Next Article in Journal
A Revision of Dispersal Strategies in Freshwater Sponges: The Journey of the Ponto-Caspian Sponge Rosulaspongilla rhadinaea (Porifera: Spongillidae), a New Alien Species for Europe
Previous Article in Journal
Temporal and Spatial Dynamics of Carbon, Nitrogen, and Phosphorus in a Subtropical Urban River (Tamanduateí River, São Paulo, Brazil)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antibiotic Resistance Genes Detection in Several Local Cyanobacteria Isolates

by
Harith K. Buniya
1,*,
Nuha A. Mohammed
1 and
Dhyauldeen Aftan Al-Hayani
2
1
Department of Biology, College of Education for Pure Sciences, University of Anbar, Ramadi 31001, Anbar, Iraq
2
Department of medical Laboratories Technique, College of Health and Medical Technology, University of Al-Maarif, Ramadi 31001, Anbar, Iraq
*
Author to whom correspondence should be addressed.
Limnol. Rev. 2024, 24(4), 568-576; https://doi.org/10.3390/limnolrev24040033
Submission received: 26 July 2024 / Revised: 10 October 2024 / Accepted: 19 November 2024 / Published: 23 November 2024

Abstract

Antibiotic resistance in cyanobacteria represents a global threat to public health. The widespread presence of cyanobacteria in aquatic environments exposes them to antibiotic contamination. Cyanobacteria are also in direct contact with pathogenic bacteria containing antibiotic-resistance genes (ARGs), which impart these characteristics to them. This study aims to examine the presence of some ARGs in locally isolated cyanobacteria species, Spirulina laxa, Chroococcus minutes, Oscillatoria princeps, Oscillatoria proteus, Oscillatoria terebriformis, and Lyngbya epiphytica, and compare the presence of these genes in two pathogenic bacteria, Escherichia coli and Klebsiella pneumoniae. Ampicillin (Ap) and erythromycin (Em) resistance genes were detected in five algal samples. Meanwhile, Chloramphenicol (Cm) and gentamicin (Gm) resistance genes were apparent in only two species. Genes encoding resistance towards kanamycin (Km) and spectinomycin (Sp) were recorded in three specimens. It was also found that E. coli possessed resistance genes for four antibiotics, ampicillin (Ap), erythromycin (Em), gentamicin (Gm), and kanamycin (Km), whereas K. pneumoniae was resistant towards three antibiotics, ampicillin (Ap), gentamicin (Gm), and kanamycin (Km). The results show that there is a match in antibiotic-resistance genes in both cyanobacteria and pathogenic bacteria. Suggesting the possibility that cyanobacteria could acquire ARGs from the environment through horizontal gene transfer. Thus, freshwater cyanobacteria may play a significant role in the prevalence of ARGs in their environment.

