Skip to Content
Limnological ReviewLimnological Review
  • Article
  • Open Access

3 December 2024

A Revision of Dispersal Strategies in Freshwater Sponges: The Journey of the Ponto-Caspian Sponge Rosulaspongilla rhadinaea (Porifera: Spongillidae), a New Alien Species for Europe

,
and
1
Laboratorio de Biología Marina, Departamento de Zoología, Facultad de Biología, Universidad de Sevilla, Avda. Reina Mercedes 6, 41012 Sevilla, Spain
2
Instituto de Ciencias del Mar y Limnología (Unidad Académica Mazatlán), Universidad Nacional Autónoma de México, Avda. Joel Montes Camarena S/N, Mazatlán 82000, SIN, Mexico
*
Author to whom correspondence should be addressed.

Abstract

Alien species constitute one of the main threats to freshwater ecosystems, negatively impacting biodiversity, economy, and ecosystem services. Here, we use morphological and genetic data to show the presence of a new alien freshwater sponge in Europe, Rosulaspongilla rhadinaea, a Ponto-Caspian species which recently has been found in the fluvial port of Seville (Guadalquivir River, Spain). We also reviewed the mechanisms and adaptations of freshwater sponges for dispersal. The gemmule is the key structure for understanding their life history, evolution, and dispersal capacity, since their high salinity tolerance may have made possible the spreading of these sponges on the hulls of ocean-going ships that frequent freshwater ports. Once established, they are dispersed via river currents and intraregional boat traffic through the network of interconnected channels, which act as invasion corridors. Transport via phoresy attached to mobile animal vectors such as birds (especially migrating birds) has also been demonstrated in several sponge species. Gemmules may be attached on the feathers and scales, or even to be transported in the guts of these animals, followed by defecation of viable gemmules. Transport associated with other invasive freshwater species, such as mussels, cannot be ruled out. The scarcity of taxonomic studies of freshwater sponges in the Iberian Peninsula might explain why the species had not been recorded.

1. Introduction

Alien species are those that human activities have transported beyond their original geographic range and into an area where they are not naturally found [1]. They are considered as the second most important cause of global biodiversity change after direct habitat destruction [2]. Many of these species have been shown to cause significant changes in native species’ extinction, trophic networks, ecosystem productivity, nutrient and contaminant cycling, hydrology, and habitat structure [3] and its monitoring is a global priority of the United Nations Sustainable Development Goals for 2030 [4]. The Assessment Report on Invasive Alien Species and their Control finds that the global economic cost of invasive alien species exceeded USD 423 billion annually in 2019, with costs having at least quadrupled every decade since 1970 [5]. One of the most invasive aquatic species with highly dispersive capacity is the zebra mussel Dreissena polymorpha, which has spread rapidly through Europe and North America over the past few decades, where it has caused enormous economic damage to fisheries, dams, power plants, water treatment facilities, boats, and aquatic communities [6]. Hydrozoans such as Cordylophora caspia or bryozoans of the genus Plumatella are also widespread freshwater aliens. These species can accumulate large masses of living and non-living materials (e.g., shells) on and around solid surfaces [7,8].
However, another important freshwater group, such as sponges, have usually been neglected in limnological studies. These sponges have developed specific adaptations, such as the ability to survive extreme thermal ranges, including permafrost [9,10], long-lasting desiccation, saline environments, anoxia, and tolerance to a variety of pollutants [11,12], enabling the colonization of continental waters at all latitudes, from the high plains to coastline, subterranean environments, ephemeral pools, and man-made basins [13]. Examples of alien freshwater sponges are Eunapius fragilis (Leidy 1851), described in North America [14], which are now considered a cosmopolitan species in a wide range of lentic and lotic habitats in Europe [15], and Eunapius carteri (Bowerbank 1863), described in different localities of South Asian countries [16], from where it has been spreading throughout Europe [17].
In addition to its scientific interest, the study and monitoring of these alien freshwater sponges is important because some can become fouling organisms affecting aquatic infrastructures and related economic activities. The species E. carteri as an invasive has developed massively on submerged structures in the cooling pond of the Khmelnytskyi Nuclear Power Plant in Ukraine [18,19]. The situation gets worse in summer when the sponges cover 100% of the surface available and the biomass triples [19]. The mass growth of freshwater sponges in cooling ponds in Europe [20,21,22,23] is only part of the problem, since they also cause problems in drinking water reservoirs and supply systems [24], such as the species Heterorotula multidentata (Weltner, 1895) in Australia [25], Japan [26], and Spain [27] and Trochospongilla leidii (Jones and Rützler 1975) in North America [28].
A new alien freshwater sponge in Europe, Rosulaspongilla rhadinaea, a Ponto-Caspian species so far known only from Iran and Tajikistan, has recently been found in the fluvial port of Seville, associated with the basin of the Guadalquivir River (Spain). We described the species and reviewed the strategies and adaptations of freshwater sponges that allow them this great ability to disperse over long distances, even between continents, crossing saltwater bodies. Transport via phoresy is also reviewed.

2. Materials and Methods

2.1. Sampling Stations and Collection

The Port of Seville is located to the south of the city of Seville (Spain), in the Guadalquivir River and some 90 km from its mouth into the Atlantic Ocean (Figure 1a). The port, about 800 m long, is located inside a branch of the river (Guadalquivir Canal) about 13.5 km long that was cut to prevent the floods that traditionally inundated the city of Seville (Figure 1b). It is the only inland port in Spain, and a strategic enclave for the European Union, fully multimodal with maritime, rail, and road connections. It is a main node of the Core Network and forms part of the Mediterranean corridor of the Trans-European Transport Network (TEN-T); as well as the Atlantic corridor together with the Guadalquivir waterway, due to the importance of inland waterways for the European Union. The port’s lock allows the entry of large merchant and cruise ships from many parts of the world, with an annual freight traffic of 4.5 million tons [29] (Figure 1a).
Figure 1. (a) Map of the Iberian Peninsula showing the position of the Port of Seville (white mark in the south). The inserted photograph shows a view of the basin of the river Guadalquivir as it passes through the city of Seville, and the presence of a large cruise ship. (b) Aerial image of the River Guadalquivir (left arrow) and of the canal and the port (right arrow). (c) Image of one of the specimens collected (photograph taken in aquarium). (d) Image of a part of a specimen showing a large number of gemmules, mainly located at the base of the sponge. (e) Detail of the sponge surface showing rounded subdermal spaces of different sizes.
Three specimens were collected by wading from the revetment wall and associated stone riprap in the Guadalquivir canal. Specimens were hand-picked from the substrate using a knife and photographed outside because the visibility of the water did not allow photography in situ. The material collected was deposited in the Phylum Porifera Collection of the Zoology Department in Seville University (CE-DZ-US) preserved in absolute ethanol.

