Early Molecular Immune Responses of Turbot (Scophthalmus maximus L.) Following Infection with Aeromonas salmonicida subsp. salmonicida
Abstract
:1. Introduction
2. Results
2.1. Haematological Analyses and Leucocytes Count
2.2. Innate Humoral Parameters
2.3. Oxidative Stress
2.4. Gene Expression Analysis
3. Discussion
4. Materials and Methods
4.1. Experimental Design
4.2. Bacterial Growth and Inoculum Preparation
4.3. Bacterial Challenge
4.4. Sampling
4.5. Haematological Analyses and Leucocyte Counting
4.6. Innate Humoral Parameters
4.6.1. Peroxidase (PER)
4.6.2. Anti-Protease (AP)
4.6.3. Lysozyme (LYS)
4.7. Oxidative Stress
4.7.1. Liver Homogenization
4.7.2. Protein Concentration
4.7.3. Lipid Peroxidation (LPO)
4.7.4. Catalase (CAT)
4.7.5. Superoxide Dismutase (SOD)
4.7.6. Glutathione-S-Transferase (GST)
4.8. Gene Expression Analysis
4.9. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- FAO. GLOBEFISH RESEARCH PROGRAMME Turbot-Production Technology and Markets. Volume 103. 2011; 103. Available online: www.globefish.org (accessed on 7 July 2023).
- Fernández-González, R.; Pérez-Pérez, M.I.; Garza-Gil, M.D. Main issues and key factors for development of turbot aquaculture in Spanish regions: A social-ecological perspective. Aquaculture 2021, 544, 737140. [Google Scholar] [CrossRef]
- Chen, W.; Gao, S. Current status of industrialized aquaculture in China: A review. Environ. Sci. Pollut. Res. 2023, 30, 32278–32287. [Google Scholar] [CrossRef]
- Ellis, A.E. Immunization with bacterial antigens: Furunculosis. Dev. Biol. Stand. 1997, 90, 107–116. [Google Scholar]
- Millán, A.; Gómez-Tato, A.; Pardo, B.G.; Fernández, C.; Bouza, C.; Vera, M.; Alvarez-Dios, J.A.; Cabaleiro, S.; Lamas, J.; Lemos, M.L.; et al. Gene Expression Profiles of the Spleen, Liver, and Head Kidney in Turbot (Scophthalmus maximus) Along the Infection Process with Aeromonas salmonicida Using an Immune-Enriched Oligo-microarray. Mar. Biotechnol. 2011, 13, 1099–1114. [Google Scholar] [CrossRef]
- Emmerich, R.; Weibel, E. Über eine durch Bakterien erzeugte Seuche unter den Forellen. Arch. Hyg. Bakteriol. 1894, 21, 1–21. [Google Scholar]
- Magariños, B.; Devesa, S.; González, A.; Castro, N.; Toranzo, A.E. Furunculosis in Senegalese sole (Solea senegalensis) cultured in a recirculation system. Vet. Rec. 2011, 168, 431. [Google Scholar] [CrossRef]
- Austin, B.; Austin, D.A. Bacterial Fish Pathogens. In Diseases of Farmed and Wild Fish; Springer: Berlin/Heidelberg, Germany, 2016. [Google Scholar]
- Librán-Pérez, M.; Costa, M.M.; Figueras, A.; Novoa, B. β-glucan administration induces metabolic changes and differential survival rates after bacterial or viral infection in turbot (Scophthalmus maximus). Fish Shellfish Immunol. 2018, 82, 173–182. [Google Scholar] [CrossRef]
- Pedersen, K.; Skall, H.F.; Lassen-Nielsen, A.M.; Nielsen, T.F.; Henriksen, N.H.; Olesen, N.J. Surveillance of health status on eight marine rainbow trout, Oncorhynchus mykiss(Walbaum), farms in Denmark in 2006. J. Fish Dis. 2008, 31, 659–667. [Google Scholar] [CrossRef]
- Saleh, M.; Soliman, H.; Haenen, O.; El-Matbouli, M. Antibody-coated gold nanoparticles immunoassay for direct detection of Aeromonas salmonicida in fish tissues. J. Fish Dis. 2011, 34, 845–852. [Google Scholar] [CrossRef]
- Diamanka, A.; Loch, T.P.; Cipriano, R.C.; Faisal, M. Polyphasic characterization of Aeromonas salmonicida isolates recovered from salmonid and non-salmonid fish. J. Fish Dis. 2013, 36, 949–963. [Google Scholar] [CrossRef]
