Rosiglitazone Mitigates Dexamethasone-Induced Depression in Mice via Modulating Brain Glucose Metabolism and AMPK/mTOR Signaling Pathway
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Drugs
2.3. Induction of Depression
2.4. Experimental Design
2.5. Forced Swimming Test and Tail Suspension Test
2.6. Enzyme-Linked Immunosorbent Assay
2.7. RNA Extraction and Real Time Quantitative PCR (RT-qPCR)
2.8. Western Blotting Analysis
2.9. Statistical Analyses
3. Results
3.1. Improving Dexamethasone Induced Depression Behaviors
3.1.1. Forced Swimming Test
3.1.2. Tail Suspension Test
3.2. Reversal of GLUT1 and GLUT3 Expression Levels in Frontal Cortex and Hippocampus of Mice Post Dexamethasone Administration
3.3. Reversal of the Quantity of Vital Glycolytic Enzymes in Dexamethasone-Injected Mice Brain
3.4. Reversal of mTOR Activity by Regulation of the pAMPK/pAKT/P38MAPK/4EBP1 Pathway in Dexamethazone-Injected Mice Brain
3.5. Reversal of Nerve Growth Factor in the Brain of Dexamethasone-Injected Mice
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kessler, R.C.; Berglund, P.; Demler, O.; Jin, R.; Koretz, D.; Merikangas, K.R.; Rush, A.J.; Walters, E.E.; Wang, P.S.; National Comorbidity Survey Replication. The epidemiology of major depressive disorder: Results from the National Comorbidity Survey Replication (NCS-R). JAMA 2003, 289, 3095–3105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Henry, R.J.; Kerr, D.M.; Finn, D.P.; Roche, M. For whom the endocannabinoid tolls: Modulation of innate immune function and implications for psychiatric disorders. Prog. Neuropsychopharmacol. Biol. Psychiatry 2016, 64, 167–180. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tanaka, M.; Tóth, F.; Polyák, H.; Szabó, Á.; Mándi, Y.; Vécsei, L. Immune Influencers in Action: Metabolites and Enzymes of the Tryptophan-Kynurenine Metabolic Pathway. Biomedicines 2021, 9, 734. [Google Scholar] [CrossRef] [Scilit]
- Voorhees, J.L.; Tarr, A.J.; Wohleb, E.S.; Godbout, J.P.; Mo, X.; Sheridan, J.F.; Eubank, T.D.; Marsh, C.B. Prolonged restraint stress increases IL-6, reduces IL-10, and causes persistent depressive-like behavior that is reversed by recombinant IL-10. PLoS ONE 2013, 8, e58488. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barik, J.; Marti, F.; Morel, C.; Fernandez, S.P.; Lanteri, C.; Godeheu, G.; Tassin, J.P.; Mombereau, C.; Faure, P.; Tronche, F. Chronic stress triggers social aversion via glucocorticoid receptor in dopaminoceptive neurons. Science 2013, 339, 332–335. [Google Scholar] [CrossRef] [Scilit]
- Knierim, J.J. The hippocampus. Curr. Biol. 2015, 25, R1116–R1121. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Toni, N.; Schinder, A.F. Maturation and Functional Integration of New Granule Cells into the Adult Hippocampus. Cold Spring Harb. Perspect. Biol. 2015, 8, a018903. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abbott, C.C.; Jones, T.; Lemke, N.T.; Gallegos, P.; McClintock, S.M.; Mayer, A.R.; Bustillo, J.; Calhoun, V.D. Hippocampal structural and functional changes associated with electroconvulsive therapy response. Transl. Psychiatry 2014, 4, e483. [Google Scholar] [CrossRef] [Scilit]
- Gold, S.M.; O’Connor, M.F.; Gill, R.; Kern, K.C.; Shi, Y.; Henry, R.G.; Pelletier, D.; Mohr, D.C.; Sicotte, N.L. Detection of altered hippocampal morphology in multiple sclerosis-associated depression using automated surface mesh modeling. Hum. Brain Mapp. 2014, 35, 30–37. [Google Scholar] [CrossRef] [Scilit]
