Effect of Low Nighttime Temperature on Oil Accumulation of Rapeseed Seeds (Brassica napus L.) Based on RNA-Seq of Silique Wall Tissue
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials Collection of Plant Material for Different Altitudes and Low Nighttime Temperature Treatments
2.2. Analysis of the Oil Content and Fatty Acid Content in the Two Rapeseed Cultivars
2.3. RNA Extraction, Illumina Sequencing, and Data Analysis
2.4. qRT-PCR Assays
2.5. Statistical Analysis
3. Results
3.1. The Effect of Different Altitudes on Oil and FA Contents
3.2. The Effects of Nighttime Temperature on Oil Content and Fatty Acid Contents of Seeds
3.3. Quality Analysis of the Transcriptome of Silique Wall Tissue Under Low Nighttime Temperature
3.4. KEGG Annotation of the DEGs in Silique Wall Under Low Nighttime Temperature
3.5. Expression Analysis of the DEGs Related to Respiration in Silique Wall Under Low Nighttime Temperature
3.6. Expression Analysis of the DEGs Related to Sucrose Transportation in the Silique Wall Under Low Nighttime Temperature
3.7. Expression Analysis of Glucose-Metabolizing Transcription Factor Genes in the Silique Wall Under Low Nighttime Temperature
3.8. Analysis of the Relative Expression of Genes Related to Oil Synthesis in Seeds
3.9. qRT-PCR Validation of the Transcriptome Data of the Silique Wall
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kang, W.; Dong, J.; Meng, Q.; Liang, X.; Xu, T.; Yang, Q.; Dong, Z. Correlation between meteorological factors and oil content in pod of Brassica napus L. J. Northwest AF Univ. (Nat. Sci. Ed.). 2016, 44, 97–103. (In Chinese) [Google Scholar] [CrossRef]
- Cong, R.; Zhang, Z.; Lu, J. Climate impacts on yield of winter oilseed rape in different growth regions of the Yangtze River Basin. Chin. J. Oil Crop Sci. 2019, 41, 894–903. (In Chinese) [Google Scholar] [CrossRef]
- Li, Z. In Silico Analysis of GDSL Genes in Arabidopsis and Brassica and the Investigation on Their Function in Seeds. Ph.D. Thesis, Zhejiang University, Hangzhou, China, 2014; p. 56. (In Chinese). [Google Scholar]
- Tian, Z.; Zhao, K.; Li, G.; Zhang, Y.; Li, Q.; Lu, Y.; Fu, M. Investigation and analysis of fertilization in rapeseed in Yunnan Province. Southwest China J. Agric. Sci. 2019, 32, 1586–1593. (In Chinese) [Google Scholar] [CrossRef]
- Liu, Z.; Sun, W.; Yang, N.; Wu, J.; Fang, Y.; Li, X.; Zeng, X.; Wang, Y. Variations in quality and agronomic traits of winter rapeseed (Brassica campestris L.) grown in different ecological regions. Agric. Res. Arid Areas 2015, 33, 49–58. (In Chinese) [Google Scholar] [CrossRef]
- Cao, X.; Liu, Z.; Mi, W.; Xu, C.; Zou, Y.; Xu, M.; Zheng, G.; Fang, X.; Cui, X.; Dong, X.; et al. Analysis on the adaptability of northward planting of Brassica napus. Sci. Agric. Sin. 2020, 53, 4164–4176. (In Chinese) [Google Scholar] [CrossRef]