- Wang, P.; Li, J.; He, T.T.; Li, N.; Mo, Z.L.; Nie, P.; Xie, H.X. Pathogenic characterization of Aeromonas salmonicida subsp. masoucida turbot isolate from China. J. Fish Dis. 2020, 43, 1145–1154. [Google Scholar] [CrossRef]
- Nougayrede, P.; Sochon, E.; Vuillaume, A. Isolation of Aeromonas subspecies salmonicida in farmed turbot (Psetta maxima) in France. Bull. Eur. Assoc. Fish Pathol. 1990, 10, 139–140. [Google Scholar]
- Toranzo, A.E.; Barja, J.L. First report of furunculosis in turbot reared in floating cages in northwest of Spain. Bull. Eur. Assoc. Fish Pathol. 1992, 12, 147–149. [Google Scholar]
- Santos, Y.; Garcia-Marquez, S.; Pereira, P.G.; Pazos, F.; Riaza, A.; Silva, R.; El Morabit, A.; Ubeira, F.M. Efficacy of furunculosis vaccines in turbot, Scophthalmus maximus (L.): Evaluation of immersion, oral and injection delivery. J. Fish Dis. 2005, 28, 165–172. [Google Scholar] [CrossRef]
- Lillehaug, A.; Lunestad, B.; Grave, K. Epidemiology of bacterial diseases in Norwegian aquaculture—A description based on antibiotic prescription data for the ten-year period 1991 to 2000. Dis. Aquat. Org. 2003, 53, 115–125. [Google Scholar] [CrossRef]
- Pedersen, K.; Kofod, H.; Dalsgaard, I.; Larsen, J. Isolation of oxidase-negative Aeromonas salmonicida from diseased turbot Scophthalmus maximus. Dis. Aquat. Org. 1994, 18, 149–154. [Google Scholar] [CrossRef]
- Keeling, S.E.; Brosnahan, C.L.; Johnston, C.; Wallis, R.; Gudkovs, N.; McDonald, W.L. Development and validation of a real-time PCR assay for the detection of Aeromonas salmonicida. J. Fish Dis. 2013, 36, 495–503. [Google Scholar] [CrossRef]
- Daher, R.K.; Filion, G.; Tan, S.G.E.; Dallaire-Dufresne, S.; Paquet, V.E.; Charette, S.J. Alteration of virulence factors and rearrangement of pAsa5 plasmid caused by the growth of Aeromonas salmonicida in stressful conditions. Vet. Microbiol. 2011, 152, 353–360. [Google Scholar] [CrossRef]
- Vasquez, I.; Hossain, A.; Gnanagobal, H.; Valderrama, K.; Campbell, B.; Ness, M.; Charette, S.J.; Gamperl, A.K.; Cipriano, R.; Segovia, C.; et al. Comparative Genomics of Typical and Atypical Aeromonas salmonicida Complete Genomes Revealed New Insights into Pathogenesis Evolution. Microorganisms 2022, 10, 189. [Google Scholar] [CrossRef]
- Svendsen, Y.S.; Dalmo, R.A.; Bøgwald, J. Tissue localization of Aeromonas salmonicida in Atlantic salmon, Salmo salar L., following experimental challenge. J. Fish Dis. 1999, 22, 125–131. [Google Scholar] [CrossRef]
- Ringø, E.; Jutfelt, F.; Kanapathippillai, P.; Bakken, Y.; Sundell, K.; Glette, J.; Mayhew, T.M.; Myklebust, R.; Olsen, R.E. Damaging effect of the fish pathogen Aeromonas salmonicida ssp. salmonicida on intestinal enterocytes of Atlantic salmon (Salmo salar L.). Cell Tissue Res. 2004, 318, 305–311. [Google Scholar] [CrossRef]
- Coscelli, G.; Bermúdez, R.; Ronza, P.; Losada, A.P.; Quiroga, M.I. Immunohistochemical study of inducible nitric oxide synthase and tumour necrosis factor alpha response in turbot (Scophthalmus maximus) experimentally infected with Aeromonas salmonicida subsp. salmonicida. Fish Shellfish Immunol. 2016, 56, 294–302. [Google Scholar] [CrossRef]
- Farto, R.; Milton, D.; Bermúdez, M.; Nieto, T. Colonization of turbot tissues by virulent and avirulent Aeromonas salmonicida subsp. salmonicida strains during infection. Dis. Aquat. Org. 2011, 95, 167–173. [Google Scholar] [CrossRef]