- Teffer, K.; Semendeferi, K. Human prefrontal cortex: Evolution, development, and pathology. Prog. Brain Res. 2012, 195, 191–218. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ippolito, G.; Bertaccini, R.; Tarasi, L.; Di Gregorio, F.; Trajkovic, J.; Battaglia, S.; Romei, V. The Role of Alpha Oscillations among the Main Neuropsychiatric Disorders in the Adult and Developing Human Brain: Evidence from the Last 10 Years of Research. Biomedicines 2022, 10, 3189. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ouwersloot, G.; Derksen, J.; Glas, G. Reintroducing Consciousness in Psychopathology: Review of the Literature and Conceptual Framework. Front. Psychol. 2020, 11, 586284. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Di Gregorio, F.; La Porta, F.; Petrone, V.; Battaglia, S.; Orlandi, S.; Ippolito, G.; Romei, V.; Piperno, R.; Lullini, G. Accuracy of EEG Biomarkers in the Detection of Clinical Outcome in Disorders of Consciousness after Severe Acquired Brain Injury: Preliminary Results of a Pilot Study Using a Machine Learning Approach. Biomedicines 2022, 10, 1897. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hosokawa, N.; Hara, T.; Kaizuka, T.; Kishi, C.; Takamura, A.; Miura, Y.; Iemura, S.; Natsume, T.; Takehana, K.; Yamada, N.; et al. Nutrient-dependent mTORC1 association with the ULK1-Atg13-FIP200 complex required for autophagy. Mol. Biol. Cell 2009, 20, 1981–1991. [Google Scholar] [CrossRef] [Scilit]
- Detka, J.; Kurek, A.; Basta-Kaim, A.; Kubera, M.; Lasoń, W.; Budziszewska, B. Elevated brain glucose and glycogen concentrations in an animal model of depression. Neuroendocrinology 2014, 100, 178–190. [Google Scholar] [CrossRef] [Scilit]
- Herbet, M.; Natorska-Chomicka, D.; Korga, A.; Ostrowska, M.; Izdebska, M.; Gawrońska-Grzywacz, M.; Piątkowska-Chmiel, I.; Pawłowski, K.; Ślaska, B.; Poleszak, E.; et al. Altered expression of genes involved in brain energy metabolism as adaptive responses in rats exposed to chronic variable stress; changes in cortical level of glucogenic and neuroactive amino acids. Mol. Med. Rep. 2019, 19, 2386–2396. [Google Scholar] [CrossRef] [Scilit]
- Bouwman, V.; Adriaanse, M.C.; van ‘t Riet, E.; Snoek, F.J.; Dekker, J.M.; Nijpels, G. Depression, anxiety and glucose metabolism in the general dutch population: The new Hoorn study. PLoS ONE 2010, 5, e9971. [Google Scholar] [CrossRef] [Scilit]
- Kahl, K.G.; Schweiger, U.; Correll, C.; Müller, C.; Busch, M.L.; Bauer, M.; Schwarz, P. Depression, anxiety disorders, and metabolic syndrome in a population at risk for type 2 diabetes mellitus. Brain Behav. 2015, 5, e00306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Detka, J.; Kurek, A.; Basta-Kaim, A.; Kubera, M.; Lasoń, W.; Budziszewska, B. Neuroendocrine link between stress, depression and diabetes. Pharmacol. Rep. 2013, 65, 1591–1600. [Google Scholar] [CrossRef] [Scilit]