1. Introduction

Microorganisms develop defense strategies against antibiotics, known as resistance mechanisms, to survive. There are different ways to achieve antibiotic resistance, such as preventing the entry of antibiotics into cells or DNA expressing specific proteins that can inactivate antibiotics upon exposure, which determine the mechanisms of resistance. Antimicrobial resistance is a naturally occurring action. However, increases in antimicrobial resistance are driven by a combination of bacteria exposed to antibiotics and the spread of those bacteria and their resistance mechanisms via DNA mutation or horizontal gene transfer [1,2].
Considering the severe threat to public health and antibiotic treatment effectiveness that antibiotic resistance poses, it represents a significant concern in microbiology. Increasing use and misuse of antimicrobials, as well as other factors, such as pollution, create good conditions for bacteria to develop resistance in humans and the environment. Non-resistance bacteria and normal flora in water, soil, and air can obtain resistance following contact with resistant bacteria. Human exposure to antimicrobial resistance in the environment can occur through contact with polluted waters, contaminated food, and other pathways that carry antimicrobial-resistant microorganisms. Nevertheless, most studies on antibiotic resistance have focused on infection-causing bacteria in humans, animals, and plants [3]. Antibiotic resistance has also been reported in other organisms, including fungi and cyanobacteria [4].
Cyanobacteria (also called blue-green algae: Cyanophyta) are photosynthetic Gram-negative prokaryotes that are unique in the microbial world. They grow in diverse habitats and play a crucial role in ecosystems. They can be found in aquatic systems (freshwater and seawater), moist soil, and other habitats such as epiphytic, epizoic, and endozoic environments. Cyanobacteria are highly diverse in morphology, exhibiting unicellular, filamentous, aggregate, and colonial forms. Most have simple DNA structures consisting of a single circular chromosome, which allows for DNA transformation. Their genome varies in size from 1.4 to 12 Mbp [5,6].
Cyanobacteria perform photosynthesis, fix carbon, produce oxygen, and can be used to make biofuel and fix nitrogen gas, which increases soil fertility and aids in the treatment of industrial wastewater by removing heavy metals, phosphate, and ammonia. Additionally, they synthesize a wide range of novel secondary metabolite compounds, including antioxidants, vitamins, and other biologically active compounds that have antibacterial, antiviral, antifungal, and anticancer properties [7]. Some cyanobacteria species can be engineered for biotechnological objectives using DNA recombination to activate newly introduced genes of industrial interest [8].
Nonetheless, cyanobacteria form harmful algal blooms (cyanoHABs) under certain conditions, producing toxins that can negatively impact humans, animals, aquatic health, and ecosystems moreover, they decrease water quality, alter the bacterial community structure and disrupt recreation and human health [9]. Although cyanobacteria do not directly cause human infections, they can still develop antibiotic resistance. A reason for the phenomenon is the widespread utilization of antibiotics for medical and veterinary purposes and by various industries, such as agriculture, aquaculture, and livestock. The vast scale of antibiotic use and antibiotic misuse speed up the evolution of antibiotic-resistant bacteria (ARB) and antibiotic-resistance genes (ARG) in the aquatic environment, including cyanobacteria and other microorganisms [10,11].
Antibiotic resistance may be intrinsic or induced. Intrinsic resistance is a natural occurrence that constitutes 3% of the bacterial genome; it is independent of previous antibiotic exposure and not related to horizontal gene transfer. Induced resistance involves genes that are naturally occurring in the bacteria, located on the plasmid, but are only expressed at resistance levels after exposure to an antibiotic. These genes may be transferred from bacteria to cyanobacteria via horizontal gene transfer (HGT). There are three main ways to transfer DNA among microorganisms: conjugation, transformation, and transduction. Horizontal gene transfer promotes the transmission of antibiotic resistance genes (ARGs) among bacteria and cyanobacteria via genetic mobile elements such as plasmids, transposons, and integrons [12,13].
The presence of antibiotic-resistant cyanobacteria in aquatic environments is concerning as these microorganisms could contribute to the dissemination of resistance genes to other bacteria, including those that are pathogenic to humans. Moreover, cyanotoxin production by particular cyanobacterial species may increase under high antibiotic concentrations in water environments [14]. Cyanotoxins are potent toxins that can harm humans and animals. People exposed to algal cyanotoxins through the consumption of impure foods or dietary additives or by swallowing contaminated water may experience symptoms such as headache, nausea, and stomach pain, as well as neurological symptoms including muscle feebleness and dizziness, depending on the type of cyanotoxins involved [15].
This study aimed to investigate and detect antibiotic resistance genes in some locally isolated freshwater cyanobacteria (blue-green algae) species; the results were then compared for the same antibiotic resistance genes in local pathogenic bacteria isolated from disease cases to investigate the presence and spread of these genes in microorganisms (other than bacteria) in Iraqi freshwater.

2. Materials and Methods

2.1. Algal Isolates

The following blue-green algae species were employed in this study: Spirulina laxa G.M. Smith, Chroococcus minutes (Ktz.) Naegeli, Oscillatoria princeps Vaucher, Oscillatoria proteus Skuja, Oscillatoria terebriformis Agardh, and Lyngbya epiphytica Hieron. Algal samples were obtained from the postgraduate laboratory of the Department of Biology, College of Education for Pure Sciences, University of Anbar. The specimens were initially collected from the Euphrates River in Ramadi City, Anbar Province, in western Iraq, for genetic and physiological research [16,17]. Using micropipette washing technique, the algal samples were isolated to obtain unialgal cultures. Subsequently, a centrifuge washing technique was employed to purify the algal samples toward axenic cultures, which was confirmed using the streak plating technique [18]. The study samples were cultured in BG11 medium from HIMEDIA (India) and prepared according to the manufacturer’s guidelines. Using 100 mL of BG11 medium in a 500 mL conical flask, the cultures were incubated at 22 ± 2 °C with a 14:10 h light/dark cycle under illumination using cool white LED light to obtain the biomass required for algal DNA extraction. The biomass was collected at the end of the log phase (after 15 days) using centrifugation at 5000 rpm for 5 min.

2.2. Bacterial Isolates

The current study utilized Escherichia coli and Klebsiella pneumoniae strains from the Microbiology Laboratory of the Department of Biology, College of Education for Pure Science, University of Anbar. E. coli and K. pneumoniae were sourced from UTI and sputum, respectively. The bacterial isolates were cultured in an LB broth medium, which consisted of 10% tryptone, 5% yeast extract, and 10% sodium chloride (NaCl). Bacterial cultures of 5 mL in 15 mL test tubes were incubated at 37 °C for 18 h and then centrifuged at 8000 rpm for 10 min in a 1.5 mL Eppendorf microcentrifuge tube to collect the bacterial pellet for DNA extraction.