2.2. Morphological Analysis

Freshwater sponge taxonomy is based on the morphology, size, and arrangement of spicules and gemmular traits. Spicules are divided into three general types: megascleres, microscleres, and gemmoscleres, whose size and morphology are often unique to each species.
Spicular elements were studied following previous methodology [30]. Particularly for scanning electron microscopy (SEM), samples were sputter-coated with Au/Pd, and scanned and photographed using Analytical SEM (ZEISS EVO, Oberkochen, Germany). Measurements for each type of spicule were made under SEM and are given in minimum-(average)-maximum length.

2.3. DNA Extraction, Sequencing, and Molecular Analysis

Metagenomic DNA was extracted from preserved tissue of two freshwater sponge samples (CE-DZ-US: 14; CE-DZ-US: 15), following the steps described by [31]. We amplified the nuclear-ribosomal region rDNA encompassing the internal transcribed spacers (ITS1 and ITS2), using primers designed by [32]: RA2 5′-GTCCCTGCCCTTTGTACACA-3′ and ITS2.2 (CCTGGTTAGTTTCTTTTCCTCCGC). However, complete sequences were difficult to obtain. Therefore, a second set of reactions was made. We used primer ITS2 of [33] (GCTGCGTTCTTCATCGATGC) combined with RA2 to obtain locus ITS1; and 5.8_Freshies_1180_9f (GCA CGT CTG TCT GAG CGT CCG) and 28S_Freshies_1178_7r (GCT TAT TGA TAT GCT TAA ATT CAG C) from [34] to obtain ITS2.
Polymerase chain reactions (PCR) were performed in volumes of 15 µL, containing 7.63 µL distilled H2O (sterile MilliQ), 0.75 µL dNTPs (0.2 mM), 1 µL MgCl2 (8 mM), 0.5 µL of each primer (10 µM), 3 µL 5X GoTaq® PCR buffer (Promega Corp, Madison, WI, USA), 0.12 µL GoTaq® DNA polymerase, 0.5 µL bovine serum albumin (BSA) (Bioline Meridian Bioscience, Cincinnati, Ohio, USA), and 1 µL genomic DNA (~50–100 ng). The cycling profile was: 95 °C for 5 min; then 35 cycles of 94 °C for 30 s, 49 °C for 30 s, and 68 °C for 1 min; and a final elongation step of 72 °C for 10 min. PCR products were separated by electrophoresis in 1.2% agarose gels. DNA bands were recovered with the Wizard® SV Gel and PCR Clean-Up System (Promega Corp, Madison, WI, USA) and were processed by capillary sequencing through a third-party service at Macrogen Inc. (Seoul, Republic of Korea).
All generated sequences in this study are available in GenBank (Rosulaspongilla rhadinaea: PQ611728, PQ611753; Heterorotula multidentate: PQ611729, PQ611730).
Sequences were analyzed and edited with the Codon Code Aligner 8.0.2 (CodonCode Corporation software. The cleaned sequences were subjected to a BLAST search against NCBI GenBank (http://www.ncbi.nlm.nih.gov/blast/, accessed on 16 October 2024) to verify the sequences’ identity.
For the phylogenetic analysis, we used our sequence and 88 sequences of Spongillida (including some short sequences corresponding to ITS2, specifically of genera Spongilla and Heteromeyenia) downloaded from Genbank. We used sequences of Echinospongilla brichardi (Brien, 1974) (EF418032) and Trochospongilla latouchiana Annandale, 1907 (EF151955) as an outgroup to root the tree, because they were shown to be in a basal position among the freshwater taxa [35,36]. Multiple alignments were accomplished with AliView program v. 1.27 [37], using MAFFT v.7 alignments [38]. Then, we implemented the program Gblocks 0.91b [39] to determine and exclude ambiguously aligned rDNA region, under the following parameters: minimum number of sequences for a conserved position: 46; minimum number of sequences for a flanking position: 77; maximum number of contiguous non-conserved positions: 8; minimum length of a block: 10; allowed gap positions: all.
Phylogenetic reconstructions were made under Bayesian inference (BI) and maximum likelihood (ML) criteria. BI analyses were performed with MrBayes 3.2.1 [40]. The optimal nucleotide substitution model under Akaike Information Criterion (AIC) selected by JModelTest 2.0.7 [41] was TPM2uf+I+G. Since it is not available in MrBayes, the GTR+I+G model was used as the closest available model. The program was run with four Markov chains, each 10,000,000 generations long. These were sampled every 200 trees with a burn-in of 25%. ML analysis was executed in RAxML 8.2.12 [42] on the CIPRES Science Gateway v.3.3 (www.phylo.org) portal [43], using the GTRGAMMA + I model; 1000 bootstrap iterations were performed.

3. Results

Although the biodiversity of numerous invertebrate groups in the Guadalquivir basin—one of the largest in the Iberian Peninsula—has been studied for several years, freshwater sponges have been forgotten until recently [27]. In this paper, we report a new record of an invasive sponge in this river, which is also the first record of the species for Europe.

3.1. Description of Rosulaspongilla rhadinaea (Annandale, 1919)

Phylum Porifera Grant, 1836
Class Demospongiae Sollas, 1885
Subclass Heteroscleromorpha Cárdenas, Perez and Boury-Esnault, 2012
Order Spongillida Manconi and Pronzato, 2002
Family Spongillidae Gray, 1867
Genus Rosulaspongilla Sokolova, Palatov, Masuda and Itskovich, 2021
Rosulaspongilla rhadinaea (Annandale, 1919)
Spongilla alba var. rhadinaea Annandale, 1919, p. 85; Gee, 1930–31, p. 47; 1931–32, p. 36.

3.1.1. Material Studied

Guadalquivir canal (37°23′45.3″ N 6°00′14.2″ W), 13 July 2023; three specimens (CE-DZ-US: 13; CE-DZ-US: 14; CE-DZ-US: 15), 24 September 2024, three specimens (CE-DZ-US: 16; CE-DZ-US: 17; CE-DZ-US: 18)

3.1.2. Description

Encrusting to cushion shaped sponge, up to 3.5 cm thick, adhered to substrata by a basal plate. The surface was uneven and irregular, with ridges, grooves, and small, erect, slightly lobose processes up to 0.5 cm high (Figure 1c). A few not protruding oscula were observed. Gemmules were light brown, abundant in the base of mature sponges (Figure 1d). A translucent, dermal membrane was observable in some parts of the sponge, which delimited rounded subdermal spaces (Figure 1e). Consistency was variable; fragile and soft, or hard and relatively compact. Color in situ and after conservation in absolute ethanol was brownish yellow.