- Wium-Andersen, I.K.; Osler, M.; Jørgensen, M.B.; Rungby, J.; Wium-Andersen, M.K. Diabetes, antidiabetic medications and risk of depression—A population-based cohort and nested case-control study. Psychoneuroendocrinology 2022, 140, 105715. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nouwen, A.; Winkley, K.; Twisk, J.; Lloyd, C.E.; Peyrot, M.; Ismail, K.; Pouwer, F.; European Depression in Diabetes (EDID) Research Consortium. Type 2 diabetes mellitus as a risk factor for the onset of depression: A systematic review and meta-analysis. Diabetologia 2010, 53, 2480–2486. [Google Scholar] [CrossRef] [Scilit]
- Colle, R.; de Larminat, D.; Rotenberg, S.; Hozer, F.; Hardy, P.; Verstuyft, C.; Fève, B.; Corruble, E. PPAR-γ Agonists for the Treatment of Major Depression: A Review. Pharmacopsychiatry 2017, 50, 49–55. [Google Scholar] [CrossRef] [Scilit]
- Biemans, E.; Hart, H.E.; Rutten, G.E.; Cuellar Renteria, V.G.; Kooijman-Buiting, A.M.; Beulens, J.W. Cobalamin status and its relation with depression, cognition and neuropathy in patients with type 2 diabetes mellitus using metformin. Acta Diabetol. 2015, 52, 383–393. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sheikh, S.A.; Ikram, H.; Haleem, D.J. Behavioral deficits in rats following acute administration of glimepiride: Relationship with brain serotonin and dopamine. Pak. J. Pharm. Sci. 2015, 28, 1181–1186. [Google Scholar]
- Yki-Järvinen, H. Thiazolidinediones. N. Engl. J. Med. 2004, 351, 1106–1118. [Google Scholar] [CrossRef] [Scilit]
- Pinto, M.; Nissanka, N.; Peralta, S.; Brambilla, R.; Diaz, F.; Moraes, C.T. Pioglitazone ameliorates the phenotype of a novel Parkinson’s disease mouse model by reducing neuroinflammation. Mol. Neurodegener. 2016, 11, 25. [Google Scholar] [CrossRef] [Scilit]
- Bonet-Costa, V.; Herranz-Pérez, V.; Blanco-Gandía, M.; Mas-Bargues, C.; Inglés, M.; Garcia-Tarraga, P.; Rodriguez-Arias, M.; Miñarro, J.; Borras, C.; Garcia-Verdugo, J.M.; et al. Clearing Amyloid-β through PPARγ/ApoE Activation by Genistein is a Treatment of Experimental Alzheimer’s Disease. J. Alzheimers Dis. 2016, 51, 701–711. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, J.; Wang, L.N. Peroxisome proliferator-activated receptor gamma agonists for preventing recurrent stroke and other vascular events in people with stroke or transient ischaemic attack. Cochrane Database Syst. Rev. 2019, 10, CD010693. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Colle, R.; de Larminat, D.; Rotenberg, S.; Hozer, F.; Hardy, P.; Verstuyft, C.; Fève, B.; Corruble, E. Pioglitazone could induce remission in major depression: A meta-analysis. Neuropsychiatr. Dis. Treat. 2016, 13, 9–16. [Google Scholar] [CrossRef] [Scilit]
- Patel, S.S.; Mehta, V.; Changotra, H.; Udayabanu, M. Depression mediates impaired glucose tolerance and cognitive dysfunction: A neuromodulatory role of rosiglitazone. Horm. Behav. 2016, 78, 200–210. [Google Scholar] [CrossRef] [Scilit]
- Picard, M.; Juster, R.P.; McEwen, B.S. Mitochondrial allostatic load puts the ‘gluc’ back in glucocorticoids. Nat. Rev. Endocrinol. 2014, 10, 303–310. [Google Scholar] [CrossRef] [Scilit]
- Peng, Y.; Liu, J.; Shi, L.; Tang, Y.; Gao, D.; Long, J.; Liu, J. Mitochondrial dysfunction precedes depression of AMPK/AKT signaling in insulin resistance induced by high glucose in primary cortical neurons. J. Neurochem. 2016, 137, 701–713. [Google Scholar] [CrossRef] [Scilit]