2.3. Genomic DNA Extraction

The algal and bacterial DNA samples were extracted separately from the cultures using a genomic DNA extraction kit supplied by Geneaid (Taiwan). A total of 100 mg of wet weight was used for the algal culture, and 1.5 mL of overnight culture was used for the bacteria. The extracted DNA was confirmed using 0.8% agarose gel electrophoresis, with 160 mg of agarose dissolved in 20 mL of TBE buffer. The extracted DNA was stored at −20 °C until use.

2.4. Polymerase Chain Reaction

Specific primers for six antibiotic-resistance genes were utilized during the polymerase chain reaction (PCR) performed in the present study. The antibiotics evaluated were gentamicin (Gm), spectinomycin (Sp), ampicillin (Ap), chloramphenicol (Cm), erythromycin (Em), and kanamycin (Km). The primer sequence, name, and PCR product for each gene are listed in Table 1 [19]. The reaction mixture was prepared using an Accupower® GOLD Multiplex kit supplied by Bioneer (Republic of Korea), following the manufacturer’s instructions. The PCR was performed using a thermocycler (DLAB- T1000-G, USA). The PCR program involved an initial denaturation at 95 °C for 5 min, followed by 35 cycles (denaturation at 95 °C for 1 min, annealing at 56 °C for 1 min, then extension at 72 °C for 1 min, and final extension at 72 °C for 5 min). The PCR products were then run on 1.5% agarose gel (300 mg of agarose in 20 mL of TBE buffer).

3. Results

The studied isolate Spirulina laxa G.M. Smith (S. laxa), Chroococcus minutes (Ktz.) Naegeli (C. minutes), Oscillatoria princeps Vaucher (O. princeps), Oscillatoria proteus Skuja (O. proteus), Oscillatoria terebriformis Agardh (O. terebriformis), and Lyngbya epiphytica Hieron (L. epiphytica) were identified based on work of Bellinger and Sigee 2010 [20]. Then, the identification of study samples was confirmed through the amplification of the 16srRNA gene following chromosomal DNA extraction. The sequences were submitted to NCBI for alignment, and the corresponding accession numbers were obtained [21]. The algal and bacterial DNA extract yields from the specimens in the present study were assessed using 0.8% agarose gel electrophoresis. Subsequently, the DNA was employed as a template to detect the antibiotic resistance genes of different antibiotics utilizing specific primers.
A previous study reported the ability of several blue-green algae species to grow in a BG11 medium consisting of different concentrations of numerous antibiotics [22]. The findings suggested that the studied algae possess the ability to be antibiotic-resistant. The PCR results indicated that the algal samples and pathogenic bacteria contained similar DNA bands for different antibiotic resistance genes, representing antibiotic resistance genes in both types of microorganisms (see Figure 1, Figure 2 and Figure 3).
ARGs were detected in the algae and pathogenic bacterium samples evaluated in this study. The bla gene (ApR) was present in all algal samples (blue-green algae and bacteria), but the ermC gene (EmR) was not observed in O. proteus and K. pneumonia. The aacC1 (GmR) and cat (CmR) genes were the least apparent in all algal samples, being present in only two algal species for each gene (Table 2). On the other hand, the algae S. laxa and O. terebriformis possess five out of six of the studied genes, whereas O. princeps has only two antibiotic-resistance genes among those studied.
The studied pathogenic bacteria E. coli and K. pneumonia possess four antibiotic resistance genes (bla, ermC, aacC, and npt) and three antibiotic resistance genes (bla, aacC, and npt), respectively (Table 2).