- Li, H.; Wu, M.; Chao, H.; Yin, Y.; Xia, Y.; Cheng, X.; Chen, K.; Yan, S.; Wang, X.; Xiong, Y.; et al. A rare dominant allele DYSOC1 determines seed coat color and improves seed oil content in Brassica napus. Sci. Adv. 2025, 11, eads7620. [Google Scholar] [CrossRef]
- Fu, S.; Li, C.; Nima, Z.M.; Tang, L.; Qi, C. Effect of meteorological factors on oil accumulation in rapeseed. Chin. Bull. Bot. 2014, 49, 41–48. (In Chinese) [Google Scholar] [CrossRef]
- Mi, C.; Wang, Q.; Zhao, Y.N.; Zhang, C.L.; Sun, C.; Liu, Z.G.; Lin, L.B. Changes in the differentially expressed proteins and total fatty acid contents in winter rapeseed (Brassica rapa L.) leaves under drought stress. Russ. J. Plant Physiol. 2022, 69, 31. [Google Scholar] [CrossRef]
- Yang, J.; Wang, Q.; Zhang, C.; Bai, Y.; Zhang, Y.; Li, D.; Shang, H.; Lin, L. Effect of different high altitudes on the seed oil content and agronomic traits of Brassica napus L. J. Yunnan Agric. Univ. (Nat. Sci.) 2021, 36, 762–767. (In Chinese) [Google Scholar] [CrossRef]
- Zhou, L.; Yan, T.; Chen, X.; Li, Z.; Wu, D.; Hua, S.; Jiang, L. Effect of high night temperature on storage lipids and transcriptome changes in developing seeds of oilseed rape. J. Exp. Bot. 2018, 69, 1721–1733. [Google Scholar] [CrossRef]
- Mi, C.; Zhang, Y.; Zhao, Y.; Lin, L. Mechanisms of low nighttime temperature promote oil accumulation in Brassica napus L. based on in-depth transcriptome analysis. Physiol. Plant. 2024, 176, e14372. [Google Scholar] [CrossRef] [PubMed]
- Song, J.; Jiang, L.; Jameson, P.E. Expression patterns of Brassica napus genes implicate IPT, CKX, sucrose transporter, cell wall invertase, and amino acid permease gene family members in leaf, flower, silique, and seed development. J. Exp. Bot. 2015, 66, 5067–5082. [Google Scholar] [CrossRef] [PubMed]
- Mi, C.; Zhao, Y.; Lin, L.; Wang, J. Mechanism analysis of increased erucic acid content in Brassica napus L. seeds resulting low nighttime temperature. Gene. 2025, 936, 149119. [Google Scholar] [CrossRef]
- Zeng, L.; Han, X.; Gou, X.; Pei, H.; Shao, Y.; Cao, Y.; Zhang, Z.; Li, X.; Yu, J.; Yan, J.; et al. Leveraging phenotypic plasticity in seed oil content for climate-adapted breeding and production. Plant Cell Environ. 2025. [Google Scholar] [CrossRef]
- Srirangan, S.; Sauer, M.L.; Howard, B.; Dvora, M.; Dums, J.; Backman, P.; Sederoff, H. Interaction of temperature and photoperiod increases growth and oil content in the marine microalgae Dunaliella viridis. PLoS ONE 2015, 10, e0127562. [Google Scholar] [CrossRef]
- Hua, W.; Li, R.J.; Zhan, G.M.; Liu, J.; Li, J.; Wang, X.F.; Liu, G.H.; Wang, H.Z. Maternal control of seed oil content in Brassica napus: The role of silique wall photosynthesis. Plant J. 2012, 69, 432–444. [Google Scholar] [CrossRef]
