Next Article in Journal
A Study on the Impact of Population Aging on the Agricultural Socialized Services
Previous Article in Journal
Can the Return of Rural Labor Effectively Stimulate the Demand for Land? Empirical Evidence from Sichuan Province, China
Previous Article in Special Issue
Stability of Early Maturing Soybean Genotypes in Poland
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effect of Low Nighttime Temperature on Oil Accumulation of Rapeseed Seeds (Brassica napus L.) Based on RNA-Seq of Silique Wall Tissue

by
Chao Mi
1,2,
Yanning Zhao
3,
Xuetao Yang
4,
Liangbin Lin
2 and
Jinxiong Wang
1,*
1
Agricultural Research Institute, Xizang Academy of Agriculture and Animal Husbandry Sciences, Lhasa 850032, China
2
College of Agronomy and Biotechnology, Yunnan Agricultural University, Kunming 650201, China
3
Vegetable Research Institute, Xizang Academy of Agriculture and Animal Husbandry Sciences, Lhasa 850032, China
4
Xizang Academy of Agriculture and Animal Husbandry Sciences, Lhasa 850032, China
*
Author to whom correspondence should be addressed.
Agriculture 2025, 15(6), 576; https://doi.org/10.3390/agriculture15060576
Submission received: 20 January 2025 / Revised: 3 March 2025 / Accepted: 5 March 2025 / Published: 9 March 2025
(This article belongs to the Special Issue Crop Yield Improvement in Genetic and Biology Breeding)

Abstract

:
This study investigated the impact of nighttime temperature and elevation on the oil and erucic acid content of rapeseed (Brassica napus L.) seeds, focusing on the role of sugar synthesis in the silique wall as a substrate for oil synthesis. Field experiments across different altitudes and controlled low nighttime temperature (LNT) treatments (20/18 °C and 20/13 °C) were conducted. Transcriptome analysis of the silique walls was performed to explore gene expression changes. The results showed that higher altitudes and lower nighttime temperatures significantly increased seed oil and erucic acid content, particularly in strong temperature-sensitive line (STSL) seeds. LNT conditions promoted sucrose synthesis and transport in the silique wall by upregulating genes involved in sugar transport (SUT, SWEET, SUC1) and transcription factors (WRKY51, NAC104). This, in turn, enhanced the substrate availability for oil synthesis in the seeds. Furthermore, genes associated with oil biosynthesis (SAD, FAD2, KAS) were significantly upregulated under LNT, promoting oil accumulation. In conclusion, nighttime temperature is a critical factor influencing oil content in rapeseed seeds. Low nighttime temperatures enhance sucrose transport and gene expression in the silique wall, leading to increased oil synthesis. These findings provide insights for breeding strategies aimed at improving seed oil content under varying climatic conditions.

1. Introduction

Rapeseed is the most extensively cultivated oil crop and a significant source of edible oil in China. China’s principal rapeseed planting regions are divided into winter and spring rapeseed planting areas, with the Yangtze River winter rapeseed planting area representing the largest region [1]. Cong et al. [2] conducted an analysis of the relationship between winter rapeseed yield and meteorological data in the Yangtze River basin based on meteorological data from multiple weather stations from 1962 to 2015. Their findings indicated that the average winter temperature for rapeseed grown in the region is 16–17 °C, with a diurnal temperature difference of 7–8 °C. This study demonstrated that the 29/20 °C (high nighttime temperature) treatment resulted in a 30% reduction in rapeseed oil content compared to the 20/18 °C (normal nighttime temperature) temperature design. Conversely, the 20/16 °C (low nighttime temperature) treatment resulted in a 7.70% increase in oil content compared to the normal treatment [3]. Yunnan Province is a winter rapeseed planting area situated on the Yunnan-Guizhou Plateau, encompassing the Yangtze River, Nujiang River, and Yuanjiang River water systems. The region exhibits a tropical and subtropical monsoon climate, with a gradual decrease in elevation across terraced topography. Mountainous terrain occupies approximately 90% of the total area, and the region is characterized by complex and variable environmental and climatic factors [4]. During the winter rapeseed growing period, the average daytime temperature in the area from the bolting stage to maturity was 18–25 °C, the average nighttime temperature was 13–19 °C, and the diurnal temperature difference was 5–12 °C. Some regions with pronounced altitudinal gradients exhibit more pronounced diurnal temperature fluctuations, which creates optimal conditions for the cultivation of rapeseed with elevated oil content. Some regions with pronounced altitudinal gradients exhibit more pronounced diurnal temperature fluctuations, which creates optimal conditions for the cultivation of rapeseed with elevated oil content. The agronomic characteristics of B. rape declined with increasing altitude, whereas the pod characteristics improved. Concurrently, seed oil content increases and oleic and linoleic acids accumulate at elevated altitudes [5,6]. The change in oil content caused by meteorological and environmental factors related to altitude during the cultivation of rapeseed is evident. The correlation analysis results demonstrated that altitude has a significant impact on oil content, agronomic traits deteriorate, and oil content is typically of high quality. However, erucic acid and glucosinolates are often of poor quality [7,8,9]. Li [3] quantified the seed oil content of rapeseed under three temperature treatments: 29/20 °C (high daytime/nighttime temperature), 20/18 °C (normal temperature), and 20/16 °C (low daytime/nighttime temperature). The seed oil content increased in the 20/16 °C treatment; yet, the impact of nighttime temperature on rapeseed oil content remains unclear. Yang et al. [10] cultivated DH0729, and the environmental factors that undergo alteration at varying altitudes in a single location are primarily changes in nighttime temperature, as the shifts in daytime and nighttime temperatures are minimal. The effect of altitude on the oil content of rapeseed seeds is primarily attributable to alterations in nighttime temperature, which tends to a decline in oil content with increasing altitude. Based on Yang’s results, this also indicates that DH0815 is a strongly temperature-sensitive line, whereas DH0729 is a weakly temperature-insensitive line [11].
It is imperative that the production status of rapeseed in China is promptly enhanced through the elevation of its seed oil content, thereby satisfying the requirements of domestic and international markets. Breeding rapeseed with high oil content has become a primary objective of rapeseed breeding and cultivation. Nevertheless, research on the biochemical synthesis and regulation of oil accumulation in rapeseed seeds is still in its infancy. The accumulation of oil in rapeseed is subject to regulation by both genetic and environmental factors, with the environmental factor exerting the most significant influence, namely, temperature [12]. However, research on temperature has primarily concentrated on elevated nighttime temperatures, with minimal attention devoted to the impact of low nighttime temperatures on the oil content and fatty acid composition [13,14]. The variation in seed oil content plasticity has been associated with three environmental factors: precipitation, diurnal temperature range, and ultraviolet B during the flowering or pod-filling stag [11].
Globally, Brassica napus L. (B. napus L.) is a primary oilseed crop. It is essential to understand the dynamic changes in the material flux of seeds to enhance the seed oil content and yield. The metabolites involved in oil accumulation have been analyzed in developing seeds, and more than a dozen differentially expressed metabolites related to oil accumulation have been identified. The photosynthate products in oil-producing pods are of great consequence to oil accumulation. The metabolic profile of the seed tissues have demonstrated that elevated metabolite concentrations prompted activation of gene sets associated with fatty acid (FA) synthesis and sugar metabolism in transformed seed tissues [15]. Photosynthesis and transport-related genes are more actively transcribed in the silique wall, while genes involved in lipid metabolism are more active during the seed filling stage; genes involved in secondary metabolism are selectively regulated in the silique wall and seeds [16]. Oil content correlated closely with BnRBCS1A expression levels and Rubisco activities in the silique wall, but not in the leaf [17]. Through transcriptome sequencing and sucrose content detection, sugar transport in seed coat may regulate lipid synthesis efficiency by controlling sugar concentration in the ovule [18]. There are multiple damaging effects of hot weather on seed formation and development. The oil content of the seeds is reduced by 52% and the protein content is increased. Heat treatment has a more detrimental effect on the composition of seed oil than drying, leading to an increase in the content of saturated fat oil, which improves desaturation efficiency [19]. High temperature stress causes yield loss and grain composition changes during grain filling of rapeseed. However, the mechanism of this thermal reaction is not well understood. The upregulated genes include many HSF/HSP transcripts and other heat-related marker genes, such as ROF2, DREB2a, MBF1c, and Hsa32, reflecting the conservation of key heat-resistant factors in plants. Other upregulated genes are preferentially expressed in heat-stressed silique walls or seeds, including some transcription factors and potential developmental regulators. The downregulated genes differ between the silique wall and seeds and are largely related to the biological functions of each tissue, such as glucosinolate metabolism in the silique wall and flavonoid synthesis in the seeds [20]. Moderately high temperature results in enhanced metabolic flux, which ultimately led to an increase in seed oil content. These findings offer insights into potential physiological and agronomic strategies for enhancing the seed oil content and quality. In actual production, appropriate planting density, improved light conditions within the seed-bearing layer, and improved water conditions can maximize photosynthesis in the silique wall, prolong the high photosynthesis period of the silique wall, slow the period of photosynthetic decline, regulate the photosynthetic function of the silique wall, increase the accumulation and transportation of assimilates, and promote yield and oil content improvement [21]. The accumulation and transportation of assimilates from the silique wall tissue are regulated by temperature. A reduction in nocturnal temperature results in a decrease in respiration, reduction in assimilate consumption, and increase the in oil accumulation. As more assimilates are transported to the seeds, their transport capacity is enhanced, resulting in higher quality synthesis. Genotype, temperature, and the interaction between genotype and temperature were the regulatory factors that constituted the changes in oil content and fatty acid content in Brassica napus L. seeds, as determined by RNA-seq and QTL mapping analyses [22,23]. Under long-term high-temperature treatment (34/18 °C), embryonic development is accelerated and defective, and glucosinolates and oil content are reduced in seed [24,25,26]. Water and temperature have been assessed using year-to-year changes at 12 sites of dryland rapeseed production. N and S have different effects. Unsaturated fatty acids, oleic acids, grain oils, proteins, and theoretical maximum grain yields are highly correlated with changes in water and temperature between site years. A nonlinear model determined the water and temperature conditions that enable the production of maximum unsaturated fatty acid content, oleic acid content, total oil, protein, and maximum theoretical yield of the seeds [27].
Accordingly, the effect of nocturnal temperature on the oil and fatty acid (FA) content of rapeseed seeds was examined. The respiration of the silique wall was found to significantly decrease with decreasing nighttime temperature, resulting in a reduction in nighttime respiration and the accumulation of more sugars, which are substrates for oil synthesis in the seeds. It is currently unclear whether substrate accumulation facilitates substrate transport from the silique wall to the seeds. Consequently, investigating the accumulation and transport of assimilates in silique walls at low nighttime temperatures is crucial to address the issue of oil accumulation in seeds. Appropriately increasing the diurnal temperature difference during the growth period of rapeseed (especially formation period of the seeds) was not only conducive to increasing the oil content of the seeds, but also to promoting the quality of the seeds (the unsaturated fat contents were increasing). However, beyond a certain range, e.g., if the nighttime temperature is too low or the daytime temperature is too hot, the rapeseed will suffer from cold damage or heat stress, respectively, which makes the seed oil content reduced and the quality inferior [12,13,22,25,27]. To this end, a precision daylight temperature controlled greenhouse was constructed, wherein different nighttime temperatures (18, 16, 13, and 10 °C) were maintained under a daytime temperature of 20 °C. The effects of nighttime temperature on the oil and FA content of the seeds were then analyzed [11,13,22]. Based on this, two diurnal temperature difference treatments, 20/18 °C and 20/13 °C, were established, and transcriptome sequencing of the silique wall and seeds was conducted to analyze the differentially expressed genes (DEGs) related to sucrose synthesis and transport, respiration, and oilseed synthesis in the silique wall and seeds. The objective was to analyze the expression levels of oil synthesis-related genes in the seeds to elucidate the molecular mechanisms by which low nighttime temperatures affect the oil content of rapeseed seeds.