4. Discussion

Freshwater ecosystems play a significant role in supporting life by serving as agricultural environments and providing a source of drinking water. Therefore, pollution or changes in the physical and chemical factors of these ecosystems, including cyanobacterial harmful algal blooms (cyanoHABs), disrupt interactions between living microorganisms, leading to variations in aquatic community structure and the spread of AR [23].
The results showed the presence of antibiotic-resistance genes in some studied species of blue-green algae isolated from the local environment. This indicates the possibility of the spread of antibiotic resistance in aquatic microorganisms in the local environment. The global distribution of cyanobacteria indicates their ability to cope with a wide range of global environmental stresses, such as high and low temperatures, nitrogen starvation, anaerobic stress and osmotic tension, photooxidation, salinity, and drought. Cyanobacteria have developed several mechanisms to defend themselves against environmental stressors [24].
Antibiotic contamination is a serious environmental and health challenge. Residual antibiotics from municipal, industrial, and agricultural wastewater and sewage discharge are continuously released into freshwater environments, where they contribute to the evolution and spread of antibiotic resistance. Therefore, it has a serious impact on aquatic organisms, especially microalgae and cyanobacteria, which play a significant role as primary producers in the water ecosystem [25]. Antibiotics also have significant negative effects on the growth of cyanophyta and their chlorophyll content, and they encourage the production of algal toxins such as microcystin. Cyanophyta are particularly susceptible to these effects because they are prokaryotic [26].
Two isolates of pathogenic bacteria resistant to antibiotics were used as a positive control to identify the extent of similarity in the presence of antibiotic resistance genes between bacteria and blue-green algae. The results indicate a similarity in the presence of antibiotic-resistance genes in both types of microorganisms (bacteria and cyanobacteria). This may indicate a high level of contamination by antibiotics in local freshwater due to various factors, which has led to the transfer of antibiotic resistance to microorganisms that did not previously possess this feature.
Antibiotics are occasionally employed in industry to prevent bacterial infections. Nevertheless, when antibiotics are released into the environment, they may exert selective pressure on bacteria, including cyanobacteria, leading to the development of resistance [27]. Increased concentrations of antibiotics may increase mutation rates and cause shifts in bacterial gene expression, biofilm formation, and virulence [28]. Long-term exposure to low concentrations of antibiotics can induce the bacterial SOS repair system, increasing the frequency of genome mutations and promoting horizontal gene transfer of mobile genetic elements, including those responsible for antibiotic resistance. This process accelerates the spread of drug-resistant genes even among phylogenetically distant microorganisms [29].
Numerous studies have reported antibiotic resistance genes (ARGs) in cyanobacteria isolated from different environments, including freshwater and marine ecosystems. These genes reportedly confer resistance to various antibiotics, including tetracyclines, beta (β)-lactams, and macrolides [30,31,32].
Antibiotic resistance is a critical global issue, and ARGs are deemed environmental contaminants that can be transmitted between antibiotic-resistant and non-antibiotic-resistant bacteria via multiple mobile genetic elements (MGEs). Furthermore, microorganisms are prevalent in various bodies of water, including surface, drinking, sewage, and natural water [33,34,35]. Antibiotic resistance in cyanobacteria could also impact the control of cyanobacterial harmful blooms, which lead to damage to water ecosystems by consuming oxygen in the water and producing high concentrations of toxins, which can kill fish and other living organisms [36].
Although cyanobacteria are ubiquitous in aquatic ecosystems and are exposed to pollution or antibiotic resistance, their role in AR expansion in natural ecosystems remains unknown [37]. Some studies have hypothesized that cyanobacteria may contain AR genes, considering their MGEs, such as plasmids. MGEs are the primary mechanism for AR gene transfer between microorganisms. Some reports suggest that plasmids may play a role in determining cyanobacterial resistance to antibiotics [38,39,40].
Plasmids play a critical role in transferring ARGs among microorganisms via horizontal gene transfer. Some studies refer to the presence of plasmids in cyanobacteria, comprising a total of 256 plasmids distributed across 145 cyanobacterial species belonging to the Oscillatoriophycideae, Synechococcales, Nostocales, Pleurocapsales, and Pseudanabaenales. More than 69 of these species have one or more extrachromosomal elements, 43 of which harbor large plasmids exceeding 100 kbp, contributing to the distribution of antimicrobial resistance genes [41].
Several cyanobacterial species reportedly resist several antibiotics, including penicillin and ampicillin [27]. For instance, a gene encoding penicillin-binding protein was recorded in the cyanobacterium Thermosynechococcus elongatus [26]. Although the finding explained the weak β-lactamase activity in the bacterium, its physiological role has not been determined. Nonetheless, a recent study reported that cyanobacteria can serve as hosts for ARGs. Cyanobacteria are also associated with CyanoHABs when the microbial community structures in freshwater are altered. Accordingly, other biotic factors (such as interactions with other microorganisms) and abiotic factors necessitate investigation [42,43,44].
Promoting responsible antibiotic utilization in all sectors, including agriculture, aquaculture, and human medicine, is essential for addressing the issue of cyanobacteria antibiotic resistance. Proper waste management and treatment could prevent antibiotic release into the environment. Monitoring antibiotic resistance in cyanobacteria and other bacteria is crucial for comprehending the extent of this issue and developing appropriate strategies to mitigate its impact. Nonetheless, no local studies have addressed antibiotic-resistance genes in blue-green algae. The significance of blue-green algae in producing toxins might be linked to their resistance to antibiotics. Consequently, future studies could focus on toxin-producing and antibiotic resistance genes in similar species.

5. Conclusions

In conclusion, the prevalence of antibiotic resistance genes (ARGs) in the locally isolated blue-green algae species evaluated in this study resembled that in the pathogenic bacterium specimens. The results highlight the importance of this study, as significant similarities between antibiotic-resistance genes in cyanobacteria and pathogenic bacteria were observed. Nevertheless, future studies on antibiotic resistance genes of cyanobacteria in other localities are necessary, along with correlating these genes with the ability to produce toxins, freshwater pollution, and the change in DNA materials via natural selection that may lead to a new generation of harmful cyanobacteria.