- Liu, J.; Hua, W.; Yang, H.; Guo, T.; Sun, X.; Wang, X.; Liu, G.; Wang, H. Effects of specific organs on seed oil accumulation in Brassica napus L. Plant Sci. 2014, 227, 60–68. [Google Scholar] [CrossRef]
- Elferjani, R.; Soolanayakanahally, R. Canola responses to drought, heat, and combined stress: Shared and specific effects on carbon assimilation, seed yield, and oil composition. Front. Plant Sci. 2018, 9, 1224. [Google Scholar] [CrossRef]
- Yu, E.; Fan, C.; Yang, Q.; Li, X.; Wan, B.; Dong, Y.; Wang, X.; Zhou, Y. Identification of heat responsive genes in Brassica napus siliques at the seed-filling stage through transcriptional profiling. PLoS ONE 2014, 9, e101914. [Google Scholar] [CrossRef]
- Mi, C.; Sun, C.; Yuan, Y.; Li, F.; Wang, Q.; Zhu, H.; Hua, S.; Lin, L. Effects of low nighttime temperature on fatty acid content in developing seeds from Brassica napus L. based on RNA-seq and metabolome. Plants 2023, 12, 325. [Google Scholar] [CrossRef]
- Wu, X.L.; Liu, Z.H.; Hu, Z.H.; Huang, R.Z. BnWRI1 coordinates fatty acid biosynthesis and photosynthesis pathways during oil accumulation in rapeseed. J. Integr. Plant Biol. 2014, 56, 582–593. [Google Scholar] [CrossRef] [PubMed]
- Laudencia-Chingcuanco, D.; Ganeshan, S.; You, F.; Fowler, B.; Chibbar, R.; Anderson, O. Genome-wide gene expression analysis supports a developmental model of low temperature tolerance gene regulation in wheat (Triticum aestivum L.). BMC Genom. 2011, 12, 299. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Yang, Q.; Fan, C.; Zhao, X.; Wang, X.; Zhou, Y. Transcriptomic basis of functional difference and coordination between seeds and the silique wall of Brassica napus during the seed-filling stage. Plant Sci. 2015, 233, 186–199. [Google Scholar] [CrossRef] [PubMed]
- Mácová, K.; Prabhullachandran, U.; Štefková, M.; Spyroglou, I.; Pěnčík, A.; Endlová, L.; Novák, O.; Robert, H.S. Long-term high-temperature stress impacts on embryo and seed development in Brassica napus. Front. Plant Sci. 2022, 13, 844292. [Google Scholar] [CrossRef]
- Hammac, W.A.; Maaz, T.M.; Koenig, R.T.; Burke, I.C.; Pan, W.L. Water and Temperature stresses impact canola (Brassica napus L.) fatty acid, protein, and yield over nitrogen and sulfur. J. Agric. Food Chem. 2017, 65, 10429–10438. [Google Scholar] [CrossRef]
- Xu, P.; Zhang, W.; Wang, X.; Zhu, Y.; Liang, W.; He, Y.; Yu, X. Multiomics analysis reveals a link between Brassica-specific miR1885 and rapeseed tolerance to low temperature. Plant Cell Environ. 2023, 46, 3405–3419. [Google Scholar] [CrossRef]
- Manju Devi, S.; Joel, J.A.; Raveendran, M.; Pushpam, R.; Muthuramu, S.; Pushpa, R.; Suresh, R. Unravelling population structure and marker trait association using SSR markers among the identified drought tolerant rice landraces (Oryza sativa L.). Czech J. Genet. Plant Breed. 2025, 61, 1–22. [Google Scholar] [CrossRef]