2. Materials and Methods

2.1. Materials Collection of Plant Material for Different Altitudes and Low Nighttime Temperature Treatments

Two varieties of rapeseed (B. napus L.) from Yunnan Agricultural University were used in this study: a strongly temperature-sensitive line (DH0815, STSL) and a weakly temperature-sensitive line (DH0729, WTSL). During 5th–10th September 2019, the different altitude treatments were planted in the of Yunnan Agricultural University test base (1890 m a.s.l.) and Tuanjie Town of Yunnan Academy of Agricultural Sciences (2180 m a.s.l.) test base. The distance between the two test sites was 53km, and three biological replicates were planted at each site. The planting area was a plot 4 × 6 m2 for each line (STSL and WTSL). Local field soil was used as the main source to add an appropriate amount of farm fertilizer, and fertilizer was applied according to 25 kg/667 m2 diammonium phosphate (My life, Kunming, China) and 40 kg/667 m2 urea (Lanhua, Jincheng, China). The soil physicochemical properties (Texture, Structure, pH, CEC, Organic matter, etc.) before rapeseed planting were tested, as shown in Table S1. Artificial ditch planting was adopted, row spacing was 30 cm, seedlings were thinned after emergence, plant spacing was 10 cm, and the number of plants in each planting area was 820–850. Phoxim was adopted to control underground pests during the planting period. During the bolting period, 10% imidacloprid (Macklin, Shanghai, China) and 500× avermectin (Kemik, Wuhan, China) were used to control aphids and powdery mildew. Mixed fertilizer was applied to the soil regularly, and borax fertilizer was applied regularly during the bolting period. At the early florescence stage, flower blooming was marked using red wool at 10th–30th days, these seeds marked silique walls to be harvested at the maturity stage. The FA and oil content of these seeds were detected by GC-MS. Major climate and environmental factors of rapeseed during the development period were also collected (Table 1).
Based on the different altitude treatments results, the low nighttime temperature treatments were set up. During 2020–2021, WTSL and STSL were firstly planted in a field pot experiment at the Yunnan Agricultural University site, then transferred to a greenhouse with automatic temperature and sunlight control (Kunming Institute of Botany, Chinese Academy of Sciences, Kunming, China) during the bolting period. These DH lines were subjected to different temperatures between daytime and nighttime temperatures, and the treatment groups were as follows: 20/18 (±0.5 °C, daytime/nighttime temperature), 20/16, 20/13, and 20/10 °C; day 14 h, night 10 h. At the early florescence stage, flower blooming was marked using red wool on different days. We harvested the seeds and episperms of WTSL and STSL at different blooming times, including 27 days after flowering (DAF), 35 DAF, and 43 DAF. The FA and oil contents of the seeds were determined using GC-MS in 27, 35, and 43 DAF and mature seeds. Meanwhile, we collected silique wall tissue from STSL and WTSL under high nighttime temperature (20/18 °C, CK) and low nighttime temperature (20/13 °C, LNT) at 27, 35, and 43 DAF for RNA-seq. Similarly, SSS18, SFS18, STS18, SSS13, SFS13, and STS13 represent 27, 35, and 43 DAF from of WTSL’s silique wall under the CK and LNT treatments; OSS18, OFS18, OTS18, OSS13, OFS13, and OTS13 represent 27, 35, and 43 DAF for of STSL’s silique wall under the CK and LNT treatments; SSE18, SFE18, STE18, SSE13, SFE13, and STE13 represent 27, 35, and 43 DAF for of WTSL’s seeds under the CK and LNT treatments; and OSE18, OFE18, OTE18, OSE13, OFE13, and OTE13 represent 27, 35, and 43 DAF for of STSL’s seeds under the CK and LNT treatments. All samples for RNA-seq were collected, frozen in liquid nitrogen, and stored at −80 °C until further analysis.

2.2. Analysis of the Oil Content and Fatty Acid Content in the Two Rapeseed Cultivars

Oil and FA contents were determined according to the method described by Mi et al. [12,21].

2.3. RNA Extraction, Illumina Sequencing, and Data Analysis

Approximately 0.3 g of silique wall for each sample was extracted with a TRIzol reagent kit (Invitrogen, Carlsbad, CA, USA) to obtain total RNA. The quality of the RNA was evaluated using an Agilent 2100 Bioanalyzer (Agilent Technologies Inc., Santa Clara, CA, USA) and was then enriched with oligo (dT) beads in accordance with the manufacturer’s instructions. The cDNA library (total cDNA ≥ 0.1 μg) was prepared using the NEBNext Ultra RNA Library Prep Kit for Illumina (NEB #7530, New England Biolabs, Ipswich, MA, USA), and the resulting library was sequenced on the Illumina Novaseq6000 platform at Gene Denovo Biotechnology Co., Ltd. (Gene Denovo, Shenzhen, China) to obtain 100 bp paired-end sequencing reads. To obtain high-quality clean reads, the reads were filtered using Fastp v. 0.19.3 software. Sequencing reads were filtered to remove unknown nucleotides (N) and low-quality reads. An index of the B. napus genome (NCBI_GCF_000686985.2) was constructed, and paired-end clean reads were aligned to the reference genome using HISAT-3N (rapid and accurate alignment of nucleotide conversion sequencing reads with HISAT-3N) to obtain location data for the latter or the genes, as well as unique sample sequence feature information, to obtain the mapped data. Based on the B. napus genome, the mapped reads of each sample were assembled using StringTie v1.3.4, and gene expression levels were quantified and compared using featureCounts v.1.6.2 in R. FPKM values were calculated to quantify expression abundance and variations using RSEM software (1.3.3+dfsg-2), which provides accurate transcript quantification from RNA-seq data with or without a reference genome. The differential expression between the two groups was determined using DESeq2 software (R4.1.2). Genes with false discovery rate (FDR) of less than or equal to 0.01 and a log2 fold change of greater than or equal to 2 were considered DEGs. Functional annotation of the DEGs was performed using the Kyoto Encyclopedia of Genes and Genomes (KEGG), Gene Ontology (GO), and Cluster of Orthologous Groups for Eukaryotic Complete Genomes (KOG) databases using BLAST 2.2.28+ software.

2.4. qRT-PCR Assays

To ascertain the reliability of the DEGs between the silique wall tissue and seeds, the samples were subjected to qRT-PCR, which was conducted in a 96-well plate on a CFX96 Touch Real-Time PCR system (Bio-Rad, Hercules, CA, USA). BnActin7 was used as the internal standard for quantitative reverse transcription-polymerase chain reaction (qRT-PCR). The thermal conditions were as follows: 95 °C for 10 s, followed by 40 cycles of 95 °C for 10 s, 60 °C for 30 s, and 72 °C for 15 s. Gene-specific primers were designed based on the results of multiple sequence alignments (Table 2) using the NCBI Primer-BLAST tool. The relative expression levels of selected DEGs were calculated using the 2−∆∆CT method.

2.5. Statistical Analysis

Microsoft Office 2019 (Microsoft, Washington, DC, USA) and GraphPad Prism 8.0 (GraphPad Software Inc., San Diego, CA, USA) were used for statistical analyses and visualization of the FA composition of the seeds. The OmicShare tool was employed to generate a heatmap and principal component analysis (PCA) outputs.