Author Contributions

Conceptualization, H.K.B.; methodology, H.K.B. and N.A.M.; software, D.A.A.-H.; formal analysis, N.A.M.; data curation, H.K.B. and D.A.A.-H.; writing—original draft preparation, H.K.B.; writing—review and editing, N.A.M. and D.A.A.-H.; supervision, H.K.B.; project administration, H.K.B. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Data Availability Statement

The data presented in this study are available in this article.

Acknowledgments

For their assistance in completing this work, the authors are grateful to all of the employees at the Department of Biology, College of Education for Pure Science, University Of Anbar, as well as their colleagues at the Molecular Biology Lab.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Reygaert, W.C. An overview of the antimicrobial resistance mechanisms of bacteria. AIMS Microbiol. 2018, 4, 482–501. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Jian, Z.; Zeng, L.; Xu, T.; Sun, S.; Yan, S.; Yang, L.; Huang, Y.; Jia, J. Antibiotic resistance genes in bacteria: Occurrence, spread, and control. J. Basic Microbiol. 2021, 61, 1049–1070. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Nwobodo, D.C.; Ugwu, M.C.; Anie, C.O.; Al-Ouqaili, M.T.S.; Ikem, J.C.; Chigozie, U.V.; Saki, M. Antibiotic resistance: The challenges and some emerging strategies for tackling a global menace. J. Clin. Lab. Anal. 2022, 36, e24655. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Timms, V.J.; Hassan, K.A.; Pearson, L.A.; Neilan, B.A. Cyanobacteria as a critical reservoir of the environmental antimicrobial resistome. Environ. Microbiol. 2023, 25, 2266–2276. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Cassier-Chauvat, C.; Veaudor, T.; Chauvat, F. Comparative Genomics of DNA Recombination and Repair in Cyanobacteria: Biotechnological Implications. Front. Microbiol. 2016, 7, 1809. [Google Scholar] [CrossRef] [Scilit]
  6. Labella, J.I.; Llop, A.; Contreras, A. The default cyanobacterial linked genome: An interactive platform based on cyanobacterial linkage networks to assist functional genomics. FEBS Lett. 2020, 594, 1661–1674. [Google Scholar] [CrossRef] [Scilit]
  7. MehdizadehAllaf, M.; Peerhossaini, H. Cyanobacteria: Model Microorganisms and Beyond. Microorganisms 2022, 10, 696. [Google Scholar] [CrossRef] [Scilit]
  8. Cassier-Chauvat, C.; Chauvat, F. Responses to oxidative and heavy metal stresses in cyanobacteria: Recent advances. Int. J. Mol. Sci. 2015, 16, 871–886. [Google Scholar] [CrossRef] [Scilit]
  9. Huisman, J.; Codd, G.A.; Paerl, H.W.; Ibelings, B.W.; Verspagen, J.M.H.; Visser, P.M. Cyanobacterial blooms. Nat. Rev. Microbiol. 2018, 16, 471–483. [Google Scholar] [CrossRef] [Scilit]
  10. Drury, B.; Scott, J.; Rosi-Marshall, E.J.; Kelly, J.J. Triclosan exposure increases triclosan resistance and influences taxonomic composition of benthic bacterial communities. Environ. Sci. Technol. 2013, 47, 8923–8930. [Google Scholar] [CrossRef] [Scilit]
  11. Serwecińska, L. Antimicrobials and Antibiotic-Resistant Bacteria: A Risk to the Environment and to Public Health. Water 2020, 12, 3313. [Google Scholar] [CrossRef] [Scilit]
  12. Povolo, V.R.; Ackermann, M. Disseminating antibiotic resistance during treatment. Science 2019, 364, 737–738. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Michaelis, C.; Grohmann, E. Horizontal Gene Transfer of Antibiotic Resistance Genes in Biofilms. Antibiotics 2023, 12, 328. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Lu, P.L.; Wu, Y.; Ding, H.; Zhan, W. The combined and second exposure effect of copper (II) and chlortetracycline on fresh water algae, Chlorellapyrenoidosa and Microcystisaeruginosa. Environ. Toxicol. Pharmacol. 2015, 40, 140–148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Metcalf, J.S.; Tischbein, M.; Cox, P.A.; Stommel, E.W. Cyanotoxins and the Nervous System. Toxins 2021, 13, 660. [Google Scholar] [CrossRef] [Scilit]