- Coscelli, G.A.; Bermúdez, R.; Losada, A.P.; Faílde, L.D.; Santos, Y.; Quiroga, M.I. Acute Aeromonas salmonicida infection in turbot (Scophthalmus maximus L.). Histopathological and immunohistochemical studies. Aquaculture 2014, 430, 79–85. [Google Scholar] [CrossRef]
- Coscelli, G.A.; Bermúdez, R.; Silva, A.R.S.; de Ocenda, M.V.R.; Quiroga, M.I. Granulomatous dermatitis in turbot (Scophthalmus maximus L.) associated with natural Aeromonas salmonicida subsp. salmonicida infection. Aquaculture 2014, 428–429, 111–116. [Google Scholar] [CrossRef]
- Groff, J.M. Cutaneous Biology and Diseases of Fish. Vet. Clin. North Am. Exot. Anim. Pract. 2001, 4, 321–411. [Google Scholar] [CrossRef]
- Young, K.M.; Czyrny, A.; Russell, S.; Huber, P.; Lumsden, J.S. Plasma ladderlectin concentration following sterile inflammation and Aeromonas salmonicidasubsp. salmonicidainfection. J. Fish Dis. 2009, 32, 569–576. [Google Scholar] [CrossRef]
- Dallaire-Dufresne, S.; Tanaka, K.H.; Trudel, M.V.; Lafaille, A.; Charette, S.J. Virulence, genomic features, and plasticity of Aeromonas salmonicida subsp. salmonicida, the causative agent of fish furunculosis. Vet. Microbiol. 2014, 169, 1–7. [Google Scholar] [CrossRef]
- Vega-Sánchez, V.; Acosta-Dibarrat, J.; Vega-Castillo, F.; Castro-Escarpulli, G.; Aguilera-Arreola, M.G.; Soriano-Vargas, E. Phenotypical characteristics, genetic identification, and antimicrobial sensitivity of Aeromonas species isolated from farmed rainbow trout (Onchorynchus mykiss) in Mexico. Acta Trop. 2014, 130, 76–79. [Google Scholar] [CrossRef]
- Carballeira, C.; Ramos-Gómez, J.; Martín-Díaz, M.L.; Delvalls, T.A.; Carballeira, A. Designing an integrated environmental monitoring plan for land-based marine fish farms located at exposed and hard bottom coastal areas. J. Environ. Monit. 2012, 14, 1305–1316. [Google Scholar]
- Coscelli, G.A.; Bermúdez, R.; Losada, A.P.; Santos, Y.; Quiroga, M.I. Vaccination against Aeromonas salmonicida in turbot (Scophthalmus maximus L.): Study of the efficacy, morphological changes and antigen distribution. Aquaculture 2015, 445, 22–32. [Google Scholar] [CrossRef]
- Toranzo, A.E.; Santos, Y.; Barja, J.L. Immunization with bacterial antigens: Vibrio infections. Dev. Biol. Stand. 1997, 90, 93–105. [Google Scholar]
- Anderson, D.P. Adjuvants and immunostimulants for enhancing vaccine potency in fish. Dev. Biol. Stand. 1997, 90, 257–265. [Google Scholar]
- Markestad, A.; Grave, K. Reduction of antibacterial drug use in Norwegian fish farming due to vaccination. Dev. Biol. Stand. 1997, 90, 365–369. [Google Scholar]
- Bjornsdottir, B.; Gudmundsdottir, S.; Bambir, S.H.; Magnadottir, B.; Gudmundsdottir, B.K. Experimental infection of turbot, Scophthalmus maximus (L.), by Moritella viscosa, vaccination effort and vaccine-induced side-effects. J. Fish Dis. 2004, 27, 645–655. [Google Scholar] [CrossRef]
- Lago, E.; Nieto, T.; Farto, R. Virulence factors of Aeromonas salmonicida subsp. salmonicida strains associated with infections in turbot Psetta maxima. Dis. Aquat. Org. 2012, 99, 145–151. [Google Scholar] [CrossRef]
- Varga, T.; Czimmerer, Z.; Nagy, L. PPARs are a unique set of fatty acid regulated transcription factors controlling both lipid metabolism and inflammation. Biochim. Biophys. Acta 2011, 1812, 1007–1022. [Google Scholar] [CrossRef]
- Townsend, M.; McKenzie, A. Unravelling the net? Cytokines and diseases. J. Cell Sci. 2000, 113, 3549–3550. [Google Scholar] [CrossRef]
- Low, C.; Wadsworth, S.; Burrells, C.; Secombes, C. Expression of immune genes in turbot (Scophthalmus maximus) fed a nucleotide-supplemented diet. Aquaculture 2003, 221, 23–40. [Google Scholar] [CrossRef]