- Ghosal, S.; Duman, C.H.; Liu, R.J.; Wu, M.; Terwilliger, R.; Girgenti, M.J.; Wohleb, E.; Fogaca, M.V.; Teichman, E.M.; Hare, B.; et al. Ketamine rapidly reverses stress-induced impairments in GABAergic transmission in the prefrontal cortex in male rodents. Neurobiol. Dis. 2020, 134, 104669. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abelaira, H.M.; Réus, G.Z.; Neotti, M.V.; Quevedo, J. The role of mTOR in depression and antidepressant responses. Life Sci. 2014, 101, 10–14. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Hu, Z.; Du, X.; Davies, H.; Huo, X.; Fang, M. miR-16 and Fluoxetine Both Reverse Autophagic and Apoptotic Change in Chronic Unpredictable Mild Stress Model Rats. Front. Neurosci. 2017, 11, 428. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, X.; Wu, H.; Jiang, R.; Sun, G.; Shen, J.; Ma, M.; Ma, C.; Zhang, S.; Huang, Z.; Wu, Q.; et al. The antidepressant effects of ɑ-tocopherol are related to activation of autophagy via the AMPK/mTOR pathway. Eur. J. Pharmacol. 2018, 833, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Olson, L. Outgrowth of sympathetic adrenergic neurons in mice treated with a nerve-growth factor (NGF). Z. Zellforsch. Mikrosk. Anat. 1967, 81, 155–173. [Google Scholar] [CrossRef] [Scilit]
- Zhao, H.M.; Liu, X.F.; Mao, X.W.; Chen, C.F. Intranasal delivery of nerve growth factor to protect the central nervous system against acute cerebral infarction. Chin. Med. Sci. J. 2004, 19, 257–261. [Google Scholar]
- Kromer, L.F. Nerve growth factor treatment after brain injury prevents neuronal death. Science 1987, 235, 214–216. [Google Scholar] [CrossRef] [Scilit]
- Angelucci, F.; Aloe, L.; Jiménez-Vasquez, P.; Mathé, A.A. Electroconvulsive stimuli alter the regional concentrations of nerve growth factor, brain-derived neurotrophic factor, and glial cell line-derived neurotrophic factor in adult rat brain. J. ECT 2002, 18, 138–143. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Overstreet, D.H.; Fredericks, K.; Knapp, D.; Breese, G.; McMichael, J. Nerve growth factor (NGF) has novel antidepressant-like properties in rats. Pharmacol. Biochem. Behav. 2010, 94, 553–560. [Google Scholar] [CrossRef] [Scilit]
- Charan, J.; Kantharia, N.D. How to calculate sample size in animal studies? J. Pharmacol. Pharmacother. 2013, 4, 303–306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, Y.; Ma, R.; Shen, J.; Su, H.; Xing, D.; Du, L. A mouse model of depression induced by repeated corticosterone injections. Eur. J. Pharmacol. 2008, 581, 113–120. [Google Scholar] [CrossRef] [Scilit]
- Pickavance, L.C.; Tadayyon, M.; Widdowson, P.S.; Buckingham, R.E.; Wilding, J.P. Therapeutic index for rosiglitazone in dietary obese rats: Separation of efficacy and haemodilution. Br. J. Pharmacol. 1999, 128, 1570–1576. [Google Scholar] [CrossRef] [Scilit]
- Asp, M.L.; Tian, M.; Kliewer, K.L.; Belury, M.A. Rosiglitazone delayed weight loss and anorexia while attenuating adipose depletion in mice with cancer cachexia. Cancer Biol. Ther. 2011, 12, 957–965. [Google Scholar] [CrossRef] [Scilit]
- Kulkarni, N.M.; Malampati, S.; Mahat, M.Y.; Chandrasekaran, S.; Raghul, J.; Khan, A.A.; Krishnan, U.M.; Narayanan, S. Altered pharmacokinetics of rosiglitazone in a mouse model of non-alcoholic fatty liver disease. Drug Metab. Pers. Ther. 2016, 31, 165–171. [Google Scholar] [CrossRef] [Scilit]
- Yankelevitch-Yahav, R.; Franko, M.; Huly, A.; Doron, R. The forced swim test as a model of depressive-like behavior. J. Vis. Exp. 2015, 97, 52587. [Google Scholar] [CrossRef] [Scilit]