3. Results

3.1. The Effect of Different Altitudes on Oil and FA Contents

To further verify the sensitivity of the seed oil content of WTAL and STSL to altitude, the seeds were planted at the experimental bases of Yunnan Agricultural University and the Yunnan Academy of Agricultural Sciences in Kunming, Yunnan, at different altitudes. The results demonstrated that the seed oil and FA contents underwent alterations, whereas meteorological factors, with exception of temperature and evaporation, exhibited minimal fluctuations (Table 1).
Table 3 illustrates the alterations in the oil and FA content of the two rapeseed lines at varying altitudes. As altitude increased, the oil content of both WTSL and STSL seeds increased (Table 3). However, the oil content of STSL seeds exhibited a significant (p ≤ 0.05) increase of over 4%, whereas the change in WTSL was not significant, with coefficients of variation (CVs) of 6.81 and 1.12, respectively. As altitude increased, the erucic acid and linolenic acid content of STSL seeds significantly increased, with coefficients of variation (CVs) of 51.31 and 25.88, respectively. In contrast, the change in WTSL was not significant, with CVs of 2.69 and 2.27. However, the CV of other unsaturated FAs was not significant. The changes in oil content at altitudes of 1890 and 2180 m were primarily attributable to temperature fluctuations, with minimal variation in daytime temperatures at both elevations. Consequently, the primary driver of the observed shift in seed oil content was the discrepancy in nighttime temperatures.

3.2. The Effects of Nighttime Temperature on Oil Content and Fatty Acid Contents of Seeds

The oil and fatty acid contents of DH0729 and DH0815 seeds were found to be influenced by nighttime temperatures (Table 4). As nighttime temperatures decreased, the oil and fatty acid contents of WTSL (Figure 1A) and STSL (Figure 1B) exhibited disparate responses to nighttime temperature.
The variation in the content of eight fatty acids (with exception of linoleic acid) in WTSL was less pronounced than that observed in STSL. The contents of C22:0 and C20:1 (arachidonic acid) in WTSL exhibited a notable change (the CVs were 11.78 and 9.35%, respectively) (Figure 1), whereas the variation in C18:1 content was the least pronounced (CV = 1.35). In STSL, the content of saturated fatty acids (palmitic acid, stearic acid, and arachidonic acid) did not significantly increase, whereas the content of unsaturated fatty acids and oleic acid decreased with a decrease in nighttime temperature. Conversely, the contents of linoleic acid, linolenic acid, and erucic acid showed the opposite trend, with erucic acid demonstrating the most significant change, with a CV of 27.12. The levels of five fatty acids (palmitic acid, oleic acid, linoleic acid, linolenic acid, and erucic acid) in rapeseed oil and erucic acid in STSL seeds increased from 8.02% to 15.21%, whereas those in WTSL seeds increased by 2% and 0.5%, respectively. A reduction in nighttime temperature was observed to result in an increase in oil content for both WTSL and STSL (Table 4). The oil content of STSL seeds treated at 13 °C and 10 °C was significantly higher than that of all other treatments. Conversely, the oil content of WTSL seeds treated at 10 °C was significantly higher than that of seeds treated at 18, 16, and 13 °C. Additionally, the CV of the oil content of STSL was significantly higher than that of WTSL, with CVs of 4.08 and 8.90, respectively.

3.3. Quality Analysis of the Transcriptome of Silique Wall Tissue Under Low Nighttime Temperature

Twelve cDNA libraries were constructed from silique walls of STSL and WTSL treated with different nighttime temperatures, and transcriptomic data were obtained 27, 35, and 43 days after flowering. cDNA libraries were sequenced using an Illumina platform. After filtering out low-quality reads containing N-, low-, and adapter-related reads, the two materials were treated with different temperature differences between day and night to obtain 42,206,442–55,668,636 (STSL, LNT) and 45,705,934–63,914,108 (STSL, CK) total clean reads. Clean reads were then compared to the reference genome of B. napus using the Hisat software (v2.2.1). The resulting datasets were as follows: 44,563,402–60,032,102 (WTSL, LNT) and 45,562,878–57,613,840 (WTSL, CK) mapped reads. The total number of mapped reads in each sample exceeded 90%. The proportion of unique mapped reads was greater than 73%, whereas the proportion of multiple mapped reads was between 16 and 18%. The quality of transcriptome sequencing was high, as indicated by the Q20 and Q30 values, which exceeded 97% and 92%, respectively. Additionally, the GC value was greater than 46%, further confirming the high quality of sequencing data. Consequently, transcriptome sequencing of the silique wall tissue was deemed suitable for subsequent data analysis.
FPKM was employed to quantify the expression patterns of all genes in the silique wall transcripts of STSL and WTSL samples subjected to low nighttime temperatures. Subsequently, clustering heatmaps of the samples were constructed (Figure 2). The results showed the presence of OSS18, OFS18, OTS18 (STSL, CK treatment) and OSS13, OFS13, and OTS13 (STSL, LNT treatment). A total of 36 samples were analyzed, comprising 12 samples from the WTSL treatment (CK) and 12 samples from the LNT treatment: SSS18, SFS18, and STS18 (WTSL, CK) and SSS13, SFS13, and STS13 (WTSL, LNT). The correlation coefficients for all 36 replicates were greater than 0.70, indicating a high degree of correlation between samples. The repeatability coefficient among transcriptome sequencing samples was satisfactory, indicating that the results were reliable. Principal component analysis demonstrated the reliability of transcriptome data obtained from diverse rapeseed horn peel samples. The FPKM violin diagram of the distribution of horn pericarps revealed a less dispersed distribution of gene expression levels across samples, with an overall higher level of gene expression, as indicated by an FPKM range of 101.5 to 103. The screening criteria for DEGs were as follows: p < 0.05, |log2 fold change|≥2, and FPKM>1 (in at least in one sample). These criteria were used to identify the DEG profiles of different groups.
Compared to CK, OSS18 and OSS13 exhibited 1365 DEGs, of which 1048 were upregulated and 317 were downregulated. Similarly, OFS18 vs. OFS13 demonstrated 472 DEGs, comprising 205 upregulated and 267 downregulated genes. A total of 696 DEGs were identified in the OTS18 vs. OTS13 comparison, with 345 being upregulated and 351 being downregulated. In the SSS18 vs. SSS13 comparison, 1814 DEGs were observed, comprising 736 upregulated and 1078 downregulated genes. A comparison between SFS18 and SFS13 revealed 1781 DEGs, of which 801 were upregulated and 980 were downregulated. Similarly, a comparison between STS18 and STS13 yielded 12,287 DEG, comprising 6115 upregulated and 6172 downregulated genes.
As illustrated in the Venn diagram comparing the DEGs in the WTSL silique walls under LNT (Figure 3), there were 444 common genes between the SSS18 vs. SSS13 and SFS18 vs. SFS13 comparisons, while the SFS18 vs. SFS13 comparison exhibited 1379 and 1337 specific DEGs. A total of 942 common genes were identified between SFS18 and STS18, whereas STS13 exhibited 839 DEGs. Additionally, 11,345 unique DEGs were observed in STS13. SSS18 and SSS13 exhibited shared gene expression patterns with STS18 and STS13, with 999 common genes and 824 and 175 up- and down-regulated DEGs, respectively. These DEGs may play roles in maintaining growth, developing the silique wall, and synthesizing seed oil.

3.4. KEGG Annotation of the DEGs in Silique Wall Under Low Nighttime Temperature

To elucidate the alterations in oil and erucic acid composition in rapeseed seeds, transcriptome data of silique walls under LNT were compared, and discrepancies in lipid synthetic substrate content in rapeseed under LNT and CK were analyzed: OSS18 vs. OSS13, OFS18 vs. OFS13, and OTS18 vs. OTS13. The comparison group of OSS18 vs. OSS13 is illustrated in Figure 4a. The KEGG enrichment terms were primarily concentrated in the global and overview maps (153, 61, and 77 DEGs, respectively), carbohydrate metabolism (60, 20, and 29 DEGs), energy metabolism (36, 23, and 20 DEGs), and amino acid metabolism (39, 11, and 12 DEGs). Additionally, the comparison group of OSS18 vs. OSS13 (Figure 4a) revealed that lipid metabolism (29, 10, and 14 DEGs), metabolism of cofactors and vitamins (17, 7, and 7 DEGs), metabolism of other amino acids (16, 7, and 17 DEGs), biosynthesis of other secondary metabolites (22, 8, and 16 DEGs), and nucleotide metabolism (9, 0, and 3 DEGs) were significantly enriched. Additionally, there were 0, 3, and 11 DEGs in the metabolism of terpenoids and polyketides; glycan biosynthesis and metabolism; and folding, sorting, and degradation, respectively. The replication and repair pathways (3, 0, and 2 DEGs), transcription pathway (10, 2, and 1 DEGs), signal transduction pathway (33, 12, and 18 DEGs), membrane transport pathway (1, 2, and 0 DEGs), transport and catabolism pathways (18, 8, and 6 DEGs), and environmental adaptation pathway (25, 10, and 15 DEGs) were also affected. The KEGG annotations of the SSS18 vs. SSS13, SFS18 vs. SFS13, and STS18 vs. STS13 differentially expressed genes exhibited a comparable pattern (Figure 4b), with discrepancies observed in the number of upregulated and downregulated genes.