3.1.3. Skeleton

Choanosomal skeleton reticulated, with distinguishable primary and secondary spicule tracts. Longitudinal primary fibers were more clearly observed toward the sponge surface. Megascleres are slightly curved, robust, smooth oxeas, with acerate tips. Rarely with bluntly pointed tips (Figure 2a,b). Measurements: 193-(269)-399 × 4.4-(13.9)-21 μm. Microscleres were thin, fusiform bluntly pointed microxeas, densely spined. Near both extremities, they were covered by straight or recurved single spines acutely pointed towards the center of the spicule (Figure 2c). At the center of the spicule, spines were grouped in bouquets. Each one included a proximal smooth stalk and a distal rosette of microspines (Figure 2d). Measurements: 74-(129)-153 × 2.5-(3.7)-4.5 μm. Gemuloscleres were straight to slightly curved acanthoxeas, with acerate triangular spines distributed along their length (Figure 3a). More concentrated near the extremities but not forming mace-like heads; most of these spines are curved towards the center of the spicule near both extremities, and usually quite straight in the middle. Measurements: 69-(88.0)-109 × 4.1-(6.8)-10 μm. Some transformed into acanthostrongyles (Figure 3b,c). Measurements: 27-(44)-69 × 5-(7)-10 μm.
Figure 2. SEM images of spicules of Rosulaspongilla rhadinaea. (a) Megascleres. (b) Tips of two megascleres. (c) Microscleres (slender slightly curved, spiny oxeas). (d) Detail of the spinulation of microscleres (middle part of the spicule) where rosettes of microspines are observed.
Figure 3. SEM images of spicules of Rosulaspongilla rhadinaea. (a) Typical gemmuloscleres. Short, robust, spiny oxeas. (b) Some gemmuloscleres with rounded tips like strongyles. (c) Small gemmuloscleres in form of spiny strongyles. They are very rare in abundance.

3.1.4. Gemmules

They are spherical, abundant in the base of the sponge (Figure 1d and Figure 4a). Measurements: 490-(520)-550 μm. Foramen in a single depression (Figure 4b). The theca is trilayered, with the pneumatic layer characteristically composed by a fine mesh (Figure 4c). Gemmuloscleres are tangentially arranged in the outer layer and obliquely in the pneumatic layer (Figure 4c). Without gemmular cage.
Figure 4. SEM images of gemmules of Rosulaspongilla rhadinaea. (a) General view of a gemmule. (b) Foramen. (c) Cross section of a gemmule. The arrow points to the fine mesh of the pneumatic layer. Gemmoscleres are clearly observable sparsely and irregularly embedded in the pneumatic and outer coat layers.

3.2. Habitat and Distribution

Prior to this study, the species had been identified in the seasonal Lake Hamun (Sistan, Iran), which desiccates for a significant portion of each year [44], as well as in Lake Bazovskoe and Jili-Kul (Vakhsh River valley) (Tajikistan) [45]. The species has been observed in lentic and lotic fresh and brackish inland waters, as well as on stones, plant stems, reed beds, and roots. It has also been found on breakwaters, rocks, aquatic plants, and the invasive mussel Mytilopsis leucophaeata (this study).

3.3. Molecular Results

Complete ITS (ITS1-5.8-ITS2) sequences of Rosulaspongilla rhadinaea were difficult to obtain initially. Therefore, we conducted several PCR experiments, mainly combining different sets of primers to get robust and well-defined PCR bands (in agarose gels) and better-quality sequences. After analyzing and editing several obtained sequences of distinct sizes, the sequence of ITS’s region was identical for both analyzed individuals. Complete sequences were 785 bp length, where ITS1 was longer (326 bp) than ITS2 (300 pb). Our sequences varied in two polymorphic sites with respect to the sequence of R. rhadinaea available in GenBank (accession: MT894006).
The multiple ITS sequence alignments, including our sequences and other species sequences downloaded from GenBank (see Materials and methods), resulted in 946 bp in length; however, after deleting ambiguously aligned sites in the Gblocks program, we retrieved an alignment of 605 pb, where 375 pb were variable sites, of which 286 pb parsimony-informative.
The phylogenetic reconstructions recovered from both analyses (ML and BI) were mainly consistent in topology and robustness with each other. However, the ML tree showed more steps some slightly lower-supported branches than BI. Therefore, we display the BI tree topology (Figure 5), which shows at the nodes the Posterior Probability (PP) obtained from BI, followed by the Bootstrap Proportion (BP) from the ML analysis.
Figure 5. Bayesian phylogenetic ITS rDNA tree of Spongillida. The numbers on the branches represent posterior probabilities (%) (PP)/bootstrap proportions (BP) of Maximum likelihood; a (–) indicates that a particular analysis supported the node at less than 50% or supported an alternative phylogenetic arrangement in the ML tree. The obtained sequences from this study are shown in bold. Numbers after each species name refer to NCBI GenBank accession.
Although our ITS phylogenetic reconstruction has not entirely resolved the internal relationships of the Spongillida (showing a few polytomies), it was consistent with the previously published phylogenetic hypothesis, where the family Spongillidae was not retrieved as monophyletic [45,46]. Our tree topology also shows the monophyly of the family Lubomirskiidae (100 PP/96%) and some genera of the family Spongillidae (Heteromeyenia, Corvospongilla, Racekiela, Heterorotula, Radiospongilla, and Eunapius) in well-supported clades (>80% PP and BP). It also retrieved the polyphyletic group formed by Ephydatia and Cortispongilla (100 PP/90 BP%) (Figure 5). Our sequences were clustered together with Rosulospongilla rhadinaea (MT894010) (100 PP/100 BP%), confirming the species morphological identification of our specimens. The R. rhadinaea clade was closely related with strong support (100 PP/100 BP%) to one clade formed by sequences of R. alba and Spongilla manconiae Calcinai et al. 2020. This last well-supported group (98 PP/100%) suggests that S. manconiae could really be a Rosulaspongilla. The Rosulaspongilla clade was clustered together with representatives of Corvospongilla simanensis (100 PP/100%), which was clustered with a clade of genus Heteromeyenia, and another clade including the rest of freshwater sponges in a basal polytomy (Figure 5).

3.4. Taxonomic Remarks

The genus Rosulaspongilla was established by Sokolova et al. [45] to harbor Spongilla alba (Carter 1849) and S. alba var. rhadinaea (Annandale 1919) (now R. alba and R. rhadinaea, respectively). The most important character used to separate both species is the structure of the gemmuloscleres: these are with spines accumulated at the tips like a mace-shaped head in R. alba, and without mace-shaped head in R. rhadinaea. This latter species is also characterized by the presence of strongyles or bluntly pointed oxeas among megascleres. Although no true strongyles have been observed in our specimens—only a small proportion of blunt oxeas—the morphology of their gemmuloscleres is closer to R. rhadinaea than R. alba. In addition, our specimens are genetically closer to R. rhadinaea than to R. alba, which leaves no doubt as to their identity (Figure 5). Sokolova et al. [45] also suggested that Spongilla cenota by its morphological character should be transferred to the genus Rosulaspongilla. Our molecular tree topology also revealed the close relationship between the sequences of Spongilla manconiae and R. alba, in a well-supported Rosulaspongilla clade (Figure 5). In fact, a review of ITS nucleotide sequence revealed the presence of only three polymorphic sites between both species. Therefore, the morphological and molecular data not only suggest that S. manconiae should be transferred to Rosulaspongilla, but also that it could be the same species as R. alba.