- Tracey, K.J.; Cerami, A. Tumor Necrosis Factor, Other Cytokines and Disease. Annu. Rev. Cell Biol. 1993, 9, 317–343. [Google Scholar] [CrossRef]
- Pereiro, P.; Balseiro, P.; Romero, A.; Dios, S.; Forn-Cuni, G.; Fuste, B.; Planas, J.V.; Beltran, S.; Novoa, B.; Figueras, A. High-Throughput Sequence Analysis of Turbot (Scophthalmus maximus) Transcriptome Using 454-Pyrosequencing for the Discovery of Antiviral Immune Genes. PLoS ONE 2012, 7, e35369. [Google Scholar] [CrossRef]
- Balkwill, F. TNF-α in promotion and progression of cancer. Cancer Metastasis Rev. 2006, 25, 409–416. [Google Scholar] [CrossRef]
- Cawthorn, W.P.; Sethi, J.K. TNF-α and adipocyte biology. FEBS Lett. 2008, 582, 117–131. [Google Scholar] [CrossRef]
- Sun, Y.; Wang, X.; Zhou, H.; Mai, K.; He, G. Dietary Astragalus polysaccharides ameliorates the growth performance, antioxidant capacity and immune responses in turbot (Scophthalmus maximus L.). Fish Shellfish Immunol. 2020, 99, 603–608. [Google Scholar] [CrossRef]
- Wang, T.; Secombes, C.J. The cytokine networks of adaptive immunity in fish. Fish Shellfish Immunol. 2013, 35, 1703–1718. [Google Scholar] [CrossRef]
- Zhang, C.-N.; Zhang, J.-L.; Guan, W.-C.; Zhang, X.-F.; Guan, S.-H.; Zeng, Q.-H.; Cheng, G.-F.; Cui, W. Effects of Lactobacillus delbrueckii on immune response, disease resistance against Aeromonas hydrophila, antioxidant capability and growth performance of Cyprinus carpio Huanghe var. Fish Shellfish Immunol. 2017, 68, 84–91. [Google Scholar] [CrossRef]
- D’Amico, G.; Frascaroli, G.; Bianchi, G.; Transidico, P.; Doni, A.; Vecchi, A.; Sozzani, S.; Allavena, P.; Mantovani, A. Uncoupling of inflammatory chemokine receptors by IL-10: Generation of functional decoys. Nat. Immunol. 2000, 1, 387–391. [Google Scholar] [CrossRef]
- Fajardo, C.; Santos, P.; Passos, R.; Vaz, M.; Azeredo, R.; Machado, M.; Fernández-Boo, S.; Baptista, T.; Costas, B. Functional and Molecular Immune Response of Rainbow Trout (Oncorhynchus mykiss) Following Challenge with Yersinia ruckeri. Int. J. Mol. Sci. 2022, 23, 3096. [Google Scholar] [CrossRef]
- Maehr, T.; Costa, M.M.; Vecino, J.L.G.; Wadsworth, S.; Martin, S.A.; Wang, T.; Secombes, C.J. Transforming growth factor-β1b: A second TGF-β1 paralogue in the rainbow trout (Oncorhynchus mykiss) that has a lower constitutive expression but is more responsive to immune stimulation. Fish Shellfish Immunol. 2013, 34, 420–432. [Google Scholar] [CrossRef]
- Cunha, I.; Galante-Oliveira, S.; Rocha, E.; Planas, M.; Urbatzka, R.; Castro, L. Dynamics of PPARs, fatty acid metabolism genes and lipid classes in eggs and early larvae of a teleost. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2013, 164, 247–258. [Google Scholar] [CrossRef]
- Dai, W.; Panserat, S.; Plagnes-Juan, E.; Seiliez, I.; Skiba-Cassy, S. Amino Acids Attenuate Insulin Action on Gluconeogenesis and Promote Fatty Acid Biosynthesis via mTORC1 Signaling Pathway in trout Hepatocytes. Cell. Physiol. Biochem. 2015, 36, 1084–1100. [Google Scholar] [CrossRef]
- Xu, D.; He, G.; Mai, K.; Zhou, H.; Xu, W.; Song, F. Postprandial nutrient-sensing and metabolic responses after partial dietary fishmeal replacement by soyabean meal in turbot (Scophthalmus maximus L.). Br. J. Nutr. 2016, 115, 379–388. [Google Scholar] [CrossRef]