  16. Mohammed, N.A.; Buniya, H.K. Some Active compounds in Local Isolate of Spirulinalaxa GM SMITH. Biochem. Cell. Arch. 2022, 22, 1145–1149. [Google Scholar]
  17. Hameed, S.G.; Buniya, H.K. Determining the genetic Relationship for some local Isolate of Oscillatoria species present in the local Environment using the Inter Simple Sequence Repeat (ISSR) Technique. Adv. Life Sci. 2024. (in process). [Google Scholar]
  18. Parvin, M.; Zannat, M.N.; Habib, M.N.B. Two Important Techniques for Isolation of Microalgae. Asian Fish. Sci. 2007, 20, 117–124. [Google Scholar] [CrossRef] [Scilit]
  19. Jacobsen, J.H.; Rosgaard, L. One step plasmid construction for generation of knock-out mutants in cyanobacteria: Studies of glycogen metabolism in Synechococcus sp. PCC 7002. Photosynth. Res. 2011, 107, 215–221. [Google Scholar] [CrossRef] [Scilit]
  20. Bellinger, E.G.; Sigee, D.C. Freshwater Algae: Identification and Use as Bioindicators, 1st ed.; John Wiley & Sons Ltd.: Hoboken, NJ, USA, 2010. [Google Scholar]
  21. Buniya, H.K.; Ahmaed, M.M.; Mohammed, N.A. Detection of the HEP gene responsible for the production of Hepatotoxin in Blue-green Algae using polymerase chain reaction (PCR) Technique. JUAPS 2025, in press.
  22. Ahmaed, M.M.; Buniya, H.K. Study of Antibiotic Resistance for some local isolates of Blue-green Algae. Biochem. Cell. Arch. 2022, 22, 711–714. [Google Scholar]
  23. Bănăduc, D.; Simić, V.; Cianfaglione, K.; Barinova, S.; Afanasyev, S.; Öktener, A.; McCall, G.; Simić, S.; Curtean-Bănăduc, A. Freshwater as a Sustainable Resource and Generator of Secondary Resources in the 21st Century: Stressors, Threats, Risks, Management and Protection Strategies, and Conservation Approaches. Int. J. Environ. Res. Public. Health 2022, 19, 16570. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Yadav, P.; Singh, R.P.; Rana, S.; Joshi, D.; Kumar, D.; Bhardwaj, N.; Gupta, R.K.; Kumar, A. Mechanisms of Stress Tolerance in Cyanobacteria under Extreme Conditions. Stresses 2022, 2, 531–549. [Google Scholar] [CrossRef] [Scilit]
  25. Kulik, K.; Lenart-Boroń, A.; Wyrzykowska, K. Impact of Antibiotic Pollution on the Bacterial Population within Surface Water with Special Focus on Mountain Rivers. Water 2023, 15, 975. [Google Scholar] [CrossRef] [Scilit]
  26. Du, Y.; Wang, J.; Zhu, F.; Mai, D.; Xiang, Z.; Chen, J.; Guo, R. Comprehensive assessment of three typical antibiotics on cyanobacteria (Microcystisaeruginosa): The impact and recovery capability. Ecotoxicol. Environ. Safe 2018, 160, 84–93. [Google Scholar] [CrossRef] [Scilit]
  27. Kraemer, S.A.; Ramachandran, A.; Perron, G.G. Antibiotic Pollution in the Environment: From Microbial Ecology to Public Policy. Microorganisms 2019, 7, 180. [Google Scholar] [CrossRef] [Scilit]
  28. Laureti, L.; Matic, I.; Gutierrez, A. Bacterial responses and genome instability induced by subinhibitory concentrations of antibiotics. Antibiotics 2013, 2, 100–114. [Google Scholar] [CrossRef] [Scilit]
  29. Andersson, D.I.; Hughes, D. Microbiological effects of sublethal levels of antibiotics. Nat. Rev. Microbiol. 2014, 12, 465–478. [Google Scholar] [CrossRef] [Scilit]
  30. Urbach, C.; Fastrez, J.; Soumillion, P. A new family of cyanobacterial penicillin-binding proteins, a missing link in the evolution of class A β-lactamases. J. Biol. Chem. 2008, 283, 32516–32526. [Google Scholar] [CrossRef] [Scilit]
  31. Prasanna, R.; Madhan, K.; Singh, R.N.; Chauhan, A.K.; Nain, L. Developing biochemical and molecular markers for cyanobacterial inoculants. Folia Microbiol. 2010, 55, 474–480. [Google Scholar] [CrossRef] [Scilit]