4. Discussion

4.1. Rosulaspongilla rhadinaea: A New Alien Freshwater Sponge in Europe

Freshwater ecosystems are among the most threatened on the planet [47]. One of their most important threats is the invasion of alien species [48], among which sponges are currently very poorly represented, probably due to lack of studies or specialists in the group [49,50]. Here, we use morphological and genetic data to show the presence of a new alien freshwater sponge in Europe, Rosulaspongilla rhadinaea, a Ponto-Caspian species so far known only from a few localities from Iran and Tajikistán [44,45], which has been recently found in the fluvial port of Seville city (Guadalquivir River, Spain).
R. rhadinaea possibly originated in the Ponto-Caspian region [51], and where many species have evolved a wide range of salinity tolerances, making them ideally pre-adapted to invade and survive in new environments [52], as evidenced by the fact that approximately 70% of the alien species established in the Great Lakes of North America are native to the Black Sea basin. Also, one of the richest European sources of species invading inland waters is the Ponto-Caspian Region [53].

4.2. Adaptations of Freshwater Sponges for Dispersal

Gemmules are the key structure in understanding the life history and evolution of freshwater sponges, and the only life stage adapted to dispersal [54]. They are resistant to desiccation, freezing, salinity, and anoxia for long periods of time [55], which provide the potential for their dispersal on the hulls of ocean-going ships that travel to freshwater ports [56]. Some of the most cosmopolitan sponge species are precisely those that have shown the greatest resistance to factors such as salinity. Gemmules of Eunapius fragilis survived exposure to 30 ppt seawater at 20 °C for up to 27 days and to 37 ppt for up to at least 9 days [12]. Ephydatia fluviatilis has been reported in water of up to 5 ppt in Denmark [57]. Rosulaspongilla alba inhabits brackish waters near seacoasts [58,59] and its gemmules were found between the tubes of the marine polychaete Ficopomatus enigmaticus [60]. Even its larvae developed in water of 8 ppt salinity in Chilka Lake in India [61].

4.3. Freshwater Sponge Dispersal Strategies

4.3.1. Transoceanic Dispersal

Alien freshwater invertebrates are typically moved attached to ship hulls or contained in ballast water [62]. Residual sediments present in both ballasted and non-ballasted vessels may also harbor species in viable resting stages [63]. Once established, they are generally assumed to disperse using their own active mechanisms, via ocean or river currents, or via intraregional boat traffic [64]. Most freshwater or brackish-water species that foul ocean-going ships would be expected to die during the extended exposure to saline water from the marine environment. In the case of freshwater sponges, there is no evidence to suggest that they can be transported in ballast water. However, it is possible that some species may survive in the form of gemmules attached to the hulls of ocean-going ships visiting freshwater port [56]. This could be the case for the Asiatic species Eunapius carteri and the North American species Trochospongilla leidii, which were introduced by ship traffic into Central America through the Panama Canal, where they were found abundant and conspicuous on their walls [65,66]. Neither species was mentioned in an inventory of invertebrate undertaken several decades before in the Canal [67]. Other cosmopolitan species, including Spongilla lacustris, Eunapius fragilis, Ephydatia fluviatilis, and Ephydatia muelleri, were observed to be highly abundant on ship hulls and in the surrounding port facilities in harbors situated along the shores of Lake Michigan (USA) [68]. Additionally, S. lacustris and E. muelleri were documented to be thriving in soft sedimentary environments [11]. More recent examples of the expansion of freshwater sponges, probably associated with ship traffic, include Heterorotula multidentata (Weltner, 1895), a common spongillid species described in Australia [69], detected in Japan after World War II [26,70] and recently documented in Spain [27], and Heteromeyenia latitenta (Potts, 1881), described in the USA, which was subsequently identified in Mexico [46] and recently in Japan [71]. The great expansion of the range of these species has been proven morphologically as well as with molecular markers that leave no doubt about their identity (Figure 5). The above examples suggest the high dispersal capacity of freshwater sponges to move even between continents separated by saltwater masses.
In addition, transoceanic dispersal of sponge gemmules adhered to waterfowl was postulated as a mechanism of dispersal for several species [72]. The distribution of Racekiela ryderi (Potts 1882) exhibits a globally disjunct pattern between North America and northern Europe (Norway and Ireland) [73,74]. This distribution is attributed to the long-distance transport of gemmules by birds across the Atlantic Ocean [10,75]; American species of aquatic plants with similar European distributions lends credence to this argument [76]. Migratory anatids could also be the vectors responsible for the distribution of H. latitenta in Japan [71].

4.3.2. Intraregional Mechanisms of Dispersal Through Natural Corridors

Moving as a fouling organism on the hulls of ocean-going ships is probably one means of freshwater sponge dispersal between continents, and of course, it must also be within the same continent. Whereas the sea is a continuous habitat, continental waters provide extremely discontinuous habitats for most aquatic species. However, over the past century, the construction of canals that connect previously isolated watersheds has facilitated the invasion of Ponto-Caspian species to Europe [77,78]. The desire to extend navigation routes across river basin boundaries has resulted in the construction of an extensive network of navigation canals connecting the River Rhine, one of Europe’s most significant rivers, with numerous major rivers in south-western, southern, central, and eastern Europe, and beyond. This network is also linked to the Eurasian network of inland waterways [79], facilitating extensive interconnectivity. The network comprises approximately 28,000 km of navigable rivers and canals, connecting 37 countries in Europe and Central Asia (Figure 6). The appearance of 26 alien species in German waters can be attributed to the construction of canals [79]. Lake KlIycegiz (SW Turkey), where Rosulaspongilla alba coexists with marine species, is also connected to the Mediterranean Sea through a Dalyan channel [61]. The great lakes of North America, like many other inland freshwater bodies, are connected to the sea by various river corridors and canals, both natural and artificial [80]. The distribution of the Euro Asiatic alien zebra mussel Dreissena polymorpha into lakes interconnected by these corridors confirms this [81].
Figure 6. Inland waterways and shipping routes, showing the great interconnection between different river basins in Europe. Image by RRG Ordenación del Territorio y Geoinformación.
Additionally, sponge gemmules are capable of dispersing via hydrochory, whereby they float on the water surface (or are attached to a floating substrate). The pneumatic layer of the gemmules, their resilient coats, and their capacity to withstand harsh environmental conditions appear well suited to dispersal by drifting. For example, the rafting of buoyant, gemmule-laden fragments of S. lacustris was observed during annual periods of flooding in the Ottawa River [74]. Gemmules of R. alba (as Spongilla manconiae) were found grown under a piece of polystyrene floating in a lake [82]. Drafting gemmules of R. rhadinaea were also observed in drift [44]. Two additional freshwater sponge life-cycle stages, namely larvae and sponge fragments, are devoid of the structural and physiological mechanisms that are necessary for movement out of water or across significant distances. It is plausible that these forms, particularly the larvae, could facilitate short-range dispersal among connected water bodies; however, their fragile structure would preclude any out-of-water transport.
Biological vector (zoochory) is also very important for many aquatic species that disperse as diapausing stages. Waterbirds that use wetlands for drinking and bathing can disperse rotifers and other invertebrates between wetlands [83], and there are increasing numbers of exotic cladocerans, amphipods, molluscs, copepods, and bryozoans observed in aquatic systems [62], which may have been dispersed by resistant eggs via birds [84,85,86].
Gemmules float on the water surface and possess spiny spicules that act as hooks for the adhesion to feathers and scales of migrating birds, mammals, etc., which may transport them to remote areas.
Furthermore, fish can act as a biological vector. Fragments and gemmules of the sponge Oncosclera navicella have been identified within the stomach contents of the fishes Hypostomus regani and Megalancistrus aculeatus [87]. In the great lakes of Africa, fishes feed on different species of sponges, and although no gemmules have been reported in their stomachs, they probably would appear in more directed studies [88].
Piscivorous birds or endozoochory (ingestion and egestion by animals) also may be important in the movement of sponges between river catchments. Green and Figuerola [89] found 256 intact invertebrate propagules, including 186 gemmules of the sponge Ephydatia fluviatilis from one pellet of a great cormorant. This bird regurgitates pellets containing intact propagules previously ingested by fish prey [90]. Although there is no scientific evidence, anemochory cannot be completely discarded. For this, sponges must face desiccation for gemmules to be dispersed by wind. This possibility is possible for aestivant populations subjected to desiccation of water bodies [13], like the extraordinary phenomenon “arboreal sponges” reported in the Neotropical Region during extremely dry conditions in the Rio Negro River (Brazilian Amazonia) and in the Gran Pantanal (Paraguay Basin) [91].
Transport associated with other invasive freshwater species such as mussels cannot be ruled out. R. rhadinaea has been found on rocks and fouled another invasive species; the mussel Mytilopsis leucophaeata. This species, native to the east coast of North America, has been introduced to the northeastern United States and to ports and estuaries throughout Europe mainly due to river navigation or by attaching to the legs and feet of waterfowl and shorebirds, which could in turn spread gemmules of R. rhadinaea [92]. Heterorotula multidentata in Japan has been found in irrigation canals and drinking water supply systems and, interestingly, fouls the invasive mollusk Limnoperna fortunei [26].

