CrossRef] [Scilit]


| VH | VL | |
|---|---|---|
| Nucleotide | caggtgcagctgcaggaaa gcggcccgggcctggtgaaac cgagcgaaaccctgagcctgac ctgcaccgtgagcggctttagcctgctgagctatggcgtgc attgggtgcgccagccgccgggcaaaggcctg gaatggctgggcgtgatttggaccggcgg caccaccaactataacagcgcgctgatgagccgctttaccat tagcaaagatgatagcaaaaacaccgtg tatctgaaaatgaacagcctgaaaaccgaaga taccgcgatttattattgcgcgcgctattattatggcatggatt attggggccagggcaccctggtgaccgtgagcagc | gatattcagatgacccagagcccgag cagcctgagcgcgagcgtgggcgatcgcgtgac cattacctgcaaagcgagccaggatgtgcg caacaccgtggcgtggtatcagcagaaac cgggcaaagcgccgaaactgctgatttatagcag cagctatcgcaacaccggcgtgccg gatcgctttagcggcagcggcagcggcaccgat tttaccctgaccattagcagcctgcaggcggaag atgtggcggtgtattattgccagcagcatta tattaccccgtatacctttggcggcggcac caaagtggaaattaaacgcaccgtg |
| Amino acid | QVQLQESGPGLVKP SETLSLTCTVSGFSLLSY GVHWVRQPPGKGLEWLGVIWTGGTT NYNSALMSRFTISKDDSKNTVYLKMNSL KTEDTAIYYCARYYYG MDYWGQGTLVTVSS | DIQMTQSPSSLSASVGDRVTITCK ASQDVRNTVAWYQQKPGKAP KLLIYSSSYRNTGVP DRFSGSGSGTDFTLTISSLQAEDVA VYYCQQHYIT PYTFGGGTKVEIKRTV |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yeom, C.-H.; Jeong, H.-J. Production of a Soluble Recombinant Antibody Fragment against MMP9 Using Escherichia coli. Medicina 2021, 57, 981. https://doi.org/10.3390/medicina57090981
Yeom C-H, Jeong H-J. Production of a Soluble Recombinant Antibody Fragment against MMP9 Using Escherichia coli. Medicina. 2021; 57(9):981. https://doi.org/10.3390/medicina57090981
Chicago/Turabian StyleYeom, Chang-Hun, and Hee-Jin Jeong. 2021. "Production of a Soluble Recombinant Antibody Fragment against MMP9 Using Escherichia coli" Medicina 57, no. 9: 981. https://doi.org/10.3390/medicina57090981
APA StyleYeom, C.-H., & Jeong, H.-J. (2021). Production of a Soluble Recombinant Antibody Fragment against MMP9 Using Escherichia coli. Medicina, 57(9), 981. https://doi.org/10.3390/medicina57090981