- Kim, Y.; Kim, T.W.; Park, Y.S.; Jeong, E.M.; Lee, D.-S.; Kim, I.-G.; Chung, H.; Hwang, Y.-I.; Lee, W.J.; Yu, H.G.; et al. The Role of Interleukin-22 and Its Receptor in the Development and Pathogenesis of Experimental Autoimmune Uveitis. PLoS ONE 2016, 11, e0154904. [Google Scholar] [CrossRef]
- Chen, W.; Jin, W.; Hardegen, N.; Lei, K.-J.; Li, L.; Marinos, N.; McGrady, G.; Wahl, S.M. Conversion of Peripheral CD4+CD25− Naive T Cells to CD4+CD25+ Regulatory T Cells by TGF-β Induction of Transcription Factor Foxp3. J. Exp. Med. 2003, 198, 1875–1886. [Google Scholar] [CrossRef]
- Yoshimura, A.; Wakabayashi, Y.; Mori, T. Cellular and molecular basis for the regulation of inflammation by TGF. J. Biochem. 2010, 147, 781–792. [Google Scholar] [CrossRef]
- Bauer, M.E.; De la Fuente, M. The role of oxidative and inflammatory stress and persistent viral infections in immunosenescence. Mech. Ageing Dev. 2016, 158, 27–37. [Google Scholar] [CrossRef]
- Kim, C.; Cha, Y.-N. Taurine chloramine produced from taurine under inflammation provides anti-inflammatory and cytoprotective effects. Amino Acids 2014, 46, 89–100. [Google Scholar] [CrossRef]
- Ghosh, M.; Pal, S.; Sil, P.C. Taurine attenuates nano-copper-induced oxidative hepatic damage via mitochondria-dependent and NF-κB/TNF-α-mediated pathway. Toxicol. Res. 2014, 3, 474–486. [Google Scholar] [CrossRef]
- Lambert, I.H.; Kristensen, D.M.; Holm, J.B.; Mortensen, O.H. Physiological role of taurine—From organism to organelle. Acta Physiol. 2015, 213, 191–212. [Google Scholar] [CrossRef]
- Carroll, M.C. The complement system in regulation of adaptive immunity. Nat. Immunol. 2004, 5, 981–986. [Google Scholar] [CrossRef]
- Gasque, P. Complement: A unique innate immune sensor for danger signals. Mol. Immunol. 2004, 41, 1089–1098. [Google Scholar] [CrossRef]
- Kilpatrick, D.C. Animal lectins: A historical introduction and overview. Biochim. Biophys. Acta 2002, 1572, 187–197. [Google Scholar] [CrossRef]
- Afonso, A.; Lousada, S.; Silva, J.; Ellis, A.E.; Silva, M.T. Neutrophil and macrophage responses to inflammation in the peritoneal cavity of rainbow trout Oncorhynchus mykiss. A light and electron microscopic cytochemical study. Dis. Aquat. Org. 1998, 34, 27–37. [Google Scholar] [CrossRef]
- Reis, B.; Gonçalves, A.T.; Santos, P.; Sardinha, M.; Conceição, L.E.C.; Serradeiro, R.; Pérez-Sánchez, J.; Calduch-Giner, J.; Schmid-Staiger, U.; Frick, K.; et al. Immune Status and Hepatic Antioxidant Capacity of Gilthead Seabream Sparus aurata Juveniles Fed Yeast and Microalga Derived β-glucans. Mar. Drugs 2021, 19, 653. [Google Scholar] [CrossRef]
- Quade, M.J.; Roth, J.A. A rapid, direct assay to measure degranulation of bovine neutrophil primary granules. Vet. Immunol. Immunopathol. 1997, 58, 239–248. [Google Scholar] [CrossRef]
- Machado, M.; Azeredo, R.; Díaz-Rosales, P.; Afonso, A.; Peres, H.; Oliva-Teles, A.; Costas, B. Dietary tryptophan and methionine as modulators of European seabass (Dicentrarchus labrax) immune status and inflammatory response. Fish Shellfish Immunol. 2015, 42, 353–362. [Google Scholar] [CrossRef]
- Costas, B.; Conceição, L.E.; Dias, J.; Novoa, B.; Figueras, A.; Afonso, A. Dietary arginine and repeated handling increase disease resistance and modulate innate immune mechanisms of Senegalese sole (Solea senegalensis Kaup, 1858). Fish Shellfish Immunol. 2011, 31, 838–847. [Google Scholar] [CrossRef]
- Costas, B.; Couto, A.; Azeredo, R.; Machado, M.; Krogdahl, A.; Oliva-Teles, A. Gilthead seabream (Sparus aurata) immune responses are modulated after feeding with purified antinutrients. Fish Shellfish Immunol. 2014, 41, 70–79. [Google Scholar] [CrossRef]