Author Contributions

Conceptualization, J.L.C.; methodology, J.L.C. and J.A.C.-B.; formal analysis, J.L.C. and J.A.C.-B.; investigation, J.L.C., J.A.C.-B. and J.C.G.-G.; resources, J.L.C., J.A.C.-B. and J.C.G.-G.; data curation J.L.C., writing—original draft preparation, J.L.C.; writing—review and editing, J.L.C., J.A.C.-B. and J.C.G.-G.; funding acquisition, J.C.G.-G. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Data Availability Statement

The data presented in this study are available on request from the corresponding author. The sequences will be deposited in GenBank once the manuscript is accepted.

Acknowledgments

The authors thank Cristina Vaquero Aguilar of the Microscopy Service of the Centre for Research, Technology, and Innovation of the University of Seville for her help in obtaining electron microscopy photographs and Karen del Carmen Soto Vela for their assistance in the laboratory. “We also thank Autoridad Portuaria de Sevilla and Acuario de Sevilla for their logistical support and for stimulating the generation of knowledge on the Guadalquivir River related to invasive species”.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Richardson, D.M.; Pyšek, P.; Carlton, J. A compendium of essential concepts and terminology in invasion ecology. In Fifty Years of Invasion Ecology: The Legacy of Charles Elton; Richardson, D.M., Ed.; John Wiley & Sons, Ltd.: Oxford, UK, 2011; pp. 409–420. [Google Scholar]
  2. CBD. Convention on Biological Diversity. Global Strategy on Invasive Alien Species, UNEP/CBD/SBSTTA/6/INF/9, 2000, pp 1–52. Montreal. 2001. Available online: http://www.cbd.int/doc/meetings/sbstta/sbstta-06/information/sbstta-06-inf-09-en.pdf (accessed on 10 October 2024).
  3. Blackburn, T.M.; Essl, F.; Evans, T.; Hulme, P.E.; Jeschke, J.M.; Kühn, I.; Kumschick, S.; Marková, Z.; Mrugała, A.; Nentwig, W.; et al. A unified classification of alien species based on the magnitude of their environmental impacts. PLoS Biol. 2014, 12, e1001850. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Blackburn, T.M.; Bellard, C.; Ricciardi, A. Alien versus native species as drivers of recent extinctions. Front. Ecol. Environ. 2019, 17, 203–207. [Google Scholar] [CrossRef] [Scilit]
  5. IPBES. Intergovernmental Science-Policy Platform on Biodiversity and Ecosystem Services. Summary for Policymakers of the Thematic Assessment Report on Invasive Alien Species and Their Control; Roy, H.E., Pauchard, A., Stoett, P., Renard Truong, T., Bacher, S., Galil, B.S., Hulme, P.E., Ikeda, T., Sankaran, K.V., McGeoch, M.A., et al., Eds.; IPBES Secretariat: Bonn, Germany, 2023. [Google Scholar] [CrossRef]
  6. Ram, J.L.; Palazzolo, S.M. Globalization of an aquatic pest: Economic costs, ecological outcomes, and positive applications of zebra mussel invasions and expansions. Geogr. Comp. 2008, 2, 1755–1776. [Google Scholar] [CrossRef] [Scilit]
  7. Wood, T.S.; Marsh, T.G. Biofouling of wastewater treatment plants by the freshwater bryozoan, Plumatella vaihiriae (Hastings, 1929). Water Res. 1999, 33, 609–614. [Google Scholar] [CrossRef] [Scilit]
  8. Nakano, D.; Strayer, D.L. Biofouling animals in freshwater: Biology, impacts, and ecosystem engineering. Front. Ecol Environ. 2014, 12, 167–175. [Google Scholar] [CrossRef] [Scilit]
  9. Annandale, N. Description of a freshwater sponge from the North-West of Siberia. Mém. Acad. Imp. Sci. St. Pétersbourg 1915, 27, 1–3. [Google Scholar]
  10. Økland, K.A.; Økland, J. The amphiatlantic freshwater sponge Anheteromeyenia ryderi (Porifera: Spongillidae): Taxonomic-geographic implications of records from Norway. Hydrobiologia 1989, 171, 177–188. [Google Scholar] [CrossRef] [Scilit]
  11. Frost, T.M. Porifera. In Ecology and Classification of North American Freshwater Invertebrates; Thorp, J.H., Covieh, A.P., Eds.; Academic Press: New York, NY, USA, 1991; pp. 95–124. [Google Scholar]
  12. Fell, P.E. Salinity tolerance of the gemmules of Eunapius fragilis (Leidy) and the inhibition of germination by various salts. Hydrobiologia 1992, 242, 33–39. [Google Scholar] [CrossRef] [Scilit]
  13. Pronzato, R.; Manconi, R. Adaptive strategies of sponges in inland waters. Bolletino Zool. 1994, 61, 395–401. [Google Scholar] [CrossRef] [Scilit]
  14. Leidy, J. On Spongilla. Proc. Acad. Nat. Sci. USA 1851, 5, 278. [Google Scholar]
  15. De Voogd, N.J.; Alvarez, B.; Boury-Esnault, N.; Carballo, J.L.; Cárdenas, P.; Díaz, M.C.; Dohrmann, M.; Downey, R.; Goodwin, C.; Hajdu, E.; et al. World Porifera Database. 2023. Available online: https://www.marinespecies.org/porifera/ (accessed on 17 May 2023).
  16. Setiawan, E.; Yanuar, A.; Hermanto, M.E.; Riani, C.; Prayogo, F.A.; Budiharjo, A. Revisit study of freshwater sponges Eunapius carteri (Bowerbank, 1863) and a new record of Oncosclera asiatica Manconi and Ruengsawang, 2012 (Porifera: Spongillida) in Porong River, East Java, Indonesia. Hayati J. Biosci. 2023, 30, 232–245. [Google Scholar]
  17. Gollasch, S.; Nehring, S. National checklist for aquatic alien species in Germany. Aquat. Invasions 2006, 1, 245–269. [Google Scholar] [CrossRef] [Scilit]
  18. Trylis, V.V.; Babaryga, S.P.; Protasov, A.A. The first finding of freshwater sponges Eunapius carteri (Porifera, Spongillidae), beyond its common range of distribution, in cooling reservoir of Khmelnitska NPP. Vestn. Zool. 2009, 43, 347–350. [Google Scholar]