- Gao, X.; Ma, J.; Tie, J.; Li, Y.; Hu, L.; Yu, J. BR-mediated protein S-nitrosylation alleviated low-temperature stress in mini Chinese cabbage (Brassica rapa ssp. pekinensis). Int. J. Mol. Sci. 2022, 23, 10964. [Google Scholar] [CrossRef]
- He, Q.; Ren, Y.; Zhao, W.; Li, R.; Zhang, L. Low temperature promotes anthocyanin biosynthesis and related gene expression in the seedlings of purple head Chinese cabbage (Brassica rapa L.). Genes 2020, 11, 81. [Google Scholar] [CrossRef]
- Dai, Y.; Sun, X.; Wang, C.; Li, F.; Zhang, S.; Zhang, H.; Li, G.; Yuan, L.; Chen, G.; Sun, R.; et al. Gene co-expression network analysis reveals key pathways and hub genes in Chinese cabbage (Brassica rapa L.) during vernalization. BMC Genom. 2021, 22, 236. [Google Scholar] [CrossRef]
- Zhang, B.; Hu, Z.; Zhang, Y.; Li, Y.; Zhou, S.; Chen, G. A putative functional MYB transcription factor induced by low temperature regulates anthocyanin biosynthesis in purple kale (Brassica oleracea var. acephala f. tricolor). Plant Cell Rep. 2012, 31, 281–289. [Google Scholar] [CrossRef] [PubMed]
- Yuan, L.; Wang, J.; Xie, S.; Zhao, M.; Nie, L.; Zheng, Y.; Zhu, S.; Hou, J.; Chen, G.; Wang, C. Comparative proteomics indicates that redox homeostasis is involved in high- and low-temperature stress tolerance in a novel wucai (Brassica campestris L.) genotype. Int. J. Mol. Sci. 2019, 20, 3760. [Google Scholar] [CrossRef] [PubMed]
- Luo, T.; Xian, M.; Zhang, C.; Zhang, C.; Hu, L.; Xu, Z. Associating transcriptional regulation for rapid germination of rapeseed (Brassica napus L.) under low temperature stress through weighted gene co-expression network analysis. Sci. Rep. 2019, 9, 55. [Google Scholar] [CrossRef] [PubMed]
- Hussain, A.; Qayyum, A.; Farooq, S.; Almutairi, S.M.; Rasheed, R.A.; Qadir, M.; Vyhnánek, T.; Sun, Y. Pepper immunity against Ralstonia solanacearum is positively regulated by CaWRKY3 through modulation of different WRKY transcription factors. BMC Plant Biol. 2024, 24, 522. [Google Scholar] [CrossRef]
- Julia, J.W.; Alessia, P.; Berend, S.; Johannes, H.; Sjef, C.S. ABI4: Versatile activator and repressor. Trends Plant Sci. 2013, 18, 125–132. [Google Scholar]
- Gao, M.J.; Li, X.; Lui, H.; Gropp, G.M.; Lydiate, D.D.; Wei, S. ASIL1 is required for proper timing of seed filling in Arabidopsis. Plant Signal Behav. 2011, 6, 1886–1888. [Google Scholar] [CrossRef]
- Moghaddas, S.H.; Hamzeh-Mivehroud, M.; Silva, A.P.; Walshe, J.L.; Mohammadi, S.A.; Rahbar-Shahrouziasl, M.; Abbasi, M.; Jamshidi, O.; Low, J.K.; Dastmalchi, S.; et al. Expression, purification and DNA-binding properties of zinc finger domains of DOF proteins from Arabidopsis thaliana. Bioimpacts. 2018, 8, 167–176. [Google Scholar] [CrossRef]
- Ge, S.X.; Son, E.W.; Yao, R. iDEP: An integrated web application for differential expression and pathway analysis of RNA-seq data. BMC Bioinform. 2018, 19, 534. [Google Scholar] [CrossRef]