- Bird, R.P.; Draper, H.H. Comparative studies on different methods of malonaldehyde determination. Method Enzymol. 1984, 105, 299–305. [Google Scholar] [CrossRef]
- Claiborne, A. Catalase activity. In Handbook of Methods for Oxygen Radical Research; Greenwald, R.A., Ed.; CRC Press Inc.: Boca Raton, FL, USA, 1984; pp. 283–284. [Google Scholar]
- Flohé, L.; Ötting, F. Superoxide dismutase assays. Methods Enzymol. 1984, 105, 93–104. [Google Scholar] [CrossRef]
- Lima, I.; Moreira, S.M.; Osten, J.R.-V.; Soares, A.M.; Guilhermino, L. Biochemical responses of the marine mussel Mytilus galloprovincialis to petrochemical environmental contamination along the North-western coast of Portugal. Chemosphere 2007, 66, 1230–1242. [Google Scholar] [CrossRef]
- Frasco, M.; Guilhermino, L. Effects of dimethoate and beta-naphthoflavone on selected biomarkers of Poecilia reticulata. Fish Physiol. Biochem. 2002, 26, 149–156. [Google Scholar] [CrossRef]
- Habig, W.H.; Pabst, M.J.; Jakoby, W.B. Glutathione S-transferases. The first enzymatic step in mercapturic acid formation. J. Biol. Chem. 1974, 249, 7130–7139. [Google Scholar]
- Peixoto, D.; Pinto, W.; Gonçalves, A.T.; Machado, M.; Reis, B.; Silva, J.; Navalho, J.; Dias, J.; Conceição, L.; Costas, B. Microalgal biomasses have potential as ingredients in microdiets for Senegalese sole (Solea senegalensis) post-larvae. J. Appl. Phycol. 2021, 33, 2241–2250. [Google Scholar] [CrossRef]
- Babicki, S.; Arndt, D.; Marcu, A.; Liang, Y.; Grant, J.R.; Maciejewski, A.; Wishart, D.S. Heatmapper: Web-enabled heat mapping for all. Nucleic Acids Res. 2016, 44, W147–W153. [Google Scholar] [CrossRef]
- Cui, W.; Ma, A. Transcriptome analysis provides insights into the effects of myo-inositol on the turbot Scophthalmus maximus. Fish Shellfish Immunol. 2020, 106, 691–704. [Google Scholar] [CrossRef]
- Song, F.; Xu, D.; Mai, K.; Zhou, H.; Xu, W.; He, G. Comparative Study on the Cellular and Systemic Nutrient Sensing and Intermediary Metabolism after Partial Replacement of Fishmeal by Meat and Bone Meal in the Diet of Turbot (Scophthalmus maximus L.). PLoS ONE 2016, 11, e0165708. [Google Scholar] [CrossRef]
- Liu, C.-S.; Sun, Y.; Hu, Y.-H.; Sun, L. Identification and analysis of a CpG motif that protects turbot (Scophthalmus maximus) against bacterial challenge and enhances vaccine-induced specific immunity. Vaccine 2010, 28, 4153–4161. [Google Scholar] [CrossRef]
- Zhang, Y.; Wei, Z.; Yang, M.; Liu, D.; Pan, M.; Wu, C.; Zhang, W.; Mai, K. Dietary taurine modulates hepatic oxidative status, ER stress and inflammation in juvenile turbot (Scophthalmus maximus L.) fed high carbohydrate diets. Fish Shellfish Immunol. 2021, 109, 1–11. [Google Scholar] [CrossRef]
- Jiang, H.; Bian, F.; Zhou, H.; Wang, X.; Wang, K.; Mai, K.; He, G. Nutrient sensing and metabolic changes after methionine deprivation in primary muscle cells of turbot (Scophthalmus maximus L.). J. Nutr. Biochem. 2017, 50, 74–82. [Google Scholar] [CrossRef]
- Robledo, D.; Rubiolo, J.A.; Cabaleiro, S.; Martínez, P.; Bouza, C. Differential gene expression and SNP association between fast- and slow-growing turbot (Scophthalmus maximus). Sci. Rep. 2017, 7, 12105. [Google Scholar] [CrossRef]
- Guo, G.; Li, C.; Xia, B.; Jiang, S.; Zhou, S.; Men, X.; Ren, Y. The efficacy of lactic acid bacteria usage in turbot Scophthalmus maximus on intestinal microbiota and expression of the immune related genes. Fish Shellfish Immunol. 2020, 100, 90–97. [Google Scholar] [CrossRef]