  19. Sylaieva, A.A.; Protasov, A.A.; Yarmoshenko, L.P.; Babariga, S.P. Invasive species of algae and invertebrates in the cooling pond of the Khmelnitskiy NPS. Hydrob. J. 2010, 46, 13–21. [Google Scholar] [CrossRef] [Scilit]
  20. Kocková, E.; Mlejnková, H.; Záková, Z. Dukovany Nuclear Power Plant on Water Quality in the Jihlava River Lnfluence of the and Dalesice-Mohelno System of Reservoirs (Vliv Jaderné Elektrárny Dukovany na Jakost Vody v rece Jihlave a Soustave Nádrzí Dalesice-Mohelno); Vyzkum pro praxi, sesit 43; VÚVTGM Praha: Prague, Czech Republic, 2001; p. 128. (In Czech) [Google Scholar]
  21. Kučera, P.; Opravilová, V. On the occurrence of the freshwater sponge Eunapius fragilis (Porifera: Spongillidae) in the Czech Republic (Kvyskytu houby Eunapius fragilis (Porifera: Spongillidae) v Ceské republice (In Czech). Erica Plzeií 2003, 11, 3–10. [Google Scholar]
  22. Kučera, P.; Opravilová, V. The Occurrence of the Freshwater Sponge Eunapius fragilis (Porifera, Spongillidae) in the Cezch Republic: Rare or Only Neglected Species? Zborník Recenzovaných Príspevkov ŠVK Bratislava, Univerzita Komenského: Bratislava, Slovakia, 2006; pp. 266–267. [Google Scholar]
  23. Záková, Z.; Opravilová, V.; Schenková, J.; Mlejnková, H. Occurrence of freshwater sponges (Porifera, Spongillidae) and sponge-associated organisms in the Dalesice and Mohelno reservoirs (Czech Republic). Scripta Fac. Scl. Nat. Univ. Masaryk Brun 2004, 29, 9–41. [Google Scholar]
  24. Liebmann, H. Handbook of Freshwater and Wastewater Biology (Handbuch der Frischwasserund Abwasser-Biologie); Wiley and Sons: New York, NY, USA, 1960; Volume II, p. 292. [Google Scholar]
  25. Gee, N. Studies on freshwater sponges from Australia. Rec. Austral. Mus. 1935, 19, 791–814. [Google Scholar] [CrossRef] [Scilit]
  26. Matsuoka, K. Alien freshwater sponge (Spongillidae: Heterorotula multidentata) of Toyokawa City (In Japanese). Japan Sci. Rep. Toyohashi Mus. Nat. Hist. 2011, 21, 9–10. [Google Scholar]
  27. Carballo, J.L.; Cruz-Barraza, J.A.; Domínguez-Monge, C.; Cano, C.; López-González, P.J. First report of the invasive freshwater sponge Heterorotula multidentata (Weltner, 1895) in Europa: A latent threat for aquatic ecosystems? Limnology 2024, 25, 235–246. [Google Scholar] [CrossRef] [Scilit]
  28. King, D.L.; Ray, A.D.; Tuepker, J.L. Fresh-water sponges in raw water transmission lines. J. Am. Water Works Ass. 1969, 61, 473–475. [Google Scholar] [CrossRef] [Scilit]
  29. Memoria Anual. Puerto de Sevilla. Available online: https://www.puertodesevilla.com/images/memorias/Memoria_Puerto_de_Sevilla_2022_-_vOK.pdf (accessed on 24 September 2024).
  30. Carballo, J.L.; Cruz-Barraza, J.A.; Yáñez, B.; Gómez, P. Taxonomy and molecular systematic position of freshwater genus Racekiela (Porifera: Spongillida) with the description of a new species from northwest Mexico. Syst. Biodivers. 2018, 16, 160–170. [Google Scholar] [CrossRef] [Scilit]
  31. Cruz-Barraza, J.A.; Vega, C.; Avila, E.; Vazquez-Maldonado, L.E. Integrative taxonomy reveals the first record and a new species for the previously monotypic genus Tethytimea (Tethyida: Tethyidae) in the Gulf of Mexico. Zootaxa 2017, 4226, 113–125. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Adlard, R.; Lester, R.J. Development of a diagnostic test for Mikrocytos roughleyi, the aetiological agent of Australian winter mortality of the commercial rock oyster, Saccostrea commercialis (Iredale and Roughley). J. Fish Dis. 1995, 18, 609–614. [Google Scholar] [CrossRef] [Scilit]
  33. White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocol: A Guide to Methods and Applications; Innes, M., Gelfand, J., Sminsky, J., White, T., Eds.; Academic Press Inc.: New York, NY, USA, 1990; pp. 315–322. [Google Scholar]
  34. Erpenbeck, D.; Steiner, M.; Schuster, A.; Genner, M.J.; Manconi, R.; Pronzato, R.; Ruthensteiner, B.; van den Spiegel, D.; Van Soest, R.W.M.; Wörheide, G. Minimalist barcodes for sponges: A case study classifying African freshwater Spongillida. Genome 2019, 62, 1–10. [Google Scholar] [CrossRef] [Scilit]
  35. Itskovich, V.B.; Belikov, S.I.; Efremova, S.M.; Masuda, Y.; Krasko, A.; Schroeder, H.C.; Mueller, W.E.G. Monophyletic origin of freshwater sponges in ancient lakes based on partial structures of COXI gene. Hydrobiologia 2006, 568, 155–159. [Google Scholar] [CrossRef] [Scilit]
  36. Itskovich, V.; Gontcharov, A.; Masuda, Y.; Nohno, T.; Belikov, S.; Efremova, S.; Meixner, M.; Janussen, D. Ribosomal ITS sequences allow resolution of freshwater sponge phylogeny with alignments guided by secondary structure prediction. J. Mol. Evol. 2008, 67, 608–620. [Google Scholar] [CrossRef] [Scilit]
  37. Larsson, A. AliView: A fast and lightweight alignment viewer and editor for large datasets. Bioinformatics 2014, 30, 3276–3278. [Google Scholar] [CrossRef] [Scilit]
  38. Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [Scilit]
  39. Castresana, J. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol Biol Evol. 2000, 17, 540–552. [Google Scholar] [CrossRef] [Scilit]
  40. Ronquist, F.; Huelsenbeck, J.P. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef] [Scilit]
  41. Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. jModelTest 2: More models, new heuristics and parallel computing. Nat. Methods 2012, 9, 772. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Stamatakis, A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef] [Scilit]