- Huang, H.H. Sucrose and ABA Regulate Starch Biosynthesis in Maize Endosperm Through Transcription Factors, ZmEREB156 and ZmEREB17. Ph.D. Thesis, Sichuan Agricultural University, Chengdu, China, 2016; p. 56. [Google Scholar]
- Wang, J.; Wang, Y.; Zhang, J.; Ren, Y.; Li, M.; Tian, S.; Yu, Y.; Zuo, Y.; Gong, G.; Zhang, H.; et al. The NAC transcription factor ClNAC68 positively regulates sugar content and seed development in watermelon by repressing ClINV and ClGH3.6. Hortic. Res. 2021, 8, 214. [Google Scholar] [CrossRef]
- Papi, M.; Sabatini, S.; Altamura, M.M.; Hennig, L.; Schäfer, E.; Costantino, P.; Vittorioso, P. Inactivation of the phloem-specific Dof zinc finger gene DAG1 affects response to light and integrity of the test of Arabidopsis seeds. Plant Physiol. 2002, 128, 411–417. [Google Scholar] [CrossRef]
- Kang, X.; Huang, S.; Feng, Y.; Fu, R.; Tang, F.; Zheng, L.; Li, P.; Chao, N.; Liu, L. SWEET transporters and their potential roles in response to abiotic and biotic stresses in mulberry. Beverage Plant Res. 2023, 3, 6. [Google Scholar] [CrossRef]
- Lou, G.; Alam Bhat, M.; Tan, X.; Wang, Y.; He, Y. Research progress on the relationship between rice protein content and cooking and eating quality and its influencing factors. Seed Bio. 2023, 2, 16. [Google Scholar] [CrossRef]
- Tang, J.; Wang, N.; Gao, J.; Liu, T.; Wen, J.; Yi, B.; Tu, J.; Fu, T.; Shen, J. Bioinformatics analysis of SnRK gene family and its relation with seed oil content of Brassica napus L. Acta Agron. Sin. 2021, 47, 416–426. (In Chinese) [Google Scholar] [CrossRef]
- Zhang, F.; Gao, X.; Zhang, J.; Liu, B.; Zhang, H.; Xue, J.; Li, R. Seed-specific expression of heterologous gene DGAT1 increases soybean seed oil content and nutritional quality. Chin. J. Biotechnol. 2018, 34, 1478–1490. (In Chinese) [Google Scholar] [CrossRef]
- Pavón-Suriano, S.G.; Ortega-Clemente, L.A.; Curiel-Ramírez, S.; Jiménez-García, M.I.; Pérez-Legaspi, I.A.; Robledo-Narváez, P.N. Evaluation of colour temperatures in the cultivation of Dunaliella salina and Nannochloropsis oculata in the production of lipids and carbohydrates. Environ. Sci. Pollut. Res. Int. 2018, 25, 21332–21340. [Google Scholar] [CrossRef]
- Guo, Y.L. Genetic Analysis of Seed Oil Content and Function Analysis of Genes Involved in Lipid Biosynthesis in Brassica napus L. Ph.D. Thesis, Huazhong Agricultural University, Wuhan, China, 2017; p. 43. (In Chinese). [Google Scholar]
- Kong, X.D. Transcriptome Analysis of Brassica napus Pod Using RNA-Seq and Identification of Lipid-Related Candidate Genes. Master’s Thesis, Zhejiang University, Hangzhou, China, 2015; p. 3. (In Chinese). [Google Scholar]