  32. Xin, R.; Zhang, Y.; Zhang, K.; Yang, Y.; Ma, Y.; Niu, Z. Investigation of the antimicrobial susceptibility patterns of marine cyanobacteria in Bohai Bay: Cyanobacteria may be important hosts of antibiotic resistance genes in marine environment. Sci. Total Environ. 2024, 909, 168516. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Jung, A.V.; Le Cann, P.; Roig, B.; Thomas, O.; Baurès, E.; Thomas, M.F. Microbial contamination detection in water resources: Interest of current optical methods, trends and needs in the context of climate change. Int. J. Environ. Res. Public. Health 2014, 11, 4292–4310. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Ghaly, T.M.; Gillings, M.R. New perspectives on mobile genetic elements: A paradigm shift for managing the antibiotic resistance crisis. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2022, 377, 20200462. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Juwita, S.; Indrawati, A.; Damajanti, R.; SafikaMayasari, N.L.P.I. Multiple antibiotic resistance and virulence factors of Staphylococcus aureus strains isolated from dairy farms in South Sulawesi, Indonesia. Biodiversitas 2022, 23, 1015–1022. [Google Scholar] [CrossRef] [Scilit]
  36. Zhang, Q.; Zhang, Z.; Lu, T.; Peijnenburg, W.J.G.M.; Gillings, M.; Yang, X.; Chen, J.; Penuelas, J.; Zhu, Y.-G.; Zhou, N.-Y.; et al. Cyanobacterial blooms contribute to the diversity of antibiotic-resistance genes in aquatic ecosystems. Commun. Biol. 2020, 3, 737. [Google Scholar] [CrossRef] [Scilit]
  37. Dias, E.; Oliveira, M.; Jones-Dias, D.; Vasconcelos, V.; Ferreira, E.; Manageiro, V.; Caniça, M. Assessing the antibiotic susceptibility of freshwater Cyanobacteria spp. Front. Microbiol. 2015, 6, 799. [Google Scholar] [CrossRef] [Scilit]
  38. Hu, L.; Xiao, P.; Jiang, Y.; Dong, M.; Chen, Z.; Li, H.; Hu, Z.; Lei, A.; Wang, J. Transgenerational Epigenetic Inheritance Under Environmental Stress by Genome-Wide DNA Methylation Profiling in Cyanobacterium. Front. Microbiol. 2018, 9, 1479. [Google Scholar] [CrossRef] [Scilit]
  39. Li, W.X.; Mao, F.J.; Te, S.H.; He, Y.L.; Gin, K.Y.H. Impacts of Microcystis on the Dissemination of the Antibiotic Resistome in Cyanobacterial Blooms. Acs. Est. Water 2021, 1, 1263–1273. [Google Scholar] [CrossRef] [Scilit]
  40. Duan, X.; Zhang, C.; Struewing, I.; Li, X.; Allen, J.; Lu, J. Cyanotoxin-encoding genes as powerful predictors of cyanotoxin production during harmful cyanobacterial blooms in an inland freshwater lake: Evaluating a novel early-warning system. Sci. Total Environ. 2022, 830, 154568. [Google Scholar] [CrossRef] [Scilit]
  41. Ohdate, K.; Sakata, M.; Maeda, K.; Sakamaki, Y.; Nimura-Matsune, K.; Ohbayashi, R.; Hess, W.R.; Watanabe, S. Discovery of novel replication proteins for large plasmids in cyanobacteria and their potential applications in genetic engineering. Front. Microbiol. 2024, 15, 1311290. [Google Scholar] [CrossRef] [Scilit]
  42. Kim, M.J.; Kang, D.; Lee, G.D.; Kim, K.; Kim, J.; Shin, J.H.; Lee, S. Interplays between cyanobacterial blooms and antibiotic resistance genes. Environ. Int. 2023, 181, 108268. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Volk, A.; Lee, J. Cyanobacterial blooms: A player in the freshwater environmental resistome with public health relevance? Environ. Res. 2023, 216, 114612. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Wang, Z.; Chen, Q.; Zhang, J.; Guan, T.; Chen, Y.; Shi, W. Critical roles of cyanobacteria as reservoir and source for antibiotic resistance genes. Environ. Int. 2020, 144, 106034. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. The agarose gel electrophoresis (1.5%, 60 min, 70 V/cm2) results of the ARGs in Oscillatoria; (1) O. princeps, (2) O. proteus, and (3) O. terebriformis, with 100 bp DNA ladder. aad: SpR, erm: EmR, npt: KmR, bla: ApR, grm: GmR, cat: CmR. each subfigure (ac) represents two types of ARGs for 3 species belong genus Oscillatoria. the appearance of gene bands in PCR products refers to owned the freshwater cyanobacteria for characteristic of Antibiotic resistance. The ARGs bands is indicated by an arrow.