- Cryan, J.F.; Holmes, A. The ascent of mouse: Advances in modelling human depression and anxiety. Nat. Rev. Drug Discov. 2005, 4, 775–790. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Can, A.; Dao, D.T.; Arad, M.; Terrillion, C.E.; Piantadosi, S.C.; Gould, T.D. The mouse forced swim test. J. Vis. Exp. 2012, 59, e3638. [Google Scholar] [CrossRef] [Scilit]
- Steru, L.; Chermat, R.; Thierry, B.; Simon, P. The tail suspension test: A new method for screening antidepressants in mice. Psychopharmacology 1985, 85, 367–370. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Kennedy, S.H.; Evans, K.R.; Krüger, S.; Mayberg, H.S.; Meyer, J.H.; McCann, S.; Arifuzzman, A.I.; Houle, S.; Vaccarino, F.J. Changes in regional brain glucose metabolism measured with positron emission tomography after paroxetine treatment of major depression. Am. J. Psychiatry 2001, 158, 899–905. [Google Scholar] [CrossRef]
- Chen, Y.W.; Lin, P.Y.; Tu, K.Y.; Cheng, Y.S.; Wu, C.K.; Tseng, P.T. Significantly lower nerve growth factor levels in patients with major depressive disorder than in healthy subjects: A meta-analysis and systematic review. Neuropsychiatr. Dis. Treat. 2015, 11, 925–933. [Google Scholar] [CrossRef] [Scilit]
- Foong, A.L.; Grindrod, K.A.; Patel, T.; Kellar, J. Demystifying serotonin syndrome (or serotonin toxicity). Can. Fam. Physician 2018, 64, 720–727. [Google Scholar] [PubMed]
- Detka, J.; Kurek, A.; Kucharczyk, M.; Głombik, K.; Basta-Kaim, A.; Kubera, M.; Lasoń, W.; Budziszewska, B. Brain glucose metabolism in an animal model of depression. Neuroscience 2015, 295, 198–208. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chipkin, S.R.; van Bueren, A.; Bercel, E.; Garrison, C.R.; McCall, A.L. Effects of dexamethasone in vivo and in vitro on hexose transport in brain microvasculature. Neurochem. Res. 1998, 23, 645–652. [Google Scholar] [CrossRef] [Scilit]
- Kanemaru, K.; Diksic, M. The Flinders Sensitive Line of rats, a rat model of depression, has elevated brain glucose utilization when compared to normal rats and the Flinders Resistant Line of rats. Neurochem. Int. 2009, 55, 655–661. [Google Scholar] [CrossRef] [Scilit]
- Ronnett, G.V.; Ramamurthy, S.; Kleman, A.M.; Landree, L.E.; Aja, S. AMPK in the brain: Its roles in energy balance and neuroprotection. J. Neurochem. 2009, 109, 17–23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yuan, J.; Dong, X.; Yap, J.; Hu, J. The MAPK and AMPK signalings: Interplay and implication in targeted cancer therapy. J. Hematol. Oncol. 2020, 13, 113. [Google Scholar] [CrossRef] [Scilit]
- Horman, S.; Browne, G.; Krause, U.; Patel, J.; Vertommen, D.; Bertrand, L.; Lavoinne, A.; Hue, L.; Proud, C.; Rider, M. Activation of AMP-activated protein kinase leads to the phosphorylation of elongation factor 2 and an inhibition of protein synthesis. Curr. Biol. 2002, 12, 1419–1423. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Inoki, K.; Zhu, T.; Guan, K.L. TSC2 mediates cellular energy response to control cell growth and survival. Cell 2003, 115, 577–590. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jones, R.G.; Plas, D.R.; Kubek, S.; Buzzai, M.; Mu, J.; Xu, Y.; Birnbaum, M.J.; Thompson, C.B. AMP-activated protein kinase induces a p53-dependent metabolic checkpoint. Mol. Cell 2005, 18, 283–293. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gwinn, D.M.; Shackelford, D.B.; Egan, D.F.; Mihaylova, M.M.; Mery, A.; Vasquez, D.S.; Turk, B.E.; Shaw, R.J. AMPK phosphorylation of raptor mediates a metabolic checkpoint. Mol. Cell 2008, 30, 214–226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Menzies, F.M.; Fleming, A.; Rubinsztein, D.C. Compromised autophagy and neurodegenerative diseases. Nat. Rev. Neurosci. 2015, 16, 345–357. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Z.; Wang, F.; Zhou, Z.W.; Xia, H.C.; Wang, X.Y.; Yang, Y.X.; He, Z.X.; Sun, T.; Zhou, S.F. Alisertib induces G2/M arrest, apoptosis, and autophagy via PI3K/Akt/mTOR- and p38 MAPK-mediated pathways in human glioblastoma cells. Am. J. Transl. Res. 2017, 9, 845–873. [Google Scholar]
- Jung, C.H.; Ro, S.H.; Cao, J.; Otto, N.M.; Kim, D.H. mTOR regulation of autophagy. FEBS Lett. 2010, 584, 1287–1295. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ahsan, A.; Liu, M.; Zheng, Y.; Yan, W.; Pan, L.; Li, Y.; Ma, S.; Zhang, X.; Cao, M.; Wu, Z.; et al. Natural compounds modulate the autophagy with potential implication of stroke. Acta Pharm. Sin. B 2021, 11, 1708–1720. [Google Scholar] [CrossRef] [Scilit]
- Fujita, N.; Itoh, T.; Omori, H.; Fukuda, M.; Noda, T.; Yoshimori, T. The Atg16L complex specifies the site of LC3 lipidation for membrane biogenesis in autophagy. Mol. Biol. Cell 2008, 19, 2092–2100. [Google Scholar] [CrossRef] [Scilit]
- Shi, Q.; Cheng, Q.; Chen, C. The Role of Autophagy in the Pathogenesis of Ischemic Stroke. Curr. Neuropharmacol. 2021, 19, 629–640. [Google Scholar] [CrossRef] [Scilit]
- Yi, L.T.; Wang, S.S.; Cheng, J.; Chen, M.; Zhu, J.X.; Li, C.F.; Dong, S.Q.; Liu, Q. Sustained AMP-activated protein kinase activation attenuates the activity of brain-derived neurotrophic factor/tyrosine kinase receptor B signaling in mice exposed to chronic stress. Chin. Med. J. 2021, 134, 1874–1876. [Google Scholar] [CrossRef] [Scilit]
- Leibrock, C.; Ackermann, T.F.; Hierlmeier, M.; Lang, F.; Borgwardt, S.; Lang, U.E. Akt2 deficiency is associated with anxiety and depressive behavior in mice. Cell. Physiol. Biochem. 2013, 32, 766–777. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Steelman, L.S.; Abrams, S.L.; Whelan, J.; Bertrand, F.E.; Ludwig, D.E.; Bäsecke, J.; Libra, M.; Stivala, F.; Milella, M.; Tafuri, A.; et al. Contributions of the Raf/MEK/ERK, PI3K/PTEN/Akt/mTOR and Jak/STAT pathways to leukemia. Leukemia 2008, 22, 686–707. [Google Scholar] [CrossRef] [Scilit]
- Chan, A.Y.; Soltys, C.L.; Young, M.E.; Proud, C.G.; Dyck, J.R. Activation of AMP-activated protein kinase inhibits protein synthesis associated with hypertrophy in the cardiac myocyte. J. Biol. Chem. 2004, 279, 32771–32779. [Google Scholar] [CrossRef] [Scilit]
- He, Y.; She, H.; Zhang, T.; Xu, H.; Cheng, L.; Yepes, M.; Zhao, Y.; Mao, Z. p38 MAPK inhibits autophagy and promotes microglial inflammatory responses by phosphorylating ULK1. J. Cell Biol. 2018, 217, 315–328. [Google Scholar] [CrossRef] [Scilit]
- Li, R.; Li, D.; Wu, C.; Ye, L.; Wu, Y.; Yuan, Y.; Yang, S.; Xie, L.; Mao, Y.; Jiang, T.; et al. Nerve growth factor activates autophagy in Schwann cells to enhance myelin debris clearance and to expedite nerve regeneration. Theranostics 2020, 10, 1649–1677. [Google Scholar] [CrossRef] [Scilit]