  43. Miller, M.A.; Pfeiffer, W.; Schwartz, T. Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In Proceedings of the Gateway Computing Environments Workshop (GCE), New Orleans, LA, USA, 14 November 2010; pp. 1–8. [Google Scholar] [CrossRef] [Scilit]
  44. Annandale, N. Sponges, Hydrozoa and Polyzoa of Seistan. Rec. Indian Museum 1919, 18, 83–97. [Google Scholar] [CrossRef] [Scilit]
  45. Sokolova, A.M.; Palatov, D.M.; Masuda, Y.; Itskovich, V.B. Investigation of the spongillid Spongilla alba Carter, 1849 reveals a new group of brackish-water sponges. Syst. Biodivers. 2021, 19, 976–992. [Google Scholar] [CrossRef] [Scilit]
  46. Carballo, J.L.; Gómez, P.; Cruz-Barraza, J.A.; Yáñez, B. Taxonomy and molecular systematic position of the freshwater genus Heteromeyenia (Porifera: Spongillida) with the description of a new species from Mexico. Syst. Biodivers. 2021, 19, 940–956. [Google Scholar] [CrossRef] [Scilit]
  47. Tickner, D.; Opperman, J.J.; Abell, R.; Acreman, M.; Arthington, A.H.; Bunn, S.E.; Cooke, S.J.; Dalton, J.; Darwall, W.; Edwards, G. Bending the curve of global freshwater biodiversity loss: An emergency recovery plan. BioScience 2020, 70, 330–342. [Google Scholar] [CrossRef] [Scilit]
  48. Mooney, H.A.; Cleland, E.E. The evolutionary impact of invasive species. Proc. Natl. Acad. Sci. USA 2001, 98, 5446–5451. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Strayer, D.L. Alien species in fresh waters: Ecological effects, interactions with other stressors, and prospects for the future. Freshw. Biol. 2010, 55, 152–174. [Google Scholar] [CrossRef] [Scilit]
  50. Darwall, W.R.T.; Holland, R.A.; Smith, K.G.; Allen, D.; Brooks, E.G.E.; Katarya, V.; Pollock, C.M.; Shi, Y.; Clausnitzer, V.; Cumberlidge, N.; et al. Implications of bias in conservation research and investment for freshwater species. Conserv. Lett. 2011, 4, 474–482. [Google Scholar] [CrossRef] [Scilit]
  51. Jażdżewski, K. Range Extensions of some gammaridean species in European inland waters caused by human activity. Crustaceana 1980, 6, 84–107. [Google Scholar]
  52. Ketelaars, H. Range Extensions of Ponto-Caspian Aquatic Invertebrates in Continental Europe; Dumont, H., Shiganova, T.A., Niermann, U., Eds.; Kluwer Academic Publishers: Dordrecht, The Netherlands, 2004; pp. 209–236. [Google Scholar]
  53. Ricciardi, A.; MacIsaac, H.J. Recent mass invasion of the North American Great Lakes by Ponto-Caspian species. Trends Ecol. Evol. 2000, 15, 62–65. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Simpson, T.L. The Cell Biology of Sponges; Springer-Verlag: Berlin/Heidelberg, Germany; Tokyo, Japan, 1984; 662p. [Google Scholar]
  55. Reiswig, H.M.; Miller, T.L. Freshwater sponge gemmules survive months of anoxia. Invertebr. Biol. 1998, 117, 1–8. [Google Scholar] [CrossRef] [Scilit]
  56. Fell, P.E. Environmental factors affecting dormancy in the freshwater sponge Eunapius fragilis (Leidy). Int. J. Invertebr. Reprod. Dev. 1990, 18, 213–219. [Google Scholar] [CrossRef] [Scilit]
  57. Tendal, S. On the freshwater sponges of Denmark. Vid. Med. Dansk. Nat. For. 1967, 130, 173–178. [Google Scholar]
  58. Penney, J.T.; Racek, A.A. Comprehensive Revision of a Worldwide Collection of Freshwater Sponges; United States National Museum Bulletin: Washington, DC, USA, 1968; Volume 272, pp. 1–184. [Google Scholar]
  59. Poirrier, M.A.; Martin, P.S.; Baerwald, R. Comparative morphology of microsclere structure in Spongilla alba, S. cenota, and S. lacustris (Porifera: Spongillidae). Trans. Am. Micros. Soc. 1987, 106, 302–310. [Google Scholar] [CrossRef] [Scilit]
  60. Gugel, J. The occurrence of Spongilla alba Carter, 1849 (Porifera, Spongillidae) in Lake Koycegiz (SW Turkey). Zool. Middle East 1996, 12, 105–108. [Google Scholar] [CrossRef] [Scilit]
  61. Annandale, N. Fauna of the Chilka Lake: Sponges. Mem. Indian Museum 1915, 5, 21–54. [Google Scholar]
  62. Leppäkoski, E.; Gollasch, S.; Olenin, S. (Eds.) Invasive Aquatic Species of Europe—Distribution, Impacts and Management; Kluwer Academic Publishers: Dordrecht, The Netherlands, 2002. [Google Scholar]
  63. Bailey, S.A.; Duggan, I.C.; van Overdijk, C.D.A.; Jenkins, P.T.; MacIsaac, H.J. Viability of invertebrate diapausing eggs collected from residual ballast sediment. Limnol. Oceanogr. 2003, 48, 1701–1710. [Google Scholar] [CrossRef] [Scilit]
  64. Wasson, K.; Zabinc, C.H.J.; Bedingerb, L.; Diaz, C.; Pearse, J.S. Biological invasions of estuaries without international shipping: The importance of intraregional transport. Biol. Conserv. 2001, 102, 143–153. [Google Scholar] [CrossRef] [Scilit]
  65. Jones, M.L.; Rützler, K. Invertebrates of the upper chamber, Gatun Locks, Panamá Canal, with emphasis on Trochospongilla leidii (Porifera). Mar. Biol. 1975, 33, 57–66. [Google Scholar] [CrossRef] [Scilit]
  66. Poirrier, M.A. Freshwater sponges (Porifera: Spongillidae) from Panamá. Hydrobiologia 1990, 194, 203–205. [Google Scholar] [CrossRef] [Scilit]
  67. Hildebrand, S.F. The Panama Canal as a passageway for fishes, with lists and remarks on the fishes and invertebrates observed. Zoologica 1939, 24, 15–45. [Google Scholar] [CrossRef] [Scilit]
  68. Lauer, T.E.; Spacie, A. New records of freshwater sponges (Porifera) for southern Lake Michigan. J. Great Lakes Res. 1996, 22, 77–82. [Google Scholar] [CrossRef] [Scilit]