Figure 1. The agarose gel electrophoresis (1.5%, 60 min, 70 V/cm2) results of the ARGs in Oscillatoria; (1) O. princeps, (2) O. proteus, and (3) O. terebriformis, with 100 bp DNA ladder. aad: SpR, erm: EmR, npt: KmR, bla: ApR, grm: GmR, cat: CmR. each subfigure (ac) represents two types of ARGs for 3 species belong genus Oscillatoria. the appearance of gene bands in PCR products refers to owned the freshwater cyanobacteria for characteristic of Antibiotic resistance. The ARGs bands is indicated by an arrow.
Limnolrev 24 00033 g001
Figure 2. The agarose gel electrophoresis (1.5%, 60 min, 70 V/cm2) results of the ARGs in (a) Spirulinalaxa, (b) Lyngbyaepiphytica, and (c) Chroococcus minutes, with 100 bp DNA ladder. aad: SpR, erm: EmR, npt: KmR, bla: ApR, grm: GmR, cat: CmR. The ARGs bands is indicated by an arrow.
Figure 2. The agarose gel electrophoresis (1.5%, 60 min, 70 V/cm2) results of the ARGs in (a) Spirulinalaxa, (b) Lyngbyaepiphytica, and (c) Chroococcus minutes, with 100 bp DNA ladder. aad: SpR, erm: EmR, npt: KmR, bla: ApR, grm: GmR, cat: CmR. The ARGs bands is indicated by an arrow.
Limnolrev 24 00033 g002
Figure 3. The agarose gel electrophoresis (1.5%, 60 min, 70 V/cm2) results of the ARGs in the pathogenic bacteria (a) E. coli and (b) K. Pneumonia, with 100 bp DNA ladder. aad: SpR, erm: EmR, npt: KmR, bla: ApR, grm: GmR, cat: CmR. The ARGs bands is indicated by an arrow.
Figure 3. The agarose gel electrophoresis (1.5%, 60 min, 70 V/cm2) results of the ARGs in the pathogenic bacteria (a) E. coli and (b) K. Pneumonia, with 100 bp DNA ladder. aad: SpR, erm: EmR, npt: KmR, bla: ApR, grm: GmR, cat: CmR. The ARGs bands is indicated by an arrow.
Limnolrev 24 00033 g003
Table 1. The primers employed to detect the ARGs in the samples.
Table 1. The primers employed to detect the ARGs in the samples.
Gene Primer NamePrimer Sequence (5′ 3′)PCR Product Length (bp)
aacC1 (GmR)gmr1 FTCCAGAACCTTGACCGAAC654
gmr RATCACTTCTTCCCGTATGCC
aadA (SpR)aadA FTACCAAGGCAACGCTATGTTC400
aadA RATCAGAGGTAGTTGGCGTCAT
bla (ApR)bla FTTTGCCTTCCTGTTTTTGCTC593
bla RAACTTTATCCGCCTCCATCC
cat (CmR)cat FATCCCAATGGCATCGTAAAG553
cat RATCACAAACGGCATGATGAA
ermC (EmR)erm FCGCATCCGATTGCAGTATAA885
erm RTCGTCAATTCCTGCATGTTT
npt (KmR)npt FTGAATGAACTGCAGGACGAG515
npt RAATATCACGGGTAGCCAACG
Table 2. The ARGs in the locally isolated cyanophyta and bacteria.
Table 2. The ARGs in the locally isolated cyanophyta and bacteria.
SampleGene
BlaCatermCaacC1aadANpt
S. laxa+++-++
L. epiphytica+-+--+
C.minutes+-+-+-
O.princeps+-+---
O.proteus+--+++
O.terebriformis+++++-
E. coli+-++-+
K. pneumonia+--+-+
(Note: + denotes the presence of an ARG, while - corresponds to an absent ARG).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Buniya, H.K.; Mohammed, N.A.; Al-Hayani, D.A. Antibiotic Resistance Genes Detection in Several Local Cyanobacteria Isolates. Limnol. Rev. 2024, 24, 568-576. https://doi.org/10.3390/limnolrev24040033

AMA Style

Buniya HK, Mohammed NA, Al-Hayani DA. Antibiotic Resistance Genes Detection in Several Local Cyanobacteria Isolates. Limnological Review. 2024; 24(4):568-576. https://doi.org/10.3390/limnolrev24040033

Chicago/Turabian Style

Buniya, Harith K., Nuha A. Mohammed, and Dhyauldeen Aftan Al-Hayani. 2024. "Antibiotic Resistance Genes Detection in Several Local Cyanobacteria Isolates" Limnological Review 24, no. 4: 568-576. https://doi.org/10.3390/limnolrev24040033

APA Style

Buniya, H. K., Mohammed, N. A., & Al-Hayani, D. A. (2024). Antibiotic Resistance Genes Detection in Several Local Cyanobacteria Isolates. Limnological Review, 24(4), 568-576. https://doi.org/10.3390/limnolrev24040033

Article Metrics

Back to TopTop