- Zhao, Z.; Zhang, L.; Guo, X.D.; Cao, L.L.; Xue, T.F.; Zhao, X.J.; Yang, D.D.; Yang, J.; Ji, J.; Huang, J.Y.; et al. Rosiglitazone Exerts an Anti-depressive Effect in Unpredictable Chronic Mild-Stress-Induced Depressive Mice by Maintaining Essential Neuron Autophagy and Inhibiting Excessive Astrocytic Apoptosis. Front. Mol. Neurosci. 2017, 10, 293. [Google Scholar] [CrossRef] [Scilit]
- Bagherniya, M.; Butler, A.E.; Barreto, G.E.; Sahebkar, A. The effect of fasting or calorie restriction on autophagy induction: A review of the literature. Ageing Res. Rev. 2018, 47, 183–197. [Google Scholar] [CrossRef] [Scilit]
- Leão, L.L.; Tangen, G.; Barca, M.L.; Engedal, K.; Santos, S.H.S.; Machado, F.S.M.; de Paula, A.M.B.; Monteiro-Junior, R.S. Does hyperglycemia downregulate glucose transporters in the brain? Med. Hypotheses 2020, 139, 109614. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hou, W.K.; Xian, Y.X.; Zhang, L.; Lai, H.; Hou, X.G.; Xu, Y.X.; Yu, T.; Xu, F.Y.; Song, J.; Fu, C.L.; et al. Influence of blood glucose on the expression of glucose trans-porter proteins 1 and 3 in the brain of diabetic rats. Chin. Med. J. 2007, 120, 1704–1709. [Google Scholar] [CrossRef] [Scilit]
- Shao, Z.Q.; Liu, Z.J. Neuroinflammation and neuronal autophagic death were suppressed via Rosiglitazone treatment: New evidence on neuroprotection in a rat model of global cerebral ischemia. J. Neurol. Sci. 2015, 349, 65–71. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Inoki, K.; Ouyang, H.; Li, Y.; Guan, K.L. Signaling by target of rapamycin proteins in cell growth control. Microbiol. Mol. Biol. Rev. 2005, 69, 79–100. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Gene ID | Primers Sequence (5′→3′) | Annealing Temperature | |
|---|---|---|---|
| Forward | Reverse | ||
| GLUT1 | CCAGCTGGGAATCGTCGTT | CAAGTCTGCATTGCCCATGAT | 62 °C |
| GLUT3 | CTCTTCAGGTCACCCAACTACGT | CCGCGTCCTTGAAGATTCC | 55 °C |
| β-actin | ACGGCCAGGTCATCACTATTG | CAAGAAGGAAGGCTGGAAAAGA | 56 °C |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alhaddad, A.; Radwan, A.; Mohamed, N.A.; Mehanna, E.T.; Mostafa, Y.M.; El-Sayed, N.M.; Fattah, S.A. Rosiglitazone Mitigates Dexamethasone-Induced Depression in Mice via Modulating Brain Glucose Metabolism and AMPK/mTOR Signaling Pathway. Biomedicines 2023, 11, 860. https://doi.org/10.3390/biomedicines11030860
Alhaddad A, Radwan A, Mohamed NA, Mehanna ET, Mostafa YM, El-Sayed NM, Fattah SA. Rosiglitazone Mitigates Dexamethasone-Induced Depression in Mice via Modulating Brain Glucose Metabolism and AMPK/mTOR Signaling Pathway. Biomedicines. 2023; 11(3):860. https://doi.org/10.3390/biomedicines11030860
Chicago/Turabian StyleAlhaddad, Aisha, Asmaa Radwan, Noha A. Mohamed, Eman T. Mehanna, Yasser M. Mostafa, Norhan M. El-Sayed, and Shaimaa A. Fattah. 2023. "Rosiglitazone Mitigates Dexamethasone-Induced Depression in Mice via Modulating Brain Glucose Metabolism and AMPK/mTOR Signaling Pathway" Biomedicines 11, no. 3: 860. https://doi.org/10.3390/biomedicines11030860
APA StyleAlhaddad, A., Radwan, A., Mohamed, N. A., Mehanna, E. T., Mostafa, Y. M., El-Sayed, N. M., & Fattah, S. A. (2023). Rosiglitazone Mitigates Dexamethasone-Induced Depression in Mice via Modulating Brain Glucose Metabolism and AMPK/mTOR Signaling Pathway. Biomedicines, 11(3), 860. https://doi.org/10.3390/biomedicines11030860