  69. Racek, A.A. The freshwater sponges of Australia (Porifera: Spongillidae). Mar. Freshwater Res. 1969, 20, 267–310. [Google Scholar] [CrossRef] [Scilit]
  70. Masuda, Y. An overview of Japanese freshwater sponges. Proc. Jpn. Soc. Syst. Zool. 2006, 20, 15–22. [Google Scholar] [CrossRef]
  71. Torii, T.; Masuda, Y.; Shirako, T.; Kobayashi, T. First record of the North American freshwater sponge Heteromeyenia latitenta (Potts, 1881) found in Japan (Spongillida: Spongillidae). Bioinvasions Rec. 2023, 12, 245–256. [Google Scholar] [CrossRef] [Scilit]
  72. Waterston, A.R. Present knowledge of the non-marine invertebrate fauna of the Outer Hebrides. Proc. R. Soc. Edinb. Sect. B Biol. 1981, 79, 215–321. [Google Scholar] [CrossRef] [Scilit]
  73. MacKay, A.H. A freshwater sponge from Sable Island. Proc. Trans. N. S. Inst. Sci. 1900, 10, 319–322. [Google Scholar]
  74. Ricciardi, A.; Reiswig, H.M. Freshwater sponges (Porifera, Spongillidae) of Eastern Canada: Taxonomy, distribution, and ecology. Can. J. Zool. 1993, 71, 665–682. [Google Scholar] [CrossRef] [Scilit]
  75. Stephens, J. The freshwater sponges of Ireland. Proc. Roy. Irish Acad. 1920, 35, 205–254. [Google Scholar]
  76. Lindroth, C.H. The Faunal Connections Between Europe and North America; Almqvist & Wiksell; Wiley: Stockholm, NY, USA, 1957; p. 344. [Google Scholar]
  77. Bij de Vaate, A.; Jazdzewski, K.; Ketelaars, H.A.M.; Gollasch, S.; Van der Velde, G. Geographical patterns in range extension of Ponto-Caspian macroinvertebrate species in Europe. Can. J. Fish. Aquat. Sci. 2002, 59, 1159–1174. [Google Scholar] [CrossRef] [Scilit]
  78. Panov, V.E.; Alexandrov, B.; Arbaciauskas, K.; Binimelis, R.; Copp, G.H.; Grabowski, M.; Lucy, F.; Leuven, R.S.; Nehring, S.; Paunović, M.; et al. Assessing the risks of aquatic species invasions via European inland waterways: The concepts and environmental indicators. Integr. Environ. Assess. Manag. 2009, 5, 110–126. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  79. Leuven, R.S.E.W.; van der Velde, G.; Baijens, I.; Snijders, J.; van der Zwart, C.; Lenders, H.J.R.; de Vaate, A. The River Rhine: A global highway for dispersal of aquatic invasive species. Biol. Invasions 2009, 11, 1989–2008. [Google Scholar] [CrossRef] [Scilit]
  80. Holeck, K.T.; Mills, E.L.; Macisaac, H.J.; Dochoda, M.R.; Colautti, R.I.; Ricciardi, A. Bridging troubled waters: Biological invasions, transoceanic shipping and the Laurentian Great Lakes. BioScience 2004, 54, 919–929. [Google Scholar] [CrossRef] [Scilit]
  81. Carlton, J.T. The zebra mussel Dreissena polymorpha found in North America in 1986 and 1987. J. Gt. Lakes Res. 2008, 34, 770–773. [Google Scholar] [CrossRef]
  82. Calcinai, B.; Cerrano, C.; Núñez-Pons, L.; Pansini, M.; Thung, D.C.; Bertolino, M. A new species of Spongilla (Porifera, Demospongiae) from a Karst Lake in Ha Long Bay (Vietnam). J. Mar. Sci. Eng. 2020, 8, 1008. [Google Scholar] [CrossRef] [Scilit]
  83. Maguire, B. The passive dispersal of small aquatic organisms and their colonization of isolated bodies of water. Ecol. Monogr. 1963, 33, 161–185. [Google Scholar] [CrossRef] [Scilit]
  84. Wesselingh, F.; Cadée, G.; Renema, W. Flying high: On the airborne dispersal of aquatic organisms as illustrated by the distribution histories of the gastropod genera Tryonia and Planorbarius. Geol. Mijnb. 1999, 78, 165–174. [Google Scholar] [CrossRef] [Scilit]
  85. Figuerola, J.; Green, A.J. Dispersal of aquatic organisms by waterbirds: A review of past research and priorities for future studies. Freshw. Biol. 2002, 47, 483–494. [Google Scholar] [CrossRef] [Scilit]
  86. Figuerola, J.; Green, A.J.; Black, K.; Okamura, B. Influence of gut morphology on passive transport of bryozoans by waterfowl in Doñana (southwestern Spain). Can. J. Zool. 2004, 82, 835–840. [Google Scholar] [CrossRef] [Scilit]
  87. Volkmer-Ribeiro, C.; Hatanaka, T. Nota cientifica: Composicao especifica e substrato da espongofauna (Porifera) no lago da usina hidroeletrica de Tucurui, Para, Brasil. Iheringia. Ser. Zool. 1991, 71, 177–178. [Google Scholar]
  88. Trewavas, E.; Green, J.; Corbet, S.A. Ecological studies on crater lakes in west Cameroon: Fishes of Barombi Mbo. J. Zool. 1972, 167, 41–95. [Google Scholar] [CrossRef] [Scilit]
  89. Green, A.J.; Figuerola, J. Recent advances in the study of long-distance dispersal of aquatic invertebrates via birds. Divers. Distrib. 2005, 11, 149–156. [Google Scholar] [CrossRef] [Scilit]
  90. Van Leeuwen, C.H.A.; Lovas-Kiss, A.; Ovegard, M.; Green, A.J. Great cormorants reveal overlooked secondary dispersal of plants and invertebrates by piscivorous waterbirds. Biol. Lett. 2017, 13, 20170406. [Google Scholar] [CrossRef] [Scilit]
  91. Archibold, O.W. Ecology of World Vegetation; Springer Business Media: Dordrecht, The Netherlands, 1995; 510p. [Google Scholar] [CrossRef] [Scilit]
  92. Verween, A.; Vincx, M.; Degraer, S. Mytilopsis leucophaeata: The brackish water equivalent of Dreissena polymorpha? A review. In The Zebra Mussel in Europe; van der Velde, G., Rajagopal, S., bij de Vaate, A., Eds.; Backhuys Publishers: Leiden, The Netherlands, 2006; pp. 29–44. [Google Scholar]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Article Metrics

Citations

Article Access Statistics

Multiple requests from the same IP address are counted as one view.