- Gao, Z.; Wang, X.; Tan, C.; Zhou, H.; Mai, K.; He, G. Effect of dietary methionine levels on growth performance, amino acid metabolism and intestinal homeostasis in turbot (Scophthalmus maximus L.). Aquaculture 2019, 498, 335–342. [Google Scholar] [CrossRef]
- Robledo, D.; Hernández-Urcera, J.; Cal, R.M.; Pardo, B.G.; Sánchez, L.; Martínez, P.; Viñas, A. Analysis of qPCR reference gene stability determination methods and a practical approach for efficiency calculation on a turbot (Scophthalmus maximus) gonad dataset. BMC Genom. 2014, 15, 648. [Google Scholar] [CrossRef]
| Gene | 0 h | 3 h | 6 h | 9 h | 24 h | 48 h | p Value | |
|---|---|---|---|---|---|---|---|---|
| tnf-α | 1.00 ± 0.95 b | PBS | 0.99 ± 0.73 * | 0.84 ± 0.85 | 1.13 ± 1.01 | 1.16 ± 0.75 | 0.87 ± 0.47 | |
| INF | 7.82 ± 9.17 a | 3.29 ± 3.06 b | 1.29 ± 0.79 b | 1.34 ± 0.58 b | 1.46 ± 0.66 b | <0.001 | ||
| il-1β | 1.00 ± 0.86 c | PBS | 0.31 ± 0.16 * | 0.38 ± 0.13 * | 1.06 ± 1.18 | 0.48 ± 0.21 | 0.52 ± 0.33 | |
| INF | 4.40 ± 4.96 ab | 5.99 ± 7.73 a | 3.04 ± 2.16 bc | 1.56 ± 0.94 c | 0.88 ± 0.19 c | <0.001 | ||
| il-8 | 1.00 ± 0.40 a | PBS | 0.68 ± 0.26 | 0.67 ± 0.26 | 0.84 ± 0.42 | 1.12 ± 0.32 | 0.85 ± 0.14 | |
| INF | 0.741 ± 0.35 ab | 0.64 ± 0.20 b | 0.79 ± 0.27 ab | 0.89 ± 0.19 ab | 1.00 ± 0.25 ab | <0.001 | ||
| pparα-1 | 1.00 ± 0.55 a | PBS | 0.55 ± 0.23 | 0.58 ± 0.26 | 0.60 ± 0.41 | 0.66 ± 0.18 | 0.59 ± 0.33 | |
| INF | 0.46 ± 0.22 b | 0.35 ± 0.14 b | 0.34 ± 0.20 b | 0.47 ± 0.19 b | 0.67 ± 0.35 ab | <0.001 | ||
| acox1 | 1.00 ± 0.42 a | PBS | 0.69 ± 0.27 | 0.81 ± 0.21 | 1.21 ± 0.48 * | 0.80 ± 0.39 | 0.78 ± 0.21 | |
| INF | 0.59 ± 0.27 b | 0.61 ± 0.22 b | 0.80 ± 0.25 ab | 0.53 ± 0.18 b | 0.55 ± 0.22 b | <0.001 | ||
| tgf-β1 | 1.00 ± 0.42 a | PBS | 0.69 ± 0.16 | 0.72 ± 0.18 | 0.75 ± 0.34 | 0.68 ± 0.19 | 0.67 ± 0.10 | |
| INF | 0.69 ± 0.28 bc | 0.66 ± 0.17 bc | 0.89 ± 0.22 ab | 0.72 ± 0.13 bc | 0.61 ± 0.13 c | <0.001 | ||
| nf-kB p65 | 1.00 ± 0.36 a | PBS | 0.53 ± 0.12 | 0.62 ± 0.14 | 0.72 ± 0.21 | 0.67 ± 0.15 | 0.60 ± 0.17 | |
| INF | 0.70 ± 0.23 b | 0.76 ± 0.29 ab | 0.79 ± 0.16 ab | 0.61 ± 0.15 b | 0.58 ± 0.21 b | <0.001 | ||
| srebp-1 | 1.00 ± 0.41 a | PBS | 0.66 ± 0.24 | 0.66 ± 0.17 | 0.73 ± 0.23 | 0.65 ± 0.24 | 0.52 ± 0.16 | |
| INF | 0.66 ± 0.20 bc | 0.74 ± 0.23 abc | 0.84 ± 0.34 ab | 0.50 ± 0.12 c | 0.60 ± 0.20 bc | <0.001 | ||
| il-10 | 1.00 ± 0.52 b | PBS | 1.04 ± 0.93 | 0.54 ± 0.20 * | 1.32 ± 0.84 * | 0.74 ± 0.30 | 0.77 ± 0.28 | |
| INF | 3.35 ± 2.42 b | 10.35 ± 13.69 a | 14.88 ± 10.15 a | 3.28 ± 1.57 b | 2.00 ± 0.94 b | <0.001 | ||
| c3 | 1.00 ± 0.99 bc | PBS | 0.69 ± 0.30 | 0.63 ± 0.32 | 0.75 ± 1.00 * | 0.64 ± 0.63 | 1.30 ± 0.62 | |
| INF | 0.67 ± 0.55 bc | 0.44 ± 0.31 c | 2.27 ± 1.50 a | 1.63 ± 1.09 ab | 1.29 ± 0.39 bc | <0.001 | ||
| cpt1a | 1.00 ± 0.43 a | PBS | 1.16 ± 0.33 | 0.97 ± 0.28 | 0.80 ± 0.52 | 0.87 ± 0.26 | 0.98 ± 0.27 | |
| INF | 1.00 ± 0.40 a | 0.75 ± 0.26 ab | 0.50 ± 0.15 b | 0.95 ± 0.36 a | 0.86 ± 0.27 ab | <0.001 | ||
| pcna | 1.00 ± 0.76 ab | PBS | 0.75 ± 0.53 | 0.88 ± 0.39 | 0.98 ± 0.47 | 0.59 ± 0.31 | 0.66 ± 0.36 | |
| INF | 1.30 ± 0.65 a | 0.59 ± 0.26 bc | 0.83 ± 0.57 abc | 0.69 ± 0.24 abc | 0.53 ± 0.27 c | <0.001 | ||
| il-22 | 1.00 ± 0.97 | PBS | 0.61 ± 0.85 | 0.26 ± 0.23 | 0.65 ± 0.68 | 0.61 ± 1.02 | 0.27 ± 0.27 | |
| INF | 0.47 ± 0.40 | 0.57 ± 0.45 | 0.27 ± 0.16 | 0.25 ± 0.14 | 0.74 ± 0.63 | 0.017 |