3.5. Expression Analysis of the DEGs Related to Respiration in Silique Wall Under Low Nighttime Temperature

The photosynthetic products found within the silique wall serve as a substrate for the accumulation of high-quality seeds. In this study, the expressions of genes related to respiration (citrate cycle (TCA cycle), glycolysis/gluconeogenesis, oxidative phosphorylation, and the pentose phosphate pathway) were analyzed in the silique wall under LNT and CK (Table 5). The comparison groups OSS18 vs. OSS13, OFS18 vs. OFS13, OTS18 vs. OTS13, SSS18 vs. SSS13, SFS18 vs. SFS13, and STS18 vs. STS13 contained 163, 141, 140, 157, 145, and 282 DEGs, respectively. Consequently, the screening of differentially expressed genes associated with the citrate cycle (TCA cycle), glycolysis/gluconeogenesis, oxidative phosphorylation, and the pentose phosphate pathway, along with an understanding of the expression of these DEGs at varying daytime and nighttime temperatures, provides a foundation for elucidating the substrate synthesis process of the silique wall. In comparison to CK, the DEGs were found to be associated with oxidative phosphorylation and glycolysis (Figure 5). A total of 18 DEGs related to glycolysis were identified, with the majority encoding fructose-1,6-bisphosphatase, aldehyde dehydrogenase 3, fructose-diphosphate aldolase 2, pyruvate kinase, and ATP-dependent 6-phosphofructase. Among these, LOC106446362 (fructose-diphosphate aldolase 1) and LOC106421663 (fructose-1,6-bisphosphatase) are particularly noteworthy. Fructose-diphosphate aldolase 1 and fructose-1,6-bisphosphatase are involved in a two-step reaction for the conversion of fructose 6-phosphate to glyceraldehyde 3-phosphate during glycolysis. The conversion of 1,6-diphosphate fructose to glyceraldehyde 3-phosphate is a reversible reaction, and enzyme activity and gene expression levels serve as determinants of the extent of the reaction. The expression in WTSL was significantly upregulated at 35 and 43 DAF, with a particularly pronounced increase observed at 43 DAF, which was over two-fold. In contrast, there was no significant difference in STSL. The 22 DEGs involved in oxidative phosphorylation included 17 ATPases and five soluble pyrophosphatases (SIPs), of which LOC106369006 encodes ATPase 11. During oxidative phosphorylation, the energy released by the respiratory chain is utilized to synthesize ADP into ATP via ATPase, thereby providing an energy and material basis (amino acids, proteins, and nucleic acids) for the growth and development of rapeseed. Oxidative phosphorylation is a crucial process for plant respiration. The substrate for respiration is sugar (e.g., sucrose), which is oxidized and degraded into reduced coenzymes, such as NADH or FADH, which enter the electron transport chain for further oxidation and energy release. ATP is generated by oxidative phosphorylation, and serves as the primary source of energy for growth and development. LOC106357816 encodes soluble pyrophosphorylase 2, which is involved in ADP degradation. Under LNT, LOC106369006 and LOC106357816 exhibited notable upregulation in the WTSL silique wall at 35 and 43 DAF (with a difference of over two-fold at 43 DAF), whereas no significant difference was observed in the STSL silique wall. The results demonstrated that the expressions of genes associated with glycolysis and ATP degradation were upregulated at 35 DAF and 43 DAF in the WTSL silique wall, but downregulated at 35 DAF and 43 DAF in STSL. This suggests that LNT treatment was not conducive to glycolysis and ATP degradation in the STSL silique wall, resulting in the storage of more substrates and energy. This provides the material basis and energy for oil synthesis in seeds.

3.6. Expression Analysis of the DEGs Related to Sucrose Transportation in the Silique Wall Under Low Nighttime Temperature

The expression profiles of TFs in the silique walls at different developing stages were analyzed to understand the complex signaling pathways of the silique wall under different daytime and nighttime temperatures. Compared with CK, the results showed that the upregulated expression of ABI4 (LOC111208556) and WRKY51 (LOC106379059) were observed at 27 and 43 DAF in the STSL silique wall (Figure 6), and there was no significant difference at 35 DAF; however, these genes’ expression decreased at 27, 35, and 43 DAF in the WTSL silique wall (the difference was not statistically significant). NAC104 (LOC106357642), DOF3 (LOC106435356), and ARF8 (LOC106426279) were upregulated at 27, 35, and 43 DAF in the STSL silique walls (Figure 6), whereas in WTSL these genes were downregulated and the differences were not significant. These results indicate that under LNT conditions, the upregulated expression of transcription factor genes involved in sugar synthesis in STSL and the upregulated expression of DEGs related to sugar metabolism promoted the accumulation of sugars and provided more substrates for seed oil synthesis.

3.7. Expression Analysis of Glucose-Metabolizing Transcription Factor Genes in the Silique Wall Under Low Nighttime Temperature

The photosynthetic products in the silique wall are the material sources of seed oil synthesis, and sucrose is the product of photosynthesis in the silique wall, which is stored in cells to synthesize starch or transferred to seeds for oil synthesis. The photosynthetic products in the silique wall are used in the early stages of silique wall formation for silique wall morphogenesis and are mainly used in the middle and late stages of seed oil synthesis. In this study, the differential genes of metabolic pathways related to glucose metabolism in the silique wall under LNT were analyzed. Among these were carbon metabolism, plant hormone signal transduction, and starch and sucrose metabolism, and there were more DEGs enriched in metabolic processes, such as metabolism. DEGs related to sucrose transport were also identified. They are SUT (LOC106395514, LOC106400782, LOC106369332, LOC106415203, LOC106440357, LOC111214171, LOC106362619, LOC106432297) (Figure 6) and SWEET family genes (SWEET1, LOC106347359, LOC106348315, LOC106349243, LOC106384025, LOC106384033, LOC106401315, LOC106419028, LOC106424615, LOC106425885, LOC111198786, LOC111198801, LOC111208255); one DEG was SPP (LOC106390094) and one was CINV1 (LOC106397369) (Figure 6). These DEGs are mainly involved in the transport of sucrose from photosynthates (sugars) in the silique wall cells through sieve tubes to the seeds for lipid synthesis. The results showed that the expression of the sucrose synthesis-related gene CINV1 (Figure 6) in 35 and 43 DAF samples and the sucrose transport-related gene SUC1 (Figure 6) in STSL were significantly upregulated (especially when the difference ratio of 43 DAF was above 1.9) under LNT. However, there was no significant downregulation or difference in WTSL expression under the LNT conditions. These results indicate that the LNT treatment was beneficial for sucrose synthesis and transport in the STSL silique wall, and the material base for lipid and FA synthesis in seeds was higher, which was conducive to lipid synthesis in seeds.

3.8. Analysis of the Relative Expression of Genes Related to Oil Synthesis in Seeds

In this study, genes related to oil accumulation (SAD (LOC106372205), HAD (LOC106375927), KAS II (LOC106387251), FAD2 (LOC106434448), FAD3 (LOC106439274), KAR (LOC106439448), ECR (LOC106396280)) in STSL and WTSL seeds were investigated at different nighttime temperatures. and analyzed for their relative expression levels (Table 6). The results show that under low temperature treatment at night, the relative expression levels of SAD, HAD, KAS II, FAD2, FAD3, KAR, and ECR in STSL seeds increased significantly at 27 DAF, 35 DAF and 43 DAF, whereas they decreased or had no significant difference in WTSL seeds. In conclusion, low nighttime temperature significantly increased the expression of DEGs related to oil synthesis in STSL seeds, thus promoting oil synthesis and content, whereas WTSL showed no significant difference or was less upregulated than STSL seeds.

3.9. qRT-PCR Validation of the Transcriptome Data of the Silique Wall

The LNT-treated STSL seeds exhibited a notable reduction in respiration and a marked downregulation of the related genes, whereas WTSL displayed no discernible difference in the expression of these genes or exhibited a lower degree of downregulation compared to STSL. Concurrently, the enhanced expression of genes associated with sucrose transport in the STSL peel facilitates the transportation of a greater quantity of photosynthates to the seeds, thereby enhancing lipid biosynthesis. The expression of differentially expressed genes (DEGs) related to respiration in the STSL silique wall was significantly downregulated, whereas the expression of genes related to sucrose synthesis and transport was significantly upregulated. This indicated that the low nighttime temperature treatment reduced respiratory consumption in the STSL silique wall and increased the transport of photocompounds to the seeds for oil synthesis. This process is conducive to improving the oil content. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was used to validate the expression levels of genes associated with respiration and sucrose transport (Figure 6), the relative expression levels of transcription factors involved in carbohydrate metabolism (Figure 7), and the correlation between transcriptome data and the results of the qRT-PCR analysis. LOC106357816, LOC106446362, and LOC106421663 are involved in glycolysis and oxidative phosphorylation. Compared to the HNT treatment, the relative gene expression at 27, 35, and 43 DAF in the STSL silique wall under the LNT treatment was significantly downregulated. However, no significant difference was observed in the WTSL silique walls. These findings suggest that respiration-related differential genes in STSL were markedly repressed by LNT, resulting in diminished respiration and reduced sugar consumption. The expression of genes involved in sucrose synthesis and transport was elevated in the LNT treatment and was accompanied by enhanced photocontract transport capacity. However, respiration-related genes were not significantly downregulated in WTSL; sucrose synthesis and transport were downregulated, and no significant difference was found. A reduction in respiratory consumption in the silique wall of STSL, coupled with an enhanced sucrose transport capacity, resulted in increased oil content of STSL seeds under LNT conditions.