- Woodfield, H.K.; Fenyk, S.; Wallington, E.; Bates, R.E.; Brown, A.; Guschina, I.; Marillia, E.; Taylor, D.C.; Fell, D.; Harwood, J.L.; et al. Increase in lysophosphatidate acyltransferase activity in oilseed rape (Brassica napus) increases seed triacylglycerol content despite its low intrinsic flux control coefficient. New Phytol. 2019, 224, 700–711. [Google Scholar] [CrossRef]
- Ye, Y.; Nikovics, K.; To, A.; Lepiniec, L.; Fedosejevs, E.; Van Doren, S.; Baud, S.; Thelen, J. Docking of acetyl-CoA carboxylase to the plastid envelope membrane attenuates fatty acid production in plants. Nat. Commun. 2020, 11, 6191. [Google Scholar] [CrossRef]
- Liu, F.; Xia, Y.; Wu, L.; Fu, D.; Hayward, A.; Luo, J.; Yan, X.; Xiong, X.; Fu, P.; Wu, G. Enhanced seed oil content by overexpressing genes related to triacylglyceride synthesis. Gene 2015, 557, 163–171. [Google Scholar] [CrossRef]
Altitude (m) | Latitude (°) | Average Daytime Temperature (°C) | Average Nighttime Temperature (°C) | Extreme High- Temperature (°C) | Extreme Low- Temperature (°C) | Precipitation (mm) | Sunshine Duration (h/Year) | Evaporation (mm) |
---|---|---|---|---|---|---|---|---|
1890 | 25.10 | 15 | 10.9 | 21.5 | 1.6 | 150 | 1025 | 598 |
2180 | 25.11 | 13 | 5.1 | 16.7 | 0.2 | 167 | 1027 | 581 |
Gene | Forward Primer (5’ to 3’) | Reverse Primer (3’ to 5’) |
---|---|---|
BnACTIN7 | CCCTGGAATTGCTGACCGTA | TGGAAAGTGCTGAGGGATGC |
LOC106357816 | GCGGAAGATCAACGGAAACG | GTCGGATTCTCCCCCTTTCAA |
LOC106421663 | CGCGTGTAGCCGCTTAGATA | AGTGTCTAACGTGACGGAGT |
LOC106435356 | GAAAACGAGAACTTTGCTTGATG | AGAAGAGGATTACAGCGGCG |
LOC106426279 | TGGGTGAAATTTATGCAGGTCA | GGTGAGGTTCTGTGGGAAGG |
LOC106357816 | ACGAACAATCCAAGTTTATCGGC | ACGTCCATAAAGAAGCGCCA |
LOC106372205 | GGACTCGAAACTAGCGCAGA | AACAGATTGTCATCTCGGCCA |
LOC106375927 | TCATACGCAACAAGCGACC | GCTACAGCTGAAACACCAGG |
LOC106387251 | ATACCCGTCAAGCCTTTGGG | TCCGAGGAGAGGAAAGGCAT |
LOC106396280 | TTCGGCGACTGTTGCTAATC | GTCCTTTGAGCCAGGAGCC |
LOC106434448 | GTACACATCCCGCATCACAT | CGATTCTTCAGGGGCTAACCTAT |
LOC106439274 | CTCCACTAAGAACTGGGCCG | TGGGTCGAATCTCTGCCTCT |
LOC106439448 | CAACAAAGACAGTTGAAGGTCAC | TCGCATCTCCTTATACAGCCAC |
Altitude/m | C16:0 | C18:0 | C18:1 | C18:2 | C18:3 | C20:1 | C22:1 | Oil Content | |
---|---|---|---|---|---|---|---|---|---|
1890 | 3.93 ± 0.23 | 0.90 ± 0.02 | 60.39 ± 1.68 | 21.59 ± 1.34 | 7.66 ± 0.48 | 1.92 ± 0.82 | 3.61 ± 1.68 | 38.22 ± 0.05 | |
WTSL | 2180 | 3.44 ± 0.28 | 0.90 ± 0.16 | 60.71 ± 1.66 | 21.42 ± 1.19 | 7.72 ± 0.52 | 2.78 ± 0.54 | 3.75 ± 0.32 | 38.83 ± 0.65 |
CV/% | 9.40 | 0.00 | 0.37 | 0.56 | 0.55 | 25.88 | 2.69 | 1.12 | |
1890 | 2.89 ± 0.27 ** | 2.02 ± 0.20 * | 47.13 ± 2.44 | 22.19 ± 1.29 | 10.18 ± 1.58 | 8.27 ± 1.54 | 3.97 ± 0.97 | 40.82 ± 0.42 | |
STSL | 2180 | 0.66 ± 0.56 | 0.86 ± 0.19 | 48.90 ± 1.98 | 23.97 ± 1.98 | 10.26 ± 1.36 | 8.54 ± 2.01 | 8.50 ± 1.23 ** | 44.95 ± 0.35 * |
CV/% | 89.49 | 56.96 | 0.34 | 0.67 | 0.55 | 2.27 | 51.37 | 6.81 |
20/18 °C | 20/16 °C | 20/13 °C | 20/10 °C | |