| Gene | Acronym | Efficiency (%) | Amplicon Length (bp) | Reference | Accession nº | Primer Sequence (5′-3′) |
|---|---|---|---|---|---|---|
| Interleukin 1 Beta | il-1β | 98 | 181 | [46] | AJ295836 | F: TACCTGTCGTGCCAACAGGAA R: TGATGTACCAGTTGGGGAA |
| Interleukin 10 | il-10 | 100.5 | 88 | [79] | XM_035632547.1 | F: AGTGACGGAGGACGCCAAGG R: ACATCTGCTGACATCGGACTTGAG |
| Acyl-CoA Oxidase 1 | acox1 | 103.9 | 240 | [80] | KC189925 | F: AGTCCTCGCCCAGCTTTACT R: GGCTTCACATAGGTTCCGTCT |
| Complement Factor 3 | c3 | 86.3 | 131 | [81] | XM_035636545.1 | F: GGTACAACTTCAACAACAACAACAA R: AGCGTAGTACAGCGACACCATT |
| Carnitine Palmitoryl-Transferase 1 Isoform A | cpt1a | 107.2 | 96 | [80] | XM_035614266.1 | F: ATGGGAAGAGTGGACTGAATG R: GCTGGAAGGCATCTGTGG |
| Nuclear Factor Kappa B p65 | nf-kB p65 | 106.3 | 127 | [82] | MF370855 | F: ATGCCTTTGAGGACCTTTT R: GTGTTCTGGGATGCTGTGT |
| Tumor Necrosis Factor Alpha | tnf-α | 110.2 | 424 | [46] | FJ654645 | F: CCCTTATCATTATGGCCCTT R: TCCGAGTACCGCCATATCCT |
| Peroxisome Proliferator Activated Receptor Alpha 1 | pparα-1 | 98.1 | 116 | [83] | XM_035641791.1 | F: GCGTCCCTTCAGTGATAT R: CTCCACAGCAGATGATAG |
| Interleukin 22 | il-22 | 106 | 127 | [43] | XM_035612680.1 | F: TTGTTTTGAACTCCTCTGTGTGT R: GGATGGTGTCACCGTGGAAA |
| Transforming Growth Factor Beta 1 | tgf-β1 | 111.7 | 153 | [84] | XM_035623668.1 | F: TCGCTTCCCGTTTCATCACT R: CCATGCTTTGCTCATTCCCG |
| Interleukin 8 | il-8 | 116.5 | 184 | [85] | XM_035651350.1 | F: GGAGCCCAGAGTGTCGTTA R: CCTGCACCATAGAAATCTCATT |
| Proliferating Cell Nuclear Antigen | pcna | 98 | 148 | [86] | EU711051.1 | F: GGTGGACGAGTGCTGCTTC R: CTGCCCTGCGGTACTAACC |
| Sterol Regulatory Element-Binding Protein 1 | srebp-1 | 114.3 | 136 | [80] | XM_035615397.1 | F: GCCATTGACTACATCCGTTAC R: CATCAGCCTGTCCATCTACTTC |
| Ribosomal Protein S4 | rps4 | 99.7 | 143 | [87] | XM_035608277.1 | F: CAACATCTTCGTCATCGGCAAGG R: ATTGAACCAGCCTCAGTGTTTAGC |
| Elongation Factor-1 Alpha | ef-1α | 100.1 | 226 | [80] | AF467776.1 | F: TCATTGGCCATGTCGACTCC R: ACGTAGTACTTGGCGGTCTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fajardo, C.; Santos, P.; Passos, R.; Vaz, M.; Azeredo, R.; Machado, M.; Fernández-Boo, S.; Baptista, T.; Costas, B. Early Molecular Immune Responses of Turbot (Scophthalmus maximus L.) Following Infection with Aeromonas salmonicida subsp. salmonicida. Int. J. Mol. Sci. 2023, 24, 12944. https://doi.org/10.3390/ijms241612944
Fajardo C, Santos P, Passos R, Vaz M, Azeredo R, Machado M, Fernández-Boo S, Baptista T, Costas B. Early Molecular Immune Responses of Turbot (Scophthalmus maximus L.) Following Infection with Aeromonas salmonicida subsp. salmonicida. International Journal of Molecular Sciences. 2023; 24(16):12944. https://doi.org/10.3390/ijms241612944
Chicago/Turabian StyleFajardo, Carlos, Paulo Santos, Ricardo Passos, Mariana Vaz, Rita Azeredo, Marina Machado, Sergio Fernández-Boo, Teresa Baptista, and Benjamin Costas. 2023. "Early Molecular Immune Responses of Turbot (Scophthalmus maximus L.) Following Infection with Aeromonas salmonicida subsp. salmonicida" International Journal of Molecular Sciences 24, no. 16: 12944. https://doi.org/10.3390/ijms241612944
APA StyleFajardo, C., Santos, P., Passos, R., Vaz, M., Azeredo, R., Machado, M., Fernández-Boo, S., Baptista, T., & Costas, B. (2023). Early Molecular Immune Responses of Turbot (Scophthalmus maximus L.) Following Infection with Aeromonas salmonicida subsp. salmonicida. International Journal of Molecular Sciences, 24(16), 12944. https://doi.org/10.3390/ijms241612944