4. Discussion

Brassica crops include a variety of edible vegetables and plant oil crops whose production is limited beyond their ability to tolerate low temperatures. The key regulators of low temperature tolerance in Brassica remain largely undiscovered. In addition, overexpression of miR1885 in semi-winter rapeseed decreased the mRNA abundance of Bn.TIR.A09 and Bn.TNL.A03, resulting in increased sensitivity to low temperatures. Knocking out miR1885 in spring rapeseed resulted in an increase in the abundance of its target mRNA and improved low temperature tolerance [27]. Brassinolides, IAAs, Gas, CK, ABA, strigolactones are widely involved in plant growth and stress response [17,28]. The relative expression of S-nitroso-glutathione reductase (BrGSNOR) and the activity of the GSNOR enzyme are downregulated and inhibited by BR treatment, GSNO treatment, and NO removal. The relative expression of BrGSNOR and the activity of GSNOR enzyme are upregulated by GSNO spray after inhibiting BR synthesis [29]. The expression of the purple R2R3-MYB transcription factor (TF) gene BrMYB2 and alkaline helix-loop-helix (bHLH) regulatory gene BrTT8 are upregulated after low temperature induction, and the expressions of white BrMYBL2.1 and BrLBD38.2 are upregulated. BrMYB2 and BrTT8 may play an important role in the co-activation of anthocyanin structural genes of Chinese cabbage, and the downregulation of BrMYB2 and the upregulation of some negative regulatory factors may be related to the formation of a low-temperature tolerant phenotype [30]. In conclusion, many genes (SOD, POD, TLP, MTHFR2, CPRD49, AAP8, endoglucanase 10, BXL, GATL, etc.) and transcription factors (ABI, MYB, MYC, WRKY, ARF, bHLH, NAC, etc.) are involved in the process of rapeseed’s response to low temperature stress [31,32,33,34,35].
The ABI4 protein in Arabidopsis thaliana is involved in the regulation of gene expression of enzymes related to starch metabolism, thus affecting the accumulation of starch, such as DEGs related to starch synthesis (APL3 and SBE2) and starch degradation genes (SEX1 and BMY8/BAM3) [36]. Compared to the wild-type, the content of 6-phospho-trehalose in the source organs of NAC23 overexpressed plants in rice mutants increased, which improved the photosynthetic rate and transport rate of photosynthetic products from the source to the reservoir [37]. Studies have found that NAC68 can enhance the accumulation of sugars in watermelon flesh by inhibiting the activity of neutral invertase and by elucidating the molecular mechanism by which NAC transcription factors regulate sugar metabolism in watermelon flesh [38]. ABI4, WRKY51, DOF3, ARF8, and other transcription factors participate in auxin synthesis, regulate sucrose phosphate synthetase activity, and regulate sucrose content [39]. Studies have shown that in Arabidopsis thaliana with high SUT4 expression at low temperatures, SUC1 and SUC2 expression are upregulated [40]. The upregulated expression of SWEETs was found in mulberry trees, and SWEETs play an important role in temperature response [41]. A large amount of amylose is catalyzed in the endosperm of a SUT4 mutant rice, resulting in an irregular arrangement of immature starch grains and quality degradation [42]. ABI4 is a key enzyme in the regulation of starch synthesis. Starch is used as a storage substance to store photosynthates in the silique wall, which are then degraded into sucrose and transported to the seeds for oil synthesis through the stalk and sieve tubes in the stipe of the silique wall [43]. WRKY51 activates the expression of genes involved in sucrose synthesis [44]. NAC104 enhances sugar accumulation by inhibiting sucrase activity. The expression levels of DOF3 decreased, starch granules became smaller, loosely arranged, and irregular, and the expression levels of starch synthesis-related and sucrose synthase genes decreased significantly [45]. By participating in auxin synthesis, ARF8 affects the activity of sucrose phosphate synthetase, thus affecting the sucrose content [46]. The interaction of temperature and photoperiod promotes the growth of rapeseed and the oil-containing marine microalgae Dunaliella virescens [47]. The contents of oleic acid and linoleic acid in rapeseed seeds are significantly increased, while the contents of linoleic acid and linolenic acid are significantly decreased under long term high temperature [27]. High night temperature significantly affects the total fatty acid and fatty acid composition of low and high oil content varieties, resulting in a decrease of 18.9% and 13.7% of total fatty acid, respectively. A high temperature at night decreases the relative ratio of C18:0 and C18:1 and increases the relative ratio of C18:2 and C18:3, and in-depth analysis of transcriptome profiles show that high nighttime temperature upregulates gibberellin signaling. This upregulation is associated with the active expression of genes involved in the catabolism of fatty acids, such as those involved in the β-oxidation and glyoxylate metabolic pathways [12]. Under LNT, the content of C18:1 in mature STSL seeds decreased, while the content of C22:1 increased significantly in STSL seeds. In this study, LNT weakened the respiration of canola peel, increased the sugar content, and promoted the increase of seed oil content. At the same time, it promoted sucrose synthesis and transport and upregulated expression of related transcription factors in the silique wall, which ensured the substrate level for seed oil synthesis. The expressions of DEGs (LOC106397369 and LOC106432297) related to sucrose synthesis and transport in the STSL silique wall were upregulated under LNT, especially at 35 and 43 DAF (rapid growth period and stable period of oil content growth). The expressions of the ABI4 (LOC111208556) and WRKY51 (LOC106379059) transcription factors were upregulated at 27 and 43 DAF, with no significant difference at 35 DAF, whereas there was no significant difference at 27, 35, or 43 DAF in WTSL silique walls. The expressions of the NAC104 (LOC106357642), DOF3 (LOC106435356), and ARF8 (LOC106426279) transcription factors were upregulated at 27, 35, and 43 DAF in STSL silique walls, and downregulated or not significantly different in WTSL. The upregulated gene expression of sucrose synthesis and transcription factors in the STSL silique wall under LNT promoted the accumulation of sugars and provided a high material basis and energy level for oil synthesis in the seeds.
Over 2000 known genes regulate FA synthesis and accumulation in rapeseed and are highly conserved. Therefore, the expression levels of genes related to FA synthesis and accumulation, and the activities of key enzymes (SnRK, DGAT, G6PDH, PDH, PPase, LPAAT4, LPAAT5, ACC, FAD2, FAD3, SAD, FAE, LPTG, IPMS, IPMI, FATA, and FATB) were detected during development, which play an important role in substrate synthesis, acyl transfer, isomerization, desaturation, and carbon chain extension [48,49,50]. WRI1 [51], MYB76 [52], and other transcription factors play important roles in regulating the initiation of FA synthesis. Therefore, the expression of these genes and their related enzymatic activities reflects the accumulation of FAs. Meanwhile, the expressions of seven DEGs related to oil synthesis in STSL seeds were significantly upregulated under LNT, whereas in WTSL the difference was not significant or the upregulated level was lower than that in SRSL seeds. According to the transcriptomic results, respiration was weakened and sucrose transport capacity was enhanced in STSL. The expression of genes related to oil synthesis in seeds (SAD, HAD, KASII, FAD2, FAD3, KAR, and ECR) was significantly upregulated or downregulated, providing a material basis and energy level for oil synthesis in the seeds. The oil content of the STSL seeds increased.

5. Conclusions

The results of the altitude test showed that STSL is a strong temperature-sensitive line and WTSL is a weak temperature-sensitive line. The oil and FA content of rapeseed (STSL and WTSL) changed at different nighttime temperatures. The lower the nighttime temperature, the greater the difference between the oil and erucic acid content of STSL. Nighttime temperature was the main factor affecting the oil and erucic acid content of the STSL seeds. Based on this, 20/18 °C (CK) and 20/13 °C (LNT) experiments were designed to analyze the transcriptomic data of the silique wall. The low nighttime temperature reduced the respiration of the silique wall, increased the sugar content, and promoted an increase in the seed oil content. Low nighttime temperatures promoted sucrose synthesis and transport in seeds and upregulated the expression of related transcription factors, which ensured the substrate level for oil synthesis in the seeds. Sucrose synthesis and transport-related DEGs (SUC1 (LOC106432297) and CINV1 (LOC106397369)) and transcription factor genes (ABI4 (LOC111208556), WRKY51 (LOC106379059), NAC104 (LOC106357642), DOF3 (LOC106435356), and ARF8 (LOC106426279)) were upregulated in the STSL silique wall, which promoted the transport of sucrose from the silique wall to the seed. Simultaneously, the expression levels of DEGs related to oil synthesis (SAD, HAD, KASII, FAD2, FAD3, KAR, and ECR) in STSL seeds were significantly upregulated, which was conducive to oil accumulation and increased oil content in STSL seeds.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agriculture15060576/s1, Table S1: The soil physicochemical properties in the two test bases.

Author Contributions

Conceptualization, J.W. and L.L.; software, investigation, writing—original draft preparation, C.M.; validation, Y.Z. and X.Y.; resources, L.L.; writing—review and editing, J.W. and L.L.; supervision, L.L.; and project administration, funding acquisition, C.M., J.W. and L.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Unified Project Plan of the Agricultural Research Institute at the Xizang Academy of Agriculture and Animal Husbandry Sciences (grant number: NYSTC202403), the National Natural Science Foundation of China (grant number: 31960384), and the China Agriculture Research System (grant number: CARS-12-62).

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found at: https://ngdc.cncb.ac.cn/search/specific?db=bioproject&q=PRJCA036041.