---|---|---|---|---|
WTSL | 33.99 ± 1.02 b | 34.00 ± 0.98 b | 35.44 ± 1.12 a | 37.00 ± 0.88 a |
STSL | 38.93 ± 0.83 d | 41.00 ± 1.05 c | 44.36 ± 0.56 b | 46.05 ± 0.28 a |
KEGG Terms | OSS18 vs. OSS13 | OFS18 vs. OFS13 | OTS18 vs. OTS13 | SSS18 vs. SSS13 | SFS18 vs. SFS13 | STS18 vs. STS13 | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Up | Down | Up | Down | Up | Down | Up | Down | Up | Down | Up | Down | |
Citrate cycle (TCA cycle) | 22 | 21 | 18 | 18 | 19 | 17 | 22 | 22 | 17 | 17 | 14 | 16 |
Glycolysis/Gluconeogenesis | 22 | 21 | 17 | 20 | 17 | 18 | 20 | 19 | 18 | 21 | 65 | 57 |
Oxidative phosphorylation | 24 | 17 | 17 | 17 | 17 | 18 | 18 | 20 | 20 | 18 | 29 | 17 |
Pentose phosphate pathway | 18 | 18 | 17 | 17 | 17 | 17 | 17 | 19 | 17 | 17 | 53 | 31 |
Total | 86 | 77 | 69 | 72 | 70 | 70 | 77 | 80 | 72 | 73 | 161 | 121 |
OSE18 vs. OSE13 | OFE18 vs. OFE13 | OTE18 vs. OTE13 | SSE18 vs. SSE13 | SFE18 vs. SFE13 | STE18 vs. STE13 | |
---|---|---|---|---|---|---|
SAD (LOC106372205) | 2.14 ± 0.12 | 1.64 ± 0.32 | 1.61 ± 0.20 | 0.72 ± 0.10 | 1.04 ± 0.15 | 0.79 ± 0.09 |
HAD (LOC106375927) | 1.79 ± 0.15 | 1.07 ± 0.21 | 1.87 ± 0.37 | 1.47 ± 0.18 | 0.33 ± 0.02 | 0.73 ± 0.11 |
KAS II (LOC106387251) | 2.40 ± 0.20 | 1.14 ± 0.09 | 1.28 ± 0.45 | 0.64 ± 0.21 | 0.68 ± 0.09 | 0.80 ± 0.16 |
FAD2 (LOC106434448) | 2.14 ± 0.35 | 3.68 ± 0.58 | 1.85 ± 0.79 | 0.82 ± 0.13 | 0.78 ± 0.13 | 1.02 ± 0.21 |
FAD3 (LOC106439274) | 0.68 ± 0.08 | 5.93 ± 0.88 | 1.61 ± 0.50 | 0.88 ± 0.09 | 0.59 ± 0.12 | 1.02 ± 0.09 |
KAR (LOC106439448) | 1.32 ± 0.05 | 8.91 ± 0.95 | 2.67 ± 0.65 | 0.87 ± 0.10 | 0.80 ± 0.15 | 0.42 ± 0.05 |
ECR (LOC106396280) | 1.77 ± 0.17 | 3.70 ± 0.42 | 2.50 ± 0.55 | 0.93 ± 0.11 | 0.73 ± 0.12 | 0.80 ± 0.08 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mi, C.; Zhao, Y.; Yang, X.; Lin, L.; Wang, J. Effect of Low Nighttime Temperature on Oil Accumulation of Rapeseed Seeds (Brassica napus L.) Based on RNA-Seq of Silique Wall Tissue. Agriculture 2025, 15, 576. https://doi.org/10.3390/agriculture15060576
Mi C, Zhao Y, Yang X, Lin L, Wang J. Effect of Low Nighttime Temperature on Oil Accumulation of Rapeseed Seeds (Brassica napus L.) Based on RNA-Seq of Silique Wall Tissue. Agriculture. 2025; 15(6):576. https://doi.org/10.3390/agriculture15060576
Chicago/Turabian StyleMi, Chao, Yanning Zhao, Xuetao Yang, Liangbin Lin, and Jinxiong Wang. 2025. "Effect of Low Nighttime Temperature on Oil Accumulation of Rapeseed Seeds (Brassica napus L.) Based on RNA-Seq of Silique Wall Tissue" Agriculture 15, no. 6: 576. https://doi.org/10.3390/agriculture15060576
APA StyleMi, C., Zhao, Y., Yang, X., Lin, L., & Wang, J. (2025). Effect of Low Nighttime Temperature on Oil Accumulation of Rapeseed Seeds (Brassica napus L.) Based on RNA-Seq of Silique Wall Tissue. Agriculture, 15(6), 576. https://doi.org/10.3390/agriculture15060576