Acknowledgments

We would like to thank Guangzhou Genedenovo Biotechnology Co., Ltd. for the RNA-seq and bioinformatics analyses.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

References

  1. Kang, W.; Dong, J.; Meng, Q.; Liang, X.; Xu, T.; Yang, Q.; Dong, Z. Correlation between meteorological factors and oil content in pod of Brassica napus L. J. Northwest AF Univ. (Nat. Sci. Ed.). 2016, 44, 97–103. (In Chinese) [Google Scholar] [CrossRef]
  2. Cong, R.; Zhang, Z.; Lu, J. Climate impacts on yield of winter oilseed rape in different growth regions of the Yangtze River Basin. Chin. J. Oil Crop Sci. 2019, 41, 894–903. (In Chinese) [Google Scholar] [CrossRef]
  3. Li, Z. In Silico Analysis of GDSL Genes in Arabidopsis and Brassica and the Investigation on Their Function in Seeds. Ph.D. Thesis, Zhejiang University, Hangzhou, China, 2014; p. 56. (In Chinese). [Google Scholar]
  4. Tian, Z.; Zhao, K.; Li, G.; Zhang, Y.; Li, Q.; Lu, Y.; Fu, M. Investigation and analysis of fertilization in rapeseed in Yunnan Province. Southwest China J. Agric. Sci. 2019, 32, 1586–1593. (In Chinese) [Google Scholar] [CrossRef]
  5. Liu, Z.; Sun, W.; Yang, N.; Wu, J.; Fang, Y.; Li, X.; Zeng, X.; Wang, Y. Variations in quality and agronomic traits of winter rapeseed (Brassica campestris L.) grown in different ecological regions. Agric. Res. Arid Areas 2015, 33, 49–58. (In Chinese) [Google Scholar] [CrossRef]
  6. Cao, X.; Liu, Z.; Mi, W.; Xu, C.; Zou, Y.; Xu, M.; Zheng, G.; Fang, X.; Cui, X.; Dong, X.; et al. Analysis on the adaptability of northward planting of Brassica napus. Sci. Agric. Sin. 2020, 53, 4164–4176. (In Chinese) [Google Scholar] [CrossRef]
  7. Li, H.; Wu, M.; Chao, H.; Yin, Y.; Xia, Y.; Cheng, X.; Chen, K.; Yan, S.; Wang, X.; Xiong, Y.; et al. A rare dominant allele DYSOC1 determines seed coat color and improves seed oil content in Brassica napus. Sci. Adv. 2025, 11, eads7620. [Google Scholar] [CrossRef]
  8. Fu, S.; Li, C.; Nima, Z.M.; Tang, L.; Qi, C. Effect of meteorological factors on oil accumulation in rapeseed. Chin. Bull. Bot. 2014, 49, 41–48. (In Chinese) [Google Scholar] [CrossRef]
  9. Mi, C.; Wang, Q.; Zhao, Y.N.; Zhang, C.L.; Sun, C.; Liu, Z.G.; Lin, L.B. Changes in the differentially expressed proteins and total fatty acid contents in winter rapeseed (Brassica rapa L.) leaves under drought stress. Russ. J. Plant Physiol. 2022, 69, 31. [Google Scholar] [CrossRef]
  10. Yang, J.; Wang, Q.; Zhang, C.; Bai, Y.; Zhang, Y.; Li, D.; Shang, H.; Lin, L. Effect of different high altitudes on the seed oil content and agronomic traits of Brassica napus L. J. Yunnan Agric. Univ. (Nat. Sci.) 2021, 36, 762–767. (In Chinese) [Google Scholar] [CrossRef]
  11. Zhou, L.; Yan, T.; Chen, X.; Li, Z.; Wu, D.; Hua, S.; Jiang, L. Effect of high night temperature on storage lipids and transcriptome changes in developing seeds of oilseed rape. J. Exp. Bot. 2018, 69, 1721–1733. [Google Scholar] [CrossRef]
  12. Mi, C.; Zhang, Y.; Zhao, Y.; Lin, L. Mechanisms of low nighttime temperature promote oil accumulation in Brassica napus L. based on in-depth transcriptome analysis. Physiol. Plant. 2024, 176, e14372. [Google Scholar] [CrossRef] [PubMed]
  13. Song, J.; Jiang, L.; Jameson, P.E. Expression patterns of Brassica napus genes implicate IPT, CKX, sucrose transporter, cell wall invertase, and amino acid permease gene family members in leaf, flower, silique, and seed development. J. Exp. Bot. 2015, 66, 5067–5082. [Google Scholar] [CrossRef] [PubMed]
  14. Mi, C.; Zhao, Y.; Lin, L.; Wang, J. Mechanism analysis of increased erucic acid content in Brassica napus L. seeds resulting low nighttime temperature. Gene. 2025, 936, 149119. [Google Scholar] [CrossRef]
  15. Zeng, L.; Han, X.; Gou, X.; Pei, H.; Shao, Y.; Cao, Y.; Zhang, Z.; Li, X.; Yu, J.; Yan, J.; et al. Leveraging phenotypic plasticity in seed oil content for climate-adapted breeding and production. Plant Cell Environ. 2025. [Google Scholar] [CrossRef]
  16. Srirangan, S.; Sauer, M.L.; Howard, B.; Dvora, M.; Dums, J.; Backman, P.; Sederoff, H. Interaction of temperature and photoperiod increases growth and oil content in the marine microalgae Dunaliella viridis. PLoS ONE 2015, 10, e0127562. [Google Scholar] [CrossRef]
  17. Hua, W.; Li, R.J.; Zhan, G.M.; Liu, J.; Li, J.; Wang, X.F.; Liu, G.H.; Wang, H.Z. Maternal control of seed oil content in Brassica napus: The role of silique wall photosynthesis. Plant J. 2012, 69, 432–444. [Google Scholar] [CrossRef]
  18. Liu, J.; Hua, W.; Yang, H.; Guo, T.; Sun, X.; Wang, X.; Liu, G.; Wang, H. Effects of specific organs on seed oil accumulation in Brassica napus L. Plant Sci. 2014, 227, 60–68. [Google Scholar] [CrossRef]
  19. Elferjani, R.; Soolanayakanahally, R. Canola responses to drought, heat, and combined stress: Shared and specific effects on carbon assimilation, seed yield, and oil composition. Front. Plant Sci. 2018, 9, 1224. [Google Scholar] [CrossRef]
  20. Yu, E.; Fan, C.; Yang, Q.; Li, X.; Wan, B.; Dong, Y.; Wang, X.; Zhou, Y. Identification of heat responsive genes in Brassica napus siliques at the seed-filling stage through transcriptional profiling. PLoS ONE 2014, 9, e101914. [Google Scholar] [CrossRef]
  21. Mi, C.; Sun, C.; Yuan, Y.; Li, F.; Wang, Q.; Zhu, H.; Hua, S.; Lin, L. Effects of low nighttime temperature on fatty acid content in developing seeds from Brassica napus L. based on RNA-seq and metabolome. Plants 2023, 12, 325. [Google Scholar] [CrossRef]
  22. Wu, X.L.; Liu, Z.H.; Hu, Z.H.; Huang, R.Z. BnWRI1 coordinates fatty acid biosynthesis and photosynthesis pathways during oil accumulation in rapeseed. J. Integr. Plant Biol. 2014, 56, 582–593. [Google Scholar] [CrossRef] [PubMed]
  23. Laudencia-Chingcuanco, D.; Ganeshan, S.; You, F.; Fowler, B.; Chibbar, R.; Anderson, O. Genome-wide gene expression analysis supports a developmental model of low temperature tolerance gene regulation in wheat (Triticum aestivum L.). BMC Genom. 2011, 12, 299. [Google Scholar] [CrossRef] [PubMed]
  24. Liu, H.; Yang, Q.; Fan, C.; Zhao, X.; Wang, X.; Zhou, Y. Transcriptomic basis of functional difference and coordination between seeds and the silique wall of Brassica napus during the seed-filling stage. Plant Sci. 2015, 233, 186–199. [Google Scholar] [CrossRef] [PubMed]
  25. Mácová, K.; Prabhullachandran, U.; Štefková, M.; Spyroglou, I.; Pěnčík, A.; Endlová, L.; Novák, O.; Robert, H.S. Long-term high-temperature stress impacts on embryo and seed development in Brassica napus. Front. Plant Sci. 2022, 13, 844292. [Google Scholar] [CrossRef]
  26. Hammac, W.A.; Maaz, T.M.; Koenig, R.T.; Burke, I.C.; Pan, W.L. Water and Temperature stresses impact canola (Brassica napus L.) fatty acid, protein, and yield over nitrogen and sulfur. J. Agric. Food Chem. 2017, 65, 10429–10438. [Google Scholar] [CrossRef]
  27. Xu, P.; Zhang, W.; Wang, X.; Zhu, Y.; Liang, W.; He, Y.; Yu, X. Multiomics analysis reveals a link between Brassica-specific miR1885 and rapeseed tolerance to low temperature. Plant Cell Environ. 2023, 46, 3405–3419. [Google Scholar] [CrossRef]
  28. Manju Devi, S.; Joel, J.A.; Raveendran, M.; Pushpam, R.; Muthuramu, S.; Pushpa, R.; Suresh, R. Unravelling population structure and marker trait association using SSR markers among the identified drought tolerant rice landraces (Oryza sativa L.). Czech J. Genet. Plant Breed. 2025, 61, 1–22. [Google Scholar] [CrossRef]
  29. Gao, X.; Ma, J.; Tie, J.; Li, Y.; Hu, L.; Yu, J. BR-mediated protein S-nitrosylation alleviated low-temperature stress in mini Chinese cabbage (Brassica rapa ssp. pekinensis). Int. J. Mol. Sci. 2022, 23, 10964. [Google Scholar] [CrossRef]
  30. He, Q.; Ren, Y.; Zhao, W.; Li, R.; Zhang, L. Low temperature promotes anthocyanin biosynthesis and related gene expression in the seedlings of purple head Chinese cabbage (Brassica rapa L.). Genes 2020, 11, 81. [Google Scholar] [CrossRef]
  31. Dai, Y.; Sun, X.; Wang, C.; Li, F.; Zhang, S.; Zhang, H.; Li, G.; Yuan, L.; Chen, G.; Sun, R.; et al. Gene co-expression network analysis reveals key pathways and hub genes in Chinese cabbage (Brassica rapa L.) during vernalization. BMC Genom. 2021, 22, 236. [Google Scholar] [CrossRef]
  32. Zhang, B.; Hu, Z.; Zhang, Y.; Li, Y.; Zhou, S.; Chen, G. A putative functional MYB transcription factor induced by low temperature regulates anthocyanin biosynthesis in purple kale (Brassica oleracea var. acephala f. tricolor). Plant Cell Rep. 2012, 31, 281–289. [Google Scholar] [CrossRef] [PubMed]
  33. Yuan, L.; Wang, J.; Xie, S.; Zhao, M.; Nie, L.; Zheng, Y.; Zhu, S.; Hou, J.; Chen, G.; Wang, C. Comparative proteomics indicates that redox homeostasis is involved in high- and low-temperature stress tolerance in a novel wucai (Brassica campestris L.) genotype. Int. J. Mol. Sci. 2019, 20, 3760. [Google Scholar] [CrossRef] [PubMed]
  34. Luo, T.; Xian, M.; Zhang, C.; Zhang, C.; Hu, L.; Xu, Z. Associating transcriptional regulation for rapid germination of rapeseed (Brassica napus L.) under low temperature stress through weighted gene co-expression network analysis. Sci. Rep. 2019, 9, 55. [Google Scholar] [CrossRef] [PubMed]
  35. Hussain, A.; Qayyum, A.; Farooq, S.; Almutairi, S.M.; Rasheed, R.A.; Qadir, M.; Vyhnánek, T.; Sun, Y. Pepper immunity against Ralstonia solanacearum is positively regulated by CaWRKY3 through modulation of different WRKY transcription factors. BMC Plant Biol. 2024, 24, 522. [Google Scholar] [CrossRef]
  36. Julia, J.W.; Alessia, P.; Berend, S.; Johannes, H.; Sjef, C.S. ABI4: Versatile activator and repressor. Trends Plant Sci. 2013, 18, 125–132. [Google Scholar]
  37. Gao, M.J.; Li, X.; Lui, H.; Gropp, G.M.; Lydiate, D.D.; Wei, S. ASIL1 is required for proper timing of seed filling in Arabidopsis. Plant Signal Behav. 2011, 6, 1886–1888. [Google Scholar] [CrossRef]
  38. Moghaddas, S.H.; Hamzeh-Mivehroud, M.; Silva, A.P.; Walshe, J.L.; Mohammadi, S.A.; Rahbar-Shahrouziasl, M.; Abbasi, M.; Jamshidi, O.; Low, J.K.; Dastmalchi, S.; et al. Expression, purification and DNA-binding properties of zinc finger domains of DOF proteins from Arabidopsis thaliana. Bioimpacts. 2018, 8, 167–176. [Google Scholar] [CrossRef]
  39. Ge, S.X.; Son, E.W.; Yao, R. iDEP: An integrated web application for differential expression and pathway analysis of RNA-seq data. BMC Bioinform. 2018, 19, 534. [Google Scholar] [CrossRef]
  40. Huang, H.H. Sucrose and ABA Regulate Starch Biosynthesis in Maize Endosperm Through Transcription Factors, ZmEREB156 and ZmEREB17. Ph.D. Thesis, Sichuan Agricultural University, Chengdu, China, 2016; p. 56. [Google Scholar]
  41. Wang, J.; Wang, Y.; Zhang, J.; Ren, Y.; Li, M.; Tian, S.; Yu, Y.; Zuo, Y.; Gong, G.; Zhang, H.; et al. The NAC transcription factor ClNAC68 positively regulates sugar content and seed development in watermelon by repressing ClINV and ClGH3.6. Hortic. Res. 2021, 8, 214. [Google Scholar] [CrossRef]
  42. Papi, M.; Sabatini, S.; Altamura, M.M.; Hennig, L.; Schäfer, E.; Costantino, P.; Vittorioso, P. Inactivation of the phloem-specific Dof zinc finger gene DAG1 affects response to light and integrity of the test of Arabidopsis seeds. Plant Physiol. 2002, 128, 411–417. [Google Scholar] [CrossRef]
  43. Kang, X.; Huang, S.; Feng, Y.; Fu, R.; Tang, F.; Zheng, L.; Li, P.; Chao, N.; Liu, L. SWEET transporters and their potential roles in response to abiotic and biotic stresses in mulberry. Beverage Plant Res. 2023, 3, 6. [Google Scholar] [CrossRef]
  44. Lou, G.; Alam Bhat, M.; Tan, X.; Wang, Y.; He, Y. Research progress on the relationship between rice protein content and cooking and eating quality and its influencing factors. Seed Bio. 2023, 2, 16. [Google Scholar] [CrossRef]
  45. Tang, J.; Wang, N.; Gao, J.; Liu, T.; Wen, J.; Yi, B.; Tu, J.; Fu, T.; Shen, J. Bioinformatics analysis of SnRK gene family and its relation with seed oil content of Brassica napus L. Acta Agron. Sin. 2021, 47, 416–426. (In Chinese) [Google Scholar] [CrossRef]
  46. Zhang, F.; Gao, X.; Zhang, J.; Liu, B.; Zhang, H.; Xue, J.; Li, R. Seed-specific expression of heterologous gene DGAT1 increases soybean seed oil content and nutritional quality. Chin. J. Biotechnol. 2018, 34, 1478–1490. (In Chinese) [Google Scholar] [CrossRef]
  47. Pavón-Suriano, S.G.; Ortega-Clemente, L.A.; Curiel-Ramírez, S.; Jiménez-García, M.I.; Pérez-Legaspi, I.A.; Robledo-Narváez, P.N. Evaluation of colour temperatures in the cultivation of Dunaliella salina and Nannochloropsis oculata in the production of lipids and carbohydrates. Environ. Sci. Pollut. Res. Int. 2018, 25, 21332–21340. [Google Scholar] [CrossRef]
  48. Guo, Y.L. Genetic Analysis of Seed Oil Content and Function Analysis of Genes Involved in Lipid Biosynthesis in Brassica napus L. Ph.D. Thesis, Huazhong Agricultural University, Wuhan, China, 2017; p. 43. (In Chinese). [Google Scholar]
  49. Kong, X.D. Transcriptome Analysis of Brassica napus Pod Using RNA-Seq and Identification of Lipid-Related Candidate Genes. Master’s Thesis, Zhejiang University, Hangzhou, China, 2015; p. 3. (In Chinese). [Google Scholar]
  50. Woodfield, H.K.; Fenyk, S.; Wallington, E.; Bates, R.E.; Brown, A.; Guschina, I.; Marillia, E.; Taylor, D.C.; Fell, D.; Harwood, J.L.; et al. Increase in lysophosphatidate acyltransferase activity in oilseed rape (Brassica napus) increases seed triacylglycerol content despite its low intrinsic flux control coefficient. New Phytol. 2019, 224, 700–711. [Google Scholar] [CrossRef]
  51. Ye, Y.; Nikovics, K.; To, A.; Lepiniec, L.; Fedosejevs, E.; Van Doren, S.; Baud, S.; Thelen, J. Docking of acetyl-CoA carboxylase to the plastid envelope membrane attenuates fatty acid production in plants. Nat. Commun. 2020, 11, 6191. [Google Scholar] [CrossRef]
  52. Liu, F.; Xia, Y.; Wu, L.; Fu, D.; Hayward, A.; Luo, J.; Yan, X.; Xiong, X.; Fu, P.; Wu, G. Enhanced seed oil content by overexpressing genes related to triacylglyceride synthesis. Gene 2015, 557, 163–171. [Google Scholar] [CrossRef]
Figure 1. The change in fatty acid content under different nighttime temperatures. (A) Fatty acid content of WTSL mature seeds under different nighttime temperatures and (B) fatty acid content of STSL mature seeds under different nighttime temperatures. Error bars represent standard error of the mean (SEM). N = 3 for each mean.
Figure 1. The change in fatty acid content under different nighttime temperatures. (A) Fatty acid content of WTSL mature seeds under different nighttime temperatures and (B) fatty acid content of STSL mature seeds under different nighttime temperatures. Error bars represent standard error of the mean (SEM). N = 3 for each mean.
Agriculture 15 00576 g001
Figure 2. Transcriptome analysis of the silique wall under CK and LNT. (a,d) PCA of transcriptome data of STSL and WTSL silique walls under CK and LNT; (b,e) Clustering analysis of RNA-seq data in STSL and WTSL silique walls under CK and LNT. (c,f) Number of DEGs in the comparison group.
Figure 2. Transcriptome analysis of the silique wall under CK and LNT. (a,d) PCA of transcriptome data of STSL and WTSL silique walls under CK and LNT; (b,e) Clustering analysis of RNA-seq data in STSL and WTSL silique walls under CK and LNT. (c,f) Number of DEGs in the comparison group.
Agriculture 15 00576 g002
Figure 3. Analysis of the DEGs in the silique wall at low nighttime temperatures. (a,c) Number of DEGs in STSL silique walls at LNT and CK; (b,d) Number of DEGs in the WTSL silique walls at LNT and CK.
Figure 3. Analysis of the DEGs in the silique wall at low nighttime temperatures. (a,c) Number of DEGs in STSL silique walls at LNT and CK; (b,d) Number of DEGs in the WTSL silique walls at LNT and CK.
Agriculture 15 00576 g003
Figure 4. KEGG annotation of the silique wall tissue of WTSL and STSL under low nighttime temperature.
Figure 4. KEGG annotation of the silique wall tissue of WTSL and STSL under low nighttime temperature.
Agriculture 15 00576 g004
Figure 5. Heatmap of the DEGs related to sucrose transport, the TCA cycle, and oxidative phosphorylation of the silique wall.
Figure 5. Heatmap of the DEGs related to sucrose transport, the TCA cycle, and oxidative phosphorylation of the silique wall.
Agriculture 15 00576 g005
Figure 6. Regulation of sucrose synthesis in the silique wall at low nighttime temperatures.
Figure 6. Regulation of sucrose synthesis in the silique wall at low nighttime temperatures.
Agriculture 15 00576 g006
Figure 7. Analysis of expression of sucrose transport, the TCA cycle, and oxidative phosphorylation-related genes by qRT-PCR. One-way analysis of variance (ANOVA) and a Tukey’s post-hoc test were applied to evaluate the significance of differences in different comparable groups. Values with different lowercase letters were deemed to be statistically significant at p ≤ 0.05.
Figure 7. Analysis of expression of sucrose transport, the TCA cycle, and oxidative phosphorylation-related genes by qRT-PCR. One-way analysis of variance (ANOVA) and a Tukey’s post-hoc test were applied to evaluate the significance of differences in different comparable groups. Values with different lowercase letters were deemed to be statistically significant at p ≤ 0.05.
Agriculture 15 00576 g007
Table 1. Major climate and environmental factors during the growth period.
Table 1. Major climate and environmental factors during the growth period.
Altitude (m)Latitude (°)Average
Daytime
Temperature (°C)
Average Nighttime
Temperature (°C)
Extreme High-
Temperature (°C)
Extreme Low-
Temperature (°C)
Precipitation
(mm)
Sunshine Duration (h/Year)Evaporation (mm)
189025.101510.921.51.61501025598
218025.11135.116.70.21671027581
Table 2. qRT-PCR primers.
Table 2. qRT-PCR primers.
GeneForward Primer (5’ to 3’)Reverse Primer (3’ to 5’)
BnACTIN7CCCTGGAATTGCTGACCGTATGGAAAGTGCTGAGGGATGC
LOC106357816GCGGAAGATCAACGGAAACGGTCGGATTCTCCCCCTTTCAA
LOC106421663CGCGTGTAGCCGCTTAGATAAGTGTCTAACGTGACGGAGT
LOC106435356GAAAACGAGAACTTTGCTTGATGAGAAGAGGATTACAGCGGCG
LOC106426279TGGGTGAAATTTATGCAGGTCAGGTGAGGTTCTGTGGGAAGG
LOC106357816ACGAACAATCCAAGTTTATCGGCACGTCCATAAAGAAGCGCCA
LOC106372205GGACTCGAAACTAGCGCAGAAACAGATTGTCATCTCGGCCA
LOC106375927TCATACGCAACAAGCGACCGCTACAGCTGAAACACCAGG
LOC106387251ATACCCGTCAAGCCTTTGGGTCCGAGGAGAGGAAAGGCAT
LOC106396280TTCGGCGACTGTTGCTAATCGTCCTTTGAGCCAGGAGCC
LOC106434448GTACACATCCCGCATCACATCGATTCTTCAGGGGCTAACCTAT
LOC106439274CTCCACTAAGAACTGGGCCGTGGGTCGAATCTCTGCCTCT
LOC106439448CAACAAAGACAGTTGAAGGTCACTCGCATCTCCTTATACAGCCAC
Table 3. Effect of oil content and fatty acid contents in seeds at different altitudes.
Table 3. Effect of oil content and fatty acid contents in seeds at different altitudes.
Altitude/mC16:0C18:0C18:1C18:2C18:3C20:1C22:1Oil Content
18903.93 ± 0.230.90 ± 0.0260.39 ± 1.6821.59 ± 1.347.66 ± 0.481.92 ± 0.823.61 ± 1.6838.22 ± 0.05
WTSL21803.44 ± 0.280.90 ± 0.1660.71 ± 1.6621.42 ± 1.197.72 ± 0.522.78 ± 0.543.75 ± 0.3238.83 ± 0.65
CV/%9.400.000.370.560.5525.882.691.12
18902.89 ± 0.27 **2.02 ± 0.20 *47.13 ± 2.4422.19 ± 1.2910.18 ± 1.588.27 ± 1.543.97 ± 0.9740.82 ± 0.42
STSL21800.66 ± 0.560.86 ± 0.1948.90 ± 1.9823.97 ± 1.9810.26 ± 1.368.54 ± 2.018.50 ± 1.23 **44.95 ± 0.35 *
CV/%89.4956.960.340.670.552.2751.376.81
C16:0, C18:0, C18:1, C18:2, C18:3, C20:1, and C22:1 represent palmitic acid, stearic acid, oleic acid, linoleic acid, linolenic acid, arachidic acid, and erucic acid content, respectively, in WTSL and STSL seeds in the mature period. * and ** indicate significance at p ≤ 0.05 and p ≤ 0.01, respectively, under differential altitudes based on t-tests. CV/% = SD/Mean × 100%.
Table 4. Effect of oil content under different nighttime temperatures.
Table 4. Effect of oil content under different nighttime temperatures.
20/18 °C20/16 °C20/13 °C20/10 °C
WTSL33.99 ± 1.02 b34.00 ± 0.98 b35.44 ± 1.12 a37.00 ± 0.88 a
STSL38.93 ± 0.83 d41.00 ± 1.05 c44.36 ± 0.56 b46.05 ± 0.28 a
One-way analysis of variance (ANOVA) and Tukey’s post-hoc test were applied to evaluate the significance of differences in the development period as a function of different nighttime temperatures. Values with different lowercase letters were deemed to be statistically significant at p ≤ 0.05. Error values represent standard error of the mean (SEM). N = 3 for each mean.
Table 5. Numbers of DEGs related to respiration in the silique wall under LNT.
Table 5. Numbers of DEGs related to respiration in the silique wall under LNT.
KEGG Terms OSS18 vs. OSS13OFS18 vs. OFS13OTS18 vs. OTS13SSS18 vs. SSS13SFS18 vs. SFS13STS18 vs. STS13
UpDownUpDownUpDownUpDownUpDownUpDown
Citrate cycle (TCA cycle)222118181917222217171416
Glycolysis/Gluconeogenesis222117201718201918216557
Oxidative phosphorylation241717171718182020182917
Pentose phosphate pathway181817171717171917175331
Total86776972707077807273161121
Table 6. Changes of genes related of oil accumulation in seeds under low nighttime temperature.
Table 6. Changes of genes related of oil accumulation in seeds under low nighttime temperature.
OSE18 vs.
OSE13
OFE18 vs.
OFE13
OTE18 vs.
OTE13
SSE18 vs.
SSE13
SFE18 vs.
SFE13
STE18 vs.
STE13
SAD (LOC106372205)2.14 ± 0.121.64 ± 0.321.61 ± 0.200.72 ± 0.101.04 ± 0.150.79 ± 0.09
HAD (LOC106375927)1.79 ± 0.151.07 ± 0.211.87 ± 0.371.47 ± 0.180.33 ± 0.020.73 ± 0.11
KAS II (LOC106387251)2.40 ± 0.201.14 ± 0.091.28 ± 0.450.64 ± 0.210.68 ± 0.090.80 ± 0.16
FAD2 (LOC106434448)2.14 ± 0.353.68 ± 0.581.85 ± 0.790.82 ± 0.130.78 ± 0.131.02 ± 0.21
FAD3 (LOC106439274)0.68 ± 0.085.93 ± 0.881.61 ± 0.500.88 ± 0.090.59 ± 0.121.02 ± 0.09
KAR (LOC106439448)1.32 ± 0.058.91 ± 0.952.67 ± 0.650.87 ± 0.100.80 ± 0.150.42 ± 0.05
ECR (LOC106396280)1.77 ± 0.173.70 ± 0.422.50 ± 0.550.93 ± 0.110.73 ± 0.120.80 ± 0.08
Error values represent standard error of the mean (SEM). N = 3 for each mean.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Mi, C.; Zhao, Y.; Yang, X.; Lin, L.; Wang, J. Effect of Low Nighttime Temperature on Oil Accumulation of Rapeseed Seeds (Brassica napus L.) Based on RNA-Seq of Silique Wall Tissue. Agriculture 2025, 15, 576. https://doi.org/10.3390/agriculture15060576

AMA Style

Mi C, Zhao Y, Yang X, Lin L, Wang J. Effect of Low Nighttime Temperature on Oil Accumulation of Rapeseed Seeds (Brassica napus L.) Based on RNA-Seq of Silique Wall Tissue. Agriculture. 2025; 15(6):576. https://doi.org/10.3390/agriculture15060576

Chicago/Turabian Style

Mi, Chao, Yanning Zhao, Xuetao Yang, Liangbin Lin, and Jinxiong Wang. 2025. "Effect of Low Nighttime Temperature on Oil Accumulation of Rapeseed Seeds (Brassica napus L.) Based on RNA-Seq of Silique Wall Tissue" Agriculture 15, no. 6: 576. https://doi.org/10.3390/agriculture15060576

APA Style

Mi, C., Zhao, Y., Yang, X., Lin, L., & Wang, J. (2025). Effect of Low Nighttime Temperature on Oil Accumulation of Rapeseed Seeds (Brassica napus L.) Based on RNA-Seq of Silique Wall Tissue. Agriculture, 15(6), 576. https://doi.org/10.3390/agriculture15060576

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop