Abstract
Phlorotannins are phenolic compounds existing in large amounts in Phaeophyta, with this amount differing according to the season and collection area. There are many pharmacological properties of phlorotannins, such as being antioxidant, antidiabetic, and anti-cancer. In this work, phlorotannins from the Phaeophyta Sargassum linifolium were extracted, characterized, and identified, for use as an antioxidant and an anti-diabetic in a streptozotocin-induced diabetes rat model. Phlorotanins were characterized using ultraviolet (UV) and Fourier transform infrared (FT-IR) analysis, dimethoxy benzaldehyde assay (DMBA), and Folin–Ciocalteu assays. Groups of rats were tested as follows: normal control (negative control) (G1), normal rats treated with 60 mg/kg body weight of phlorotannins (G2), positive control diabetic rats injected with one dose of streptozotocin (G3), and a diabetic group treated with phlorotannins at 60 mg kg−1 body weight (G4). The biochemical parameters were determined after 4 weeks of treatment. The results demonstrated that the extracted compound was a phlorotannin, which had antioxidant properties. An in vivo study confirmed that the glucose and insulin levels in G4 were relatively similar to those in the normal control G1. The glucosidase, alpha-amylase, glutathione, and catalase levels were 0.11 ± 0.097, 420.5 ± 13, 11.27 ± 3.3, and 8.01 ± 1.31 µmol/min/g in G1, and 0.04 ± 0.016, 184.75 ± 55.24, 12.78 ± 2.1, and 11.28 ± 1.74 µmol/min/g) in G4, respectively. There were no side effects in the kidney function of both G2 and G4, and the levels of cholesterol and triglyceride were also normal. The results demonstrated that phlorotannins have antioxidant properties in vivo and that the diabetic rats had an activated AMPK expression. According to the histological analysis, phlorotannins improved the islet size and reversed necrotic and fibrotic alterations in the pancreas. The results of the present study suggest the use of phlorotannins derived from Sargassum linifolium as an antioxidant and anti-diabetic for an in vivo study. They could be used in developing medicinal preparations for treating diabetes and its related symptoms.
1. Introduction
Diabetes mellitus (DM) is a disorder that results in various negative consequences. A dangerous illness, diabetes mellitus (DM) results in continuous hyperglycemia, due to a partial or complete loss of insulin production or activity [1]. Free glucose builds up in the blood, causing hyperglycemia. When free glucose is absent from cells, the lipids and proteins are reduced, and free radicals are produced, as a result of the autoxidation of lipids and the glycosylation of proteins [2]. Approximately 463 million people are thought to have diabetes globally, and by 2045, this number might reach 700 million [3]. Due to lifestyle modifications brought on by rapid urbanization, diabetes mellitus is the metabolic illness that causes the third most deaths globally [4]. Injections of insulin and oral anti-diabetic medications are the main treatments currently available for managing DM. However, regular use of synthetic medications has many negative side effects and results in reduced healing [5]. Due to the undesirable side effects of the currently available anti-diabetic drugs, the quest for an effective natural anti-diabetic therapy is essential for combating diabetes and its accompanying consequences. Therefore, alongside creating natural therapies, it is essential to research the potential benefits of seaweed for the management of type 2 diabetes [4]. Phlorotannins are polyphenolic chemicals produced when phloroglucinol is polymerized and are frequently isolated from brown algae [6]. Brown algae have a high concentration of phlorotannins chemicals, which have a range of biological effects, including algicidal, antioxidant [7], anti-inflammatory, antidiabetic, and anticancer properties [8]. Phlorotannins can be obtained from macroalgae and microalgae, “some algae” can form phlorotannins through quorum sensing inhibition and protect themselves against surface-combined bacteria [9]. Phlorotannins can be synthesized in the endoplasmic reticulum (ER) and subsequently transported to the Golgi for additional processing. Phlorotannins are typically present in soluble form in algal cells [10]. The phlorotannin content forms up to approximately 25% of brown algal dry weight [11]. Sargassum species contains bioactive substances, including phenolic compounds, that may have antioxidant activity [12]. For the isolation of antioxidant complexes, specifically phlorotannins, for dietary and medicinal use, Sargassum angustifolium was found to be the best choice [13]. An acetone extract of brown algae possessed antioxidant and anti-diabetic actions in vivo and in vitro [14,15]. Phlorotannins recovered from brown algae varied depending on the species, region, and thallus zone [16]. Phlorotannins varied quantitatively and qualitatively according to the season [17]. Numerous studies have dealt with the role of phlorotannins extracted from Sargassum as an antidiabetic, but studies reporting the role of phlorotannins from Sargassum linifolium species collected from the region of the Gulf Suez, Sinia are lacking. This study also extended the investigation of phlorotannins’ effects to all biochemical and histological parameters of STZ-induced diabetic rats. Therefore, the study aimed to evaluate the efficiency of phlorotannins extracted from S. linifolium collected from Gulf Suez, Sinia, as an antioxidant and anti-diabetic in vitro and in vivo.
2. Materials and Methods
2.1. Studied Brown Alga
Brown alga Sargassum linifolium was collected from Ras Sidr Coast on the Gulf of Suez, Sinia, Egypt, during the summer of 2019. The alga was washed with tap water and dried at an ambient temperature of 30 ± 1 °C, followed by drying in an electric oven at 50 °C. The alga was identified according to Aleem [18] and Jha et al. [19].
2.2. Phlorotannins Extraction
First, 5 mL of hexane was added to 1 g fine powdered seaweed 5 times in a magnetic stirrer for 5 min to remove fat, followed by centrifuging at 3500 rpm each time for 3 min. To eliminate all traces of hexane, the algae material was kept in the dissector for two hours. To stop oxidation, ascorbic acid (0.3% w/v) and 50 mL of 70% acetone were combined with the hexane-free algae material. Next, the mixture was centrifuged for 6 min at 3500 rpm. Each of the previous stages were repeated for 4 h. The liquid elements of the extraction were assembled. The remaining water was centrifuged at 3500 rpm for 15 min, then the acetone was removed in a dissector, followed by lyophilizing [20].
2.3. Characterization of Extracted Phlorotannins
The extracted phlorotannins were characterized using a Fourier transform infrared (FT-IR) spectrophotometer (JASCO FT/IR 4100 LE, Hachioji, Japan; at the range: 400–4000 cm−1) and ultraviolet spectroscopy analysis (Labomed Inc. Spectro UV-VIS Double Beam PC, Scanning Spectrophotometer, model UVD-2950, Los Angeles, CA, USA); the phlorotannin concentration was 25 mg/mL of distilled water (weight 4 mg phlorotannin: 4 mL d.w), and the UV area was between 200 and 400 nm. The phlorotannins were also characterized with a dimethoxy benzaldehyde assay (DMBA) using the method of Stern et al. [21]. Stock solutions of DMBA (2 g/100 mL glacial acetic acid) and 16.0 mL concentrated hydrochloric acid per 100.0 mL glacial acetic acid were prepared and kept at room temperature before starting the assay. The working reagent was made fresh. Then, 10 mg of algal extract was dissolved in 1 ml methanol, different volumes of extract stock (0–20 µL) were taken in test tubes, and methanol was added to make a total volume of 20 µL in each test tube. Next, 10 µL of N, N dimethylformamide (DMF) was added to each tested sample to precipitate the protein. HCl reagent at 1.25 mL was mixed with 1.25 mL of DMBA reagent and added to each tested sample. The sample was placed in a 30 °C water bath and covered; after 60 min, the absorbance was recorded at 510 nm. The total phlorotannins content was determined using a linear equation based on the calibration curve of phloroglucinol as a standard. A Folin–Ciocalteu assay was performed, using the method illustrated by Esmaeilzadeh et al. [22].
2.3.1. Antioxidant Activity of Phlorotannins In Vitro
Two methods were used to determine the antioxidant activity in vitro: the first method used 2,2-diphenyl-1-picrylhydrazyl (DPPH) [23]. The second method utilized 2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid (ABTS). [24]
2.3.2. Determination of the Cytotoxicity of Phlorotannins with MTT Assay
Approximately 1 × 104 cells/mL of the human prostatic stromal myofibroblast normal cell line (WPMY-1), which was obtained from the Vecsera Company, Cairo, Egypt, were seeded into 96-well cell culture plates, where they were incubated for 24 h under standard conditions. The cells were exposed to seaweed extracts at various doses, ranging from 250 to 1000 g/mL. After a 48 h incubation period, the medium was withdrawn from the plates, and 5 mg/mL of the MTT reagent (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) was added. After that, the plates were incubated for an additional 3 to 4 h. The formazan crystals were dissolved in 100 mL of acidified isopropanol, and the findings were analyzed at 630 nm using an ELISA microplate reader (Bio-RAD microplate reader, Tokyo, Japan). Each concentration was repeated three times.
Cell viability (%) = (Ab with sample/Ab without sample) 100;
2.4. Experimental Animals
Forty white albino male Wistar rats weighing 200–240 g were bought from the Faculty of Agriculture, Center for Experimentation and Agricultural Research, Zagazig University, Egypt. Rats were kept in cages (four to six rats per cage), in a well-ventilated environment, at an appropriate temperature, with a 12 h light/dark cycle, and fed a pellet-concentrated diet. Rats were given two weeks to acclimatize to the laboratory environment prior to experimentation.
The Ethical Committee (ICUC) of the Faculty of Science, Tanta University (FSTU), approved the handling of animals under the certification code Rec-Sci-Tu-0028, 2017.
2.4.1. Diabetes Induction
Rats were given free access to water after 18 h fasting. A single intraperitoneal (I.P.) injection of freshly made streptozotocin (STZ) solution mixed in 0.1 M citrate buffer, pH 4.5, was used to induce diabetes in the rats [25]. After a week, rats that had received STZ were given a 12 h fast, before blood was drawn from the orbital venous sinus to measure glucose levels. Rats in the diabetic group were classified as diabetic if their blood glucose levels were higher than 250 mg/dL [26].
2.4.2. Animal Groups
Rats were split into four groups.
Group 1 (G.I) was the standard control group. No medications were administered to healthy normal rats, who served as the standard control for all experimental groups (CN).
Group 2 (G.II): The control untreated group received daily phlorotannins from S. linifolium extract at a dose of 60 mg/kg body weight. The control group for diabetics was Group 3 (G.III) (a single intraperitoneal STZ dose of 60 mg kg−1 body weight produced diabetic rats) (CD). The diabetic group, Group 4 (G.IV), received daily treatment for 4 weeks with phlorotannins from S. linifolium extract (60 mg/kg body weight) [27]. Following an overnight fast, all rats received an oral dose of phlorotannin extract (60 mg/kg body weight/day), thirty days after the onset of diabetes.
At the end of the experimental period, rats were anesthetized by cervical dislocation under sodium pentobarbital (300 mg/kg) given intraperitoneally. Blood samples were withdrawn from all experimental rats from the ocular vein, after overnight fasting. Blood samples were centrifuged for 15 min at 3000 rpm, to obtain the serum. The clean and clear serum was put into plastic tubes with labels and stored at −4 °C, until being used for biochemical assays. After euthanasia of the rats, the small intestine, liver, skeletal muscle, and pancreatic tissue samples were collected.
2.4.3. Biochemical Parameters
The serum glucose was investigated enzymatically using Spectrum diagnostics, Egypt (Kits), according to the method of Wu [28]. Serum insulin was determined with an ultrasensitive rat insulin ELISA kit (Biorad-680, BIORAD Ltd., Osaka, Japan) [28]. The amylase measurement followed the procedures of Winn-Deen et al., as described in [29]. Glucosidase enzyme was determined in homogenized rat intestines according to the methods of Thilagam et al. [30]. Serum triacylglycerol and total cholesterol were determined using a spectrum diagnostics kit in Egypt, according to the methods of Stein [21]. The kidney function represented by urea and creatinine in serum was determined using a diagnostics kit in Egypt according to Wu [28]; Tietz [31]. Hepatic MDA was determined in homogenate liver tissues according to the methods of Stein [32]. Using 0.5 mL of 20% TCA and 1 mL of 0.67% thiobarbituric acid, the absorbance was measured at 530 nm. The hepatic catalase activity was investigated in homogenate liver tissues by adding 10 mL of the homogenate to 160 mL 30% H2O2, in addition to 100 mL 0.067 M phosphate buffer pH 7, the H2O2 consumed within 60 s was investigated spectrophotometry at 250 nm [33]. Glutathione was determined in homogenate liver tissues using a GSH kit, according to the methods of [34]. The residual H2O2 in liver tissues representing the total antioxidant capacity was determined according to the method in [35].
2.4.4. Quantitative Real-Time RT-PCR for AMP-Activated Protein Kinase
AMPK activity was measured using RT- PCR at the Bioresearch unit, Central Lab of Tanta University. The primer design was from the gene bank of the National Center for Biotechnology Information (NCBI), with primer of AMPKα2 (Prkaa2-mRNA) of forward (GAAGATCGGACACTACGTGC) and reverse (AGTCCACGGCAGACAGAATC). The purity and quantity of RNA were estimated using a Nanodrop instrument [36].
2.4.5. Histological Examination
All animal groups had their pancreatic tissue frozen in 10% neutral formalin for one day. A procedure of embedding the specimens in paraffin wax was used. After that, pieces were sliced to a thickness of 5 m and stained with hematoxylin and eosin [2].
2.5. Statistical Analysis
All data are presented as averages with standard deviations (SD) based on three replicates and probability values (p ≤ 0.05). Duncan techniques and one-way ANOVA were used to evaluate the data.
3. Results and Discussion
3.1. UV Spectrophotometer
Figure 1 displays the UV-visible spectrum of the phlorotannin extracts from S. linifolium. The results show the wavelength at 295 nm, which proved that the extract was a phenol compound; in particular, a phlorotannin. Phlorotannins can donate to the absorption in the UV-visible spectrum ranging from 280 to 320 nm [37].
Figure 1.
The ultraviolet spectrum of the phlorotannin extract from S. linifolium marine alga.
3.2. FT-IR Spectroscopy Analysis
The results in Table 1 and Figure 2 show the FT-IR spectrum analysis of phlorotannins extracts from S. linifolium marine alga, which was established using the functional groups that appeared in the FT-IR spectrum analysis. Bands appeared at the wavenumbers 3352, 2936, 1771, 1407, 1208, and 1037 cm−1, related to the (OH), (C-H) alkyl group, (C=O), methyl groups, C-O, and C-OH, respectively. The active groups detected using FT-IR confirmed the compound present in S. linifolium that was identified by UPLC/MS and proved that the compound was a phlorotannin, as also confirmed in a previously published work by Kamal et al. [38], who also confirmed the presence of Carmalol derivatives, Dihydroxy pentafuhalol, Trihydroxy Hexafuhalol, Hydroxy tetrafuhalol, and Phlorotannis-7 phloroglucinol.
Table 1.
FT-IR spectroscopy analysis of the phlorotannins extracted from S. linifolium.
Figure 2.
The FT-IR spectrum of phlorotannins extract from S. linifolium marine alga.
3.3. Determination of Total Phlorotannins Content by DMBA Assay
The results in Table 2 show the quantitative phlorotannins and total phenol content extracted from S. linifolium determined with DMBA and Folin–Ciocalteu reagent, respectively. The amount of phlorotannins was 10.087 g/g extract, about 10% of dry weight; meanwhile, the total phenol content was 22.19 ± 3.42 mg/g GA. The phlorotannins were quantitatively analyzed with DMBA and compared to phloroglucinol. The findings concurred with the following published studies: The total phenolic content of Sargassum fillicinum and Sargassum yendoi was 20.57 to 88.97 mg GA/g DW [45]. For a cytoplasmic and membrane extract of brown alga Sargassum sp., the total phenolic compounds ranged from 0.006–0.65 and 6.72–21.99 g phloroglucinol/g100 DW, respectively [46]. The phenolic content in Sargassum duplicatum, Sargassum crassifolium, and Sargassum. polycistummg was 24, 21, and 19 mg GA/g dw [47]. The total phlorotannin content extracted from Sargassum fusiforme was 88.48 ± 0.30 mg PGE/100 mg extract, which represents the maximum phlorotannin content and highest antioxidant activity [48]. The lowest amount of phlorotannin content was found in Sargassum dupplicatum 4.45 ± 0.11 mg phloroglucinol/g DW [49].
Table 2.
Total phenolic and phlorotannin content of S. linifolium brown alga.
3.4. Antioxidant Activity of Phlorotannins Extracted from S. linifolium Brown Alga
3.4.1. DPPH Radical Scavenging Activity
The DPPH method’s measurement of antioxidant activity is represented as IC50 or the amount of extract needed to scavenge 50% of the DPPH radical. When DPPH solution is mixed with phlorotannis acting as a hydrogen atom donor, a stable non-radical form of DPPH is obtained, with a simultaneous change of the violet color to pale yellow. The inhibition could be amplified by increasing the concentration of extract, with the highest level of DPPH maximum inhibition with S. linifolium phlorotannin extract at the concentration 50 µg/mL and IC50 being 50.1 µg/mL (Figure 3). The regression value (R2) was 0.9972, which means that the model was efficient and could accurately predict the response.
Figure 3.
Percentage inhibition of the DPPH radical scavenging activity of phlorotannins extracted from S. linifolium brown alga.
3.4.2. Radical Scavenging Assay (ABTS+)
The ABTS radical cation (ABTS) is reactive towards most antioxidants, including phenolic, and during this reaction phlorotannis donate electrons, leading to the disappearance of the blue/green color of this radical. Phlorotannin extracts demonstrated stronger antioxidant activity with ABTS, and the inhibition increased with the extract concentration of S. linifolium. The maximum inhibition with S. linifolium phlorotannin extracts at the concentration of 125 µg/mL and IC50 was 85.4 µg/mL, see Figure 4. The regression value (R2) was 0.9862, which means the model was efficient and could accurately predict the response.
Figure 4.
ABTS+ percentage inhibition of phlorotannins extracted from S. linifolium brown alga.
The antioxidant activity of S. linifolium extracted phlorotannins may be due to their high phenolic and tannin contents; many studies reported that the total antioxidant activity of Sargassum dupplicatum phlorotannins corresponded to 11.17 ± 0.28 mg ascorbic acid/g DW [49], and Spirulina platensis (blue-green alga) and Chlorella vulgaris (green alga) hot water extracts have antioxidant and anti-cholesterol properties [50].
3.5. Cytotoxicity Assay
Figure 5 shows that the phlorotannins isolated from S. linifolium did not affect the viability of WPMY-1 cells, and more than 90% of them were still alive at concentrations ranging from 250 to 1000 µg/mL.
Figure 5.
Cytotoxicity of phlorotannins extracted from S. linifolium brown alga on the WPMY1 normal cell line.
3.6. In Vivo Study
The effect of the phlorotannin extracts on the differently treated groups’ serum glucose and insulin levels was evaluated. The results in Table 2 show a significant increase of serum glucose in the diabetic rats (596 mg/dl) compared to the normal control group (130.75 mg/dL), where S. linifolium phlorotannin extract lowered the level of glucose (111.25 mg/dL) below the normal control. Meanwhile, a significant decrease in serum glucose levels in the diabetic rats was observed after administration (60 mg/kg) of phlorotannins extracts of S. linifolium; the glucose levels of diabetic rats that were administered phlorotannin extracts of S. linifolium were 159.25 b ± 20.22. In addition, the results in Table 3 demonstrate the rise in serum insulin in the rats treated with S. linifolium phlorotannins above the normal control. There was no significant change in the serum insulin levels in diabetic rats treated with S. linifolium phlorotannins (5.03 a ± 1.43 µLU/mL) and the normal controls (5.302 a ± 1.336 µLU/mL). These results indicated that the S. linifolium phlorotannins promoted the β-Cell in the pancreas to secret insulin, which can be used to treat diabetes. The primary enzyme in saliva and pancreatic juice, α-amylase, is responsible for releasing the bonds that allow carbs to break down into glucose and maltose. The enzyme glucosidase, which is present in the brush border of the small intestine and is responsible for cleaving 1–4 linkages and releasing glucose for enterocyte absorption, works in tandem with it to break down carbohydrates [51]. The procedure for lowering blood glucose levels involves blocking the active sites of α-glucosidase and -amylase, which prevents the breakdown of carbs and delays glucose absorption [52]. Phlorotannins, which can be isolated from a wide range of brown algae, can prevent glucose absorption and impede the digestion of carbohydrates [53]. Brown algae Ecklonia cava and Ecklonia bicyclis phlorotannin extracts demonstrated α-glucosidase inhibition [54,55]. Phlorotannin extract of Sargassum patens caused α-glucosidase and α-amylase inhibition [56]. Phlorotannins isolated from Cystoseira compressa brown alga improved serum insulin in diabetic rats [57].
Table 3.
Serum glucose and insulin levels in the treated rat groups.
The results tabulated in Table 4 show the influence of the phlorotannins isolated from S. linifolium on the untreated rats and diabetic rates compared to the normal control and diabetic control, concerning glucosidase, alpha-amylase, catalase, and glutathione. The results showed that the phlorotannin extract of S. linifolium reduced glucosidase, alpha-amylase, and catalase levels but elevated glutathione in the untreated and diabetic rats. The methanol extracts of Iyengaria stellata and Colpomenia sinuosa had a more substantial inhibitory impact on α-glucosidase. In addition, Sirophysalis trinodis methanol extracts reduced the postprandial blood glucose levels in the diabetic rats in comparison to the untreated group [58]. Phlorotannins extracted from Phaeophyceae have shown a variety of anti-diabetic activities, such as inhibiting glucosidase and amylase, glucose uptake in muscle, inhibiting the protein tyrosine phosphatase enzyme, development of insulin sensitivity in type 2 diabetic mice, and prevention of complications from diabetes [59]. The ability of phlorotannins sequestered from Ecklonia stolonifera and Eisenia bicyclis to inhibit-glucosidase may improve the effectiveness of medicines for regulating blood sugar levels and preventing diabetic complications [60].
Table 4.
Serum glucosidase, alpha-amylase, catalase, and glutathione in the treated rat groups.
The results in Table 5 detail the kidney function tests, serum urea, and creatinine levels in the rat groups treated with phlorotannins extracted from brown alga S. linifolium, in comparison to the normal controls and diabetic controls. The results show that the phlorotannins lowered the urea levels (32.25 c ± 5.18) in the normal rats and also in the case of the diabetic rats treated with S. linifolium phlorotannins. The results demonstrated no significant changes in creatinine levels in the normal rats treated with S. linifolium phlorotannins or in diabetic treated with S. linifolium phlorotannins; meanwhile, elevated creatinine levels were observed in the diabetic rats (0.84 a ± 0.04 mg/dL). Elevated urea and creatinine levels are regarded as principal indicators of the renal impairment brought on by diabetes hyperglycemia [61], as STZ results in pathological kidney alterations [62]. The main risk factor for renal morbidity and death is diabetes, and one of the causes of chronic kidney failure is diabetic nephropathy. Gluconeogenesis is brought on by the metabolic anomalies seen in uncontrolled diabetes [63]. Increased proteolysis fuels gluconeogenesis, by releasing free glycogenic amino acids into the bloodstream, where they are de-aminated by the liver and converted into more urea [64]. As it assisted in controlling the nitrogen molecules during the endocrine metabolism, the Nannochloropsis oculata alga extract reduced the adverse effects on the renal function in STZ-induced diabetes [65]. In the STZ diabetic rat group, glutathione loss reflected intracellular oxidation [66].
Table 5.
Effect of phlorotannin extracts in the kidney function tests, represented by the urea (mg/dL) and creatinine (mg/dL) in the different treatment groups.
The results in Table 6 show the effect of the phlorotannin extracts from S. linifolium on the cholesterol (mg/dl) and serum triglyceride (mg/dl) levels in the normal and diabetic rats. Phlorotannis extracted from S. linifolium reduced the cholesterol and triglyceride (mg/dl) in diabetic rats by 72.5 b ± 8.58 and 51.5 c ± 12.23, respectively. According to Aboulthana et al. [64], Nannochloropsis oculata alga extract reduced the intestinal absorption of cholesterol and triglycerides, decreasing cholesterol and triglyceride levels. Additionally, the algal extract increased HDL levels and decreased LDL levels. Furthermore, Sewani–Rusikeetal [65] stated that daily administration of 200 and 400 mg/kg doses of algal extract for 28 days exhibited a considerable decrease in triglyceride and low-density lipoprotein (LDL) as compared to a control diabetic. This could be explained by numerous biochemical mechanisms, including activation of hormone-sensitive lipase brought on by energy depletion in diabetes, which helps mobilize fatty acids from adipocytes; and/or activation of the lipoprotein lipase, which helps endothelial cells hydrolyze triglycerides [66]. This condition, known as diabetic dyslipidemia, can be explained by the fact that diabetes tends to reduced good cholesterol and increase the levels of triacylglycerol and bad cholesterol, increasing the danger of heart disease and stroke. Increased intestinal absorption and production of cholesterol in diabetic rats led to hypercholesterolemia [67].
Table 6.
Effect of phlorotannin extracts from S. linifolium on serum cholesterol (mg/dL) and serum triglyceride (mg/dL) levels.
Table 7 shows the impact of phlorotannin extracted from S. linifolium on the diabetes rats and normal control, represented by the total antioxidant and MDA levels (nmol/g tissue). There was a highly significant enhancement in hepatic lipid peroxidation, and thereby production of a high level of lipid peroxides (MDA) (13.26 nmol/g tissue) and reduced total antioxidants (0.37 a ± 0.076), compared to normal controls (5.02 nmol/g tissue and 0.51 a ± 0.165), respectively. Diabetic rats administrated 60 mg/kg of phlorotannins revealed a significant decline in their level of MDA, towards a normal value (7.3 nmol/g tissue), and elevated total antioxidants (0.76 a ± 0.284). The antioxidant capacity was significantly higher in Sargassum sp. compared with Ulva sp. and Porphyra sp. [68]. These results are similar to those of Lee and Jeon [58], who demonstrated that both streptozotocin-induced diabetic and normal mice treated with dieckol (phlorotannin derivatives) demonstrated a considerable suppression of the antihyperglycemic activity of the drug after consuming a starch. According to Heo et al. [69], a phlorotannin derivative from the brown alga Ishige okamurae had potent inhibitory effects on β-glucosidase and β-amylase and alleviated the postprandial hyperglycemia in diabetic mice. Free radical formation and lipid peroxidation (MDA), a result of lipid peroxidation, can be stimulated by high glucose levels. According to El Barky et al. [2], an STZ-diabetic rat group had a significantly higher liver L-MDA concentration. The results showed that diabetic rats treated with S. linifolium had considerably lower levels of serum MDA (6.16 and 7.3 nmol/g tissue) after receiving phlorotannins. Phloroglucinol was shown by Queguineur et al. [70] to protect against lipid peroxidation in the human HepG2 cell line. In addition, Fauziah et al. [71] demonstrated that an extract of the brown alga Sargassum sp. reduced levels of MDA and was used for the treatment of rats with rheumatoid arthritis, showed decreased levels of MDA (0.314 ppm) compared to the rats with arthritis (0.488 ppm). This indicated that therapy with brown algae extracts at a dose of 100 mg/kg body weight positively influenced the decrease in the levels of MDA in rheumatoid arthritis rat serum. Consuming S. platensis as a dietary supplement may help humans lower their serum and liver levels of total cholesterol and TG. It seems safe to utilize a hot aqueous extract of S. platensis to potentially reduce hypercholesterolemia [72]. Polysaccharides isolated from Ulva fasciata and Ulva lactuca enhanced the antioxidant activity [73]. Many natural products have antibacterial and anticancer agents that could be used for functional pharmaceutical formulations [74,75].
Table 7.
Total antioxidant capacity and MDA levels in the differently treated rats.
3.7. Effect of Phlorotannin Extracts on AMP-Activated Protein Kinase (AMPK) Expression
Results showed that treatment of diabetic rats with phlorotannins extracts was activated AMPK expression in diabetic rats that treated with S. linifolium extract (1.79 Rat 2) as compared to those control-diabetic (0.549), shown in Table 8. The energy-sensing enzyme AMPK signals to accelerate glucose uptake in the skeletal muscles, fatty acid oxidation in the adipose (and other) tissues, and decrease hepatic glucose synthesis when cellular energy levels are low. There is strong evidence that type 2 diabetes and metabolic syndrome affect both people and animals and that AMPK activation (either physiologically or pharmacologically) can enhance insulin sensitivity and metabolic health [76]. Obesity is one of the essential risk factors for type 2 diabetes; Kojima-Yuasa [77] found that a polyphenol extract from Ecklonia cava caused the activation of AMPK and inhibited adipogenesis. Ko et al. [78] studied how Dieckol, a phlorotannin from the brown alga Ecklonia cava, inhibits adipogenesis and induces AMPK phosphorylation via AMP-activated protein kinase (AMPK). Both had a significant effect on lowering blood sugar levels. Swiss albino mice treated with Spirulina platensis, Lactobacillus, or a combination showed significant reductions in total cholesterol (TC) and triglycerides (TG) [79].
Table 8.
Real-time PCR data analysis for AMPK expression of phlorotannins extracted from S. linifolium alga.
3.8. Histopathological Findings
The pancreas of the normal control and control S. linifolium groups was observed, and the pancreas’ histological structure and the Langerhans’ islets (IL) implanted in the acinar cell were both normal and undamaged (AC). However, the diabetic rats’ pancreatic sections showed significant Langerhans islet degeneration, and some necrotic areas were detected, with hydropic islet degeneration (IL) surrounded by fibrosis of pancreatic acini (AC), with some rats exhibiting severe islet atrophy. However, the diabetic rats given extracts of S. linifolium phlorotannins (60 mg/kg) showed a noticeable increase in islet size, repaired necrotic and fibrotic alterations, and, most astonishingly, a considerably decreased percentage of degenerative cells in islets (Figure 6). The pancreatic islets of the diabetic group had severe degenerative alterations, and the certain cells had grown larger, with foamy or transparent cytoplasm [80]. Management of the metabolism of micronutrients depends on the pancreas. As a result, when diabetes affects the pancreas, the pancreas tissues may suffer intracellular damage [81]. According to research by Nagy and Amin [82], the pancreas of diabetic rats showed severe damage to the islets of Langerhans and a small islet size. After 30 days of treatment, with diabetic rats receiving 150 and 300 mg/kg of hydroalcoholic extracts of the brown alga Sargassum oligocystum, there was significant regeneration of the beta cells and an increased pancreatic islet area, according to Akbarzadeh et al. [83]. The ability of the pancreas to regenerate after being destroyed by streptozotocin is thought to be a result of the presence of stable cells in the pancreas [84]. The pancreatic islets and acinar cells of the diabetic rats receiving methanol extract of S. platensis exhibited a remarkable recovery [85].
Figure 6.
Photomicrograph of the pancreatic tissue stained with hematoxylin and eosin for the various treatment groups: (G1) control rats, (G2) rats that received S. linifolium phlorotannins extract, (G3) diabetic rats administered streptozotocin, and (G4) diabetic rats treated with S. linifolium phlorotannin extract.
4. Conclusions
Polyphenol compounds extracted from marine algae, especially phlorotannins, have potentially beneficial activities, including being antioxidant, antidiabetic, and anti-cholesterol, and lowering triglycerides. In this study, Sargassum linifolium was collected from the Ras Sidr Coast to extract phlorotannin (a polyphenol compound). The characterization of Sargassum-phlorotannins proved that they had antioxidant activities and no cytotoxicity when tested using an MTT assay. The experimental animal results showed that the Sargassum phlorotannins lowered glucose, insulin, cholesterol, and triglyceride levels, and activated AMPK expression in streptozotocin-induced diabetic rats. The Sargassum phlorotannins did not affect the kidney functions, represented by the urea and creatinine levels in the blood. The histopathological examination of the diabetic pancreas treated with Sargassum phlorotannins showed a noticeable increase in islet size, repaired necrotic and fibrotic alterations, and, most astonishingly, a considerably decreased percentage of degenerative cells in the islets. Phlorotannins extracted from marine algae are natural and economic compounds that may be used to treat numerous human diseases; with further investigations in volunteers required.
Author Contributions
Conceptualization, S.G., T.M.M. and A.K.; Methodolgy, M.A.N.; Software, M.A.N.; writing-draft, S.G., R.A.H.; Formal analysis, S.G. and R.A.H.; M.A.N.; T.M.M.; T.M.A.-S.; A.K., Investigation, S.G.; M.A.N.; T.M.M.; T.M.A.-S.; A.K.; Data curation, S.G.; R.A.H.; M.A.N.; Writing original draft, review and editing, S.G. and R.A.H. All authors have read and agreed to the published version of the manuscript.
Funding
This research received no external funding.
Institutional Review Board Statement
Forty white albino male Wistar rats weighing 200–240 g were bought from the Faculty of Agriculture, Center for Experimentation and Agricultural Research, Zagazig University, Egypt. The Ethical Committee (ICUC) of the Faculty of Science, Tanta University (FSTU), approved the handling of animals under the certification code Rec-Sci-Tu-0028, 2017.
Informed Consent Statement
Not applicable.
Data Availability Statement
Not applicable.
Acknowledgments
Authors would like to thank Omnia Hamdy Abdel-Karim, Bioprocess Engineering & AlgaePARC, Wageningen University and Research, The Netherlands for her assistance to organize the languge auditing of the manuscript.
Conflicts of Interest
The authors declare no conflict of interest.
References
- Ghosh, S.; Bhattacharyya, S.; Rashid, K.; Sil, P.C. Curcumin protects rat liver from streptozotocin-induced diabetic pathophysiology by counteracting reactive oxygen species and inhibiting the activation of p53 and MAPKs. Toxicol. Rep. 2015, 2, 365–376. [Google Scholar] [CrossRef] [Scilit]
- El Barky, A.R.; Hussein, S.A.; Alm-Eldeen, A.A.; Hafez, Y.A.; Mohamed, T.M. Anti-diabetic activity of Holothuria thomasi saponin. Biomed. Pharmacother. 2016, 84, 1472–1487. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rayapu, L.; Chakraborty, K.; Valluru, L. Marine Algae as a Potential Source for Anti-diabetic Compounds—A Brief Review. Curr. Pharm. Des. 2021, 27, 789–801. [Google Scholar] [CrossRef] [Scilit]
- Gunathilaka, T.L.; Samarakoon, K.; Ranasinghe, P.; Peiris, L.D.C. Antidiabetic Potential of Marine Brown Algae—A Mini Review. J. Diabetes Res. 2020, 2020, 1230218. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Unnikrishnan, P.S.; Jayasri, M.A. Marine Algae as a Prospective Source For Antidiabetic Compounds—A Brief Review. Curr. Diabetes Rev. 2018, 14, 237–245. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Venkatesan, J.; Keekan, K.K.; Anil, S.; Bhatnagar, I.; Kim, S.K. Phlorotannins. Encycl. Food Chem. 2019, 3, 515–527. [Google Scholar]
- Ferreres, F.; Lopes, G.; Gil-Izquierdo, A.; Andrade, P.B.; Sousa, C.; Mouga, T.; Valentão, P. Phlorotannin extracts from Fucales characterized by HPLC-DAD-ESI-MSn: Approaches to hyaluronidase inhibitory capacity and antioxidant properties. Mar. Drugs 2012, 10, 2766–2781. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Negara, B.F.S.P.; Sohn, J.H.; Kim, J.S.; Choi, J.S. Effects of Phlorotannins on Organisms: Focus on the Safety, Toxicity, and Availability of Phlorotannins. Foods 2021, 19, 452. [Google Scholar] [CrossRef] [Scilit]
- Saurav, K.; Costantino, V.; Venturi, V.; Steindler, L. Quorum sensing inhibitors from the sea discovered using bacterial N-acyl-homoserine lactone-based biosensors. Mar. Drugs 2017, 15, 53. [Google Scholar] [CrossRef] [Scilit]
- Schoenwaelder, M.E.A.; Clayton, M.N. Physode formation in embryos of Phyllospora comosa and Hormosira banksii (Phaeopbyceae). Phycologia 2000, 39, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Koivikko, R.; Loponen, J.; Honkanen, T.; Jormalainen, V. Contents of soluble, cell-wall-bound and exuded phlorotannins in the brown alga Fucus vesiculosus, with implications on their ecological functions. J. Chem. Ecol. 2005, 31, 195–212. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hidayati, J.R.; Yudiati, E.; Pringgenies, D.; Arifin, Z.; Oktaviyanti, D.T. Antioxidant activities, total phenolic compound and pigment contents of tropical Sargassum sp. extract, macerated in different solvents polarity. J. Kelaut. Trop. 2019, 22, 73–80. [Google Scholar] [CrossRef] [Scilit]
- Hodhodi, A.; Babakhani, A.; Rostamzad, H. Effect of different extraction conditions on phlorotannin content and antioxidant activity of extract from brown algae (Sargassum angustifolium). J. Food Process. Preserv. 2022, 46, e16307. [Google Scholar] [CrossRef] [Scilit]
- Ismail, G.A.; Gheda, S.F.; Abo-shady, A.M.; Abdel-karim, O.H. In vitro potential activity of some seaweeds as antioxidants and inhibitors of diabetic enzymes. Food Sci. Technol. 2019, 40, 681–691. [Google Scholar] [CrossRef] [Scilit]
- Abdel-Karim, O.H.; Abo-Shady, A.M.; Ismail, G.A.; Gheda, S.F. Potential effect of Turbinaria decurrens acetone extract on the biochemical and histological parameters of alloxan-induced diabetic rats. Int. J. Environ. Health Res. 2022, 32, 1447–1468. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Iken, K.; Amsler, C.D.; Hubbard, J.M.; McClintock, J.B.; Baker, B.J. Allocation patterns of phlorotannins in Antarctic brown algae. Phycologia 2007, 46, 386–395. [Google Scholar] [CrossRef] [Scilit]
- Parys, S.; Kehraus, S.; Pete, R.; Küpper, F.C.; Glombitza, K.W.; König, G.M. Seasonal variation of polyphenolics in Ascophyllum nodosum (Phaeophyceae). Eur. J. Phycol. 2009, 44, 331–338. [Google Scholar] [CrossRef] [Scilit]
- Aleem, A. The marine algae of the Alexandria, Egypt. Privately published, Alexandria, Egypt, 139p. Adv. Appl. Sci. Res. 1993, 5, 74–81. [Google Scholar]
- Jha, B.; Reddy, C.R.K.; Thakur, M.C.; Rao, M.U. Seaweeds India: The Diversity and Distribution of Seaweeds of the Gujarat Coast; Springer: Dordrecht, The Netherlands, 2009; Volume 3, 215p. [Google Scholar] [CrossRef] [Scilit]
- Koivikko, R.; Loponen, J.; Pihlaja, K.; Jormalainen, V. High-performance liquid chromatographic analysis of phlorotannins from the brown alga Fucus vesiculosus. Phytochem. Anal. 2007, 18, 326–332. [Google Scholar] [CrossRef] [Scilit]
- Stern, J.L.; Hagerman, A.E.; Steinberg, P.D.; Winter, F.C.; Estes, J.A. A new assay for quantifying brown algal phlorotannins and comparisons to previous methods. J. Chem. Ecol. 1996, 7, 1273–1293. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Esmaeilzadeh Kenari, R.; Mohsenzadeh, F.; Amiri, Z.R. Antioxidant activity and total phenolic compounds of Dezful sesame cake extracts obtained by classical and ultrasound-assisted extraction methods. Food Sci. Nutr. 2014, 2, 426–435. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Montero, L.; Herrero, M.; Ibanez, E.; Cifuentes, A. Separation and characterization of phlorotannins from brown alga Cystoseira abies-marina by comprehensive two-dimensional liquid chromatography. Electrophoresis 2014, 35, 1644–1651. [Google Scholar] [CrossRef] [Scilit]
- Lien, E.J.; Ren, S.; Bui, H.-H.; Wang, R. Quantitative structure-activity relationship analysis of phenolic antioxidants. Free. Radic. Biol. Med. 1999, 26, 285–294. [Google Scholar] [CrossRef] [Scilit]
- Tariq, M.; Masoud, M.S.; Mehmood, A.; Khan, S.N.; Riazuddin, S. Stromal cell derived factor-1alpha protects stem cell derived insulin-producing cells from glucotoxicity under high glucose conditions in-vitro and ameliorates drug induced diabetes in rats. J. Transl. Med. 2013, 11, 115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheng, D.; Liang, B.; Li, Y. Antihyperglycemic effect of Ginkgo biloba extract in streptozotocin-induced diabetes in rats. Biomed. Res. Int. 2013, 2013, 162724. [Google Scholar] [CrossRef] [Scilit]
- Jung, Y.S.; Cho, Y.-H.; Han, C.H. Anti-nflammatory effect of phlorotannin on chronic nonbacterial prostatitis in a rat model. Korean J. Urogenit. Tract Infect. Inflamm. 2014, 9, 86–92. [Google Scholar] [CrossRef] [Scilit]
- Wu, A. Tietz Clinical Guide to Laboratory Tests, 4th ed.; Saunders: Philadelphia, PA, USA, 2006; p. 1816. ISBN 9781437719871. [Google Scholar]
- Winn-Deen, E.S.; David, H.; Sigler, G.; Chavez, R. Development of a direct assay for alpha-amylase. Clin. Chem. 1988, 34, 2005–2008. [Google Scholar] [CrossRef] [Scilit]
- Thilagam, E.; Parimaladevi, B.; Kumarappan, C.; Chandra Mandal, S. α-Glucosidase and α-amylase inhibitory activity of Senna surattensis. J. Acupunct. Meridian Stud. 2013, 6, 24–30. [Google Scholar] [CrossRef] [Scilit]
- Tietz, N.W. (Ed.) Textbook of Clinical Chemistry; Sauders: Philadelphia, PA, USA, 1986; pp. 1271–1281. [Google Scholar] [CrossRef] [Scilit]
- Stein, E.A. Lipids, lipoproteins, and apolipoproteins. In Fundamentals of Clinical Chemistry, 3rd ed.; Tietz, N.W., Ed.; WB Saunders: Philadelphia, PA, USA, 1987; p. 448. [Google Scholar]
- Zhang, J.; Shen, H.; Wang, X.; Wu, J.; Xue, Y. Effects of chronic exposure of 2,4-dichlorophenol on the antioxidant system in liver of freshwater fish Carassius auratus. Chemosphere 2004, 55, 167–174. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beutler, E.; Duron, O.; Kelly, B.M. Improved method for the determination of blood glutathione. J. Lab. Clin. Med. 1963, 61, 882–888. [Google Scholar]
- Koracevic, D.; Koracevic, G.; Djordjevic, V.; Andrejevic, S.; Cosic, V. Method for the measurement of antioxidant activity in human fluids. J. Clin. Pathol. 2001, 54, 356–361. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guan, H.; Yang, K. RNA isolation and real-time quantitative RT-PCR. Methods Mol. Biol. J. 2008, 456, 259–270. [Google Scholar] [CrossRef] [Scilit]
- Pavia, H.; Cervin, G.; Lindgren, A.; Åberg, P. Effects of UV-B radiation and simulated herbivory on phlorotannins in the brown alga Ascophyllum nodosum. Mar. Ecol. Prog. Ser. 1997, 157, 139–146. [Google Scholar] [CrossRef] [Scilit]
- Kamal, M.; Gheda, S.; Abdel Hamid, A.; Mohamed, T.M. Antibacterial and antioxidant activities of Phlorotannins extracted from Sargassum linifolium brown alga. Delta J. Sci. 2020, 41, 32–38. [Google Scholar] [CrossRef] [Scilit]
- Oh, S.Y.; Yoo, D.I.; Shin, Y.; Kim, H.C.; Kim, H.Y.; Chung, Y.S.; Youk, J.H. Crystalline structure analysis of cellulose treated with sodium hydroxide and carbon dioxide by means of X-ray diffraction and FTIR spectroscopy. Carbohydr. Res. 2005, 340, 2376–2391. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Coward, J.L. FTIR spectroscopy of synthesized racemic nonacosan-10-ol: A model compound for plant epicuticular waxes. J. Biol. Phys. 2010, 36, 405–425. [Google Scholar] [CrossRef] [Scilit]
- Kecskés, T.; Raskó, J.; Kiss, J. FTIR and mass spectrometric study of HCOOH interaction with TiO2 supported Rh and Au catalysts. Appl. Catal. A Gen. 2004, 268, 9–16. [Google Scholar] [CrossRef] [Scilit]
- Breto, J.; Burie, J.R.; Berthomieu, C.; Berger, G.; Nabedryk, E. The binding sites of quinones in photosynthetic bacterial reaction centers investigated by light-induced FTIR difference spectroscopy: Assignment of the QA vibrations in Rhodobacter sphaeroides using 18O-or 13C-labeled ubiquinones and vitamin K1. Biochemistry 1994, 33, 4953–4965. [Google Scholar] [CrossRef] [Scilit]
- Ling, F.T.; Post, J.E.; Heaney, P.J.; Kubicki, J.D.; Santelli, C.M. Fourier-transform infrared spectroscopy (FTIR) analysis of triclinic and hexagonal birnessites. Spectrochim. Acta Part A Mol. Biomol. Spectrosc. 2017, 178, 32–46. [Google Scholar] [CrossRef] [Scilit]
- Das, K.; Kendall, C.; Isabelle, M.; Fowler, C.; Christie-Brown, J.; Stone, N. FTIR of touch imprint cytology: A novel tissue diagnostic technique. J. Photochem. Photobiol. B Biol. 2008, 92, 160–164. [Google Scholar] [CrossRef] [Scilit]
- Baek, S.H.; Cao, L.; Jeong, S.J.; Kim, H.R.; Nam, T.J.; Lee, S.G. The comparison of total phenolics, total antioxidant, and anti-tyrosinase activities of Korean Sargassum species. J. Food Qual. 2021, 2021, 6640789. [Google Scholar] [CrossRef] [Scilit]
- Budhiyanti, S.A.; Raharjo, S.; Marseno, D.W.; Lelana, I.Y. Antioxidant activity of brown algae Sargassum species extracts from the coastline of java island. Am. J. Agric. Biol. Sci. 2012, 7, 337–346. [Google Scholar] [CrossRef] [Scilit]
- Pramesti, R.; Setyati, W.A.; Pringgenies, D.; Zainuddin, M. Phenol Content and Antioxidative Activity in the Extract of Multiple Sargassum Species. Ann. Biol. Sci. 2019, 7, 7–15. [Google Scholar]
- Li, Y.; Fu, X.; Duan, D.; Liu, X.; Xu, J.; Gao, X. Extraction and identification of phlorotannins from the brown alga, Sargassum fusiforme (Harvey) Setchell. Mar. Drugs 2017, 15, 49. [Google Scholar] [CrossRef] [Scilit]
- Boi, V.N.; Trang, N.T.M.; Cuong, D.X.; Ha, H.T. Antioxidant phlorotannin from brown algae Sargassum dupplicatum: Enzyme-assissted extraction and purification. World 2020, 4, 62–68. [Google Scholar]
- Ibrahim, M.R.; Hamouda, R.A.; Tayel, A.A.; Al-Saman, M.A. Anti-cholesterol and antioxidant activities of independent and combined microalgae aqueous extracts in vitro. Waste Biomass Valorization 2021, 12, 4845–4857. [Google Scholar] [CrossRef] [Scilit]
- He, L. Alpha-glucosidase inhibitors as agents in the treatment of diabetes. Diabetes Rev. 1998, 6, 132–145. [Google Scholar]
- Krentz, A.J.; Bailey, C.J. Oral Antidiabetic Agents. Drugs 2005, 65, 385–411. [Google Scholar] [CrossRef] [Scilit]
- Lopes, G.; Andrade, P.B.; Valentão, P. Phlorotannins: Towards New Pharmacological Interventions for Diabetes Mellitus Type 2. Molecules 2016, 30, 56. [Google Scholar] [CrossRef] [Scilit]
- Lee, J.Y.; Kim, S.M.; Jung, W.-S.; Song, D.-G.; Um, B.-H.; Son, J.-K.; Pan, C.-H. Phlorofucofuroeckol-A, a potent inhibitor of aldo-keto reductase family 1 member B10, from the edible brown alga Eisenia bicyclis. J. Korean Soc. Appl. Biol. Chem. 2012, 55, 721–727. [Google Scholar] [CrossRef] [Scilit]
- Park, M.-H.; Heo, S.-J.; Park, P.-J.; Moon, S.-H.; Sung, S.-H.; Jeon, B.-T.; Lee, S.-H. 6,6′-Bieckol Isolated from Ecklonia cava Protects Oxidative Stress Through Inhibiting Expression of ROS and Proinflammatory Enzymes in High-Glucose-Induced Human Umbilical Vein Endothelial Cells. Appl. Biochem. Biotechnol. 2014, 174, 632–643. [Google Scholar] [CrossRef] [Scilit]
- Kawamura-Konishi, Y.; Watanabe, N.; Saito, M.; Nakajima, N.; Sakaki, T.; Katayama, T.; Enomoto, T. Isolation of a new phlorotannin, a potent inhibitor of carbohydrate-hydrolyzing enzymes, from the brown alga Sargassum patens. J. Agric. Food Chem. 2012, 60, 5565–5570. [Google Scholar] [CrossRef] [Scilit]
- Gheda, S.; Naby, M.A.; Mohamed, T.; Pereira, L.; Khamis, A. Antidiabetic and antioxidant activity of phlorotannins extracted from the brown seaweed Cystoseira compressa in streptozotocin-induced diabetic rats. Environ. Sci. Pollut. Res. Int. 2021, 28, 22886–22901. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, S.H.; Jeon, Y.J. Anti-diabetic effects of brown algae derived phlorotannins, marine polyphenols through diverse mechanisms. Fitoterapia 2013, 86, 129–136. [Google Scholar] [CrossRef] [Scilit]
- Moon, H.E.; Islam, N.; Ahn, B.R.; Chowdhury, S.S.; Sohn, H.S.; Jung, H.A.; Choi, J.S. Protein tyrosine phosphatase 1B and α-glucosidase inhibitory Phlorotannins from edible brown algae, Ecklonia stolonifera and Eisenia bicyclis. Biosci. Biotechnol. Biochem. 2011, 75, 1472–1480. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Juma, A.A.; Ngeranwa, J.J.; Njagi, E.N. Reference values for some renal function parameters for adult population in north-rift valley, kenya. Indian J. Clin. Biochem. 2012, 27, 40–45. [Google Scholar] [CrossRef] [Scilit]
- Sun, J.E.; Ao, Z.H.; Lu, Z.M.; Xu, H.Y.; Zhang, X.M.; Dou, W.F.; Xu, Z.H. Antihyperglycemic and antilipidperoxidative effects of dry matter of culture broth of Inonotus obliquus in submerged culture on normal and alloxan-diabetes mice. J. Ethnopharmacol. 2008, 118, 7–13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Punithavathi, V.R.; Anuthama, R.; Prince, P.S. Combined treatment with naringin and vitamin C ameliorates streptozotocin-induced diabetes in male Wistar rats. J. Appl. Toxicol. 2008, 28, 806–813. [Google Scholar] [CrossRef] [Scilit]
- Atangwho, I.J.; Ebong, P.E.; Eteng, M.U.; Eyong, E.U.; Obi, A.U. Effect of Vernonia amygdalina del leaf on kidney function of diabetic rats. Int. J. Pharmacol. 2007, 3, 143–148. [Google Scholar] [CrossRef] [Scilit]
- Aboulthana, W.M.; El-Feky, A.M.; El-Sayed, A.B.; Ibrahim, N.E.; Sahu, R.K.; Mishra, A. Evaluation of the pancreatoprotective effect of Nannochloropsis oculata Extract against streptozotocin-induced diabetes in rats. J. Appl. Pharm. Sci. 2018, 8, 46–58. [Google Scholar] [CrossRef] [Scilit]
- Sewani-Rusike, C.R.; Jumbam, D.N.; Chinhoyi, L.R.; Nkeh-Chungag, B.N. Investigation of hypogycemic and hypolipidemic effects of an aqueous extract of Lupinus albuslegume seed in Streptozotocin-induced type I diabetic rats. Afr. J. Tradit. Complement. Altern. Med. 2015, 12, 36. [Google Scholar] [CrossRef] [Scilit]
- Walker, C.G.; Zariwala, M.G.; Holness, M.J.; Sugden, M.C. Diet, obesity and diabetes: A current update. Clin. Sci. 2007, 112, 93–111. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mathe, D. Dyslipidemia and diabetes: Animal models. Diabetes Metab. 1995, 21, 106–111. [Google Scholar]
- García-Casal, M.N.; Ramírez, J.; Leets, I.; Pereira, A.C.; Quiroga, M.F. Antioxidant capacity, polyphenol content and iron bioavailability from algae (Ulva sp., Sargassum sp. and Porphyra sp.) in human subjects. Br. J. Nutr. 2009, 101, 79–85. [Google Scholar] [CrossRef] [Scilit]
- Heo, S.J.; Hwang, J.Y.; Choi, J.I.; Han, J.S.; Kim, H.J.; Jeon, Y.J. Diphlorethohydroxycarmalol isolated from Ishige okamurae, a brown algae, a potent alpha-glucosidase and alpha-amylase inhibitor, alleviates postprandial hyperglycemia in diabetic mice. Eur. J. Pharmacol. 2009, 615, 252–256. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Queguineur, B.; Goya, L.; Ramos, S.; Martin, M.A.; Mateos, R.; Bravo, L. Phloroglucinol: Antioxidant properties and effects on cellular oxidative markers in human HepG2 cell line. Food Chem. Toxicol. 2012, 50, 2886–2893. [Google Scholar] [CrossRef] [Scilit]
- Fauziah, F.; Aulanni’am, A.A.; Mahdi1, C. A study on brown seaweed therapy (Sargassum sp.) toward MDA levels and histological improvement on rat foot suffering rheumatoid arthritis. Pure Appl. Chem. Res. 2013, 2, 102–107. [Google Scholar] [CrossRef] [Scilit]
- Al-Saman, M.A.; Doleib, N.M.; Ibrahim, M.R.; Nasr, M.Y.; Tayel, A.A.; Hamouda, R.A. In vitro and in vivo hypolipidemic properties of the aqueous extract of Spirulina platensis, cultivated in colored flasks under artificial illumination. PeerJ 2020, 8, e10366. [Google Scholar] [CrossRef] [Scilit]
- Hamouda, R.A.; Hussein, M.H.; El-Naggar, N.E.A.; Karim-Eldeen, M.A.; Alamer, K.H.; Saleh, M.A.; El-Azeem, R.M.A. Promoting Effect of Soluble Polysaccharides Extracted from Ulva spp. on Zea mays L. growth. Molecules 2022, 27, 1394. [Google Scholar] [CrossRef] [Scilit]
- Aldakheel, R.K.; Rehman, S.; Almessiere, M.A.; Khan, F.A.; Gondal, M.A.; Mostafa, A.; Baykal, A. Bactericidal and in vitro cytotoxicity of moringa oleifera seed extract and its elemental analysis using laser-induced breakdown spectroscopy. Pharmaceuticals 2020, 13, 193. [Google Scholar] [CrossRef] [Scilit]
- Taqvi, S.; Bhat, E.A.; Sajjad, N.; Sabir, J.S.; Qureshi, A.; Rather, I.A.; Rehman, S. Protective effect of vanillic acid in hydrogen peroxide-induced oxidative stress in D. Mel-2 cell line. Saudi J. Biol. Sci. 2021, 28, 1795–1800. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Coughlan, K.A.; Valentine, R.J.; Ruderman, N.B.; Saha, A.K. AMPK activation: A therapeutic target for type 2 diabetes? Diabetes Metab. Syndr. Obes. 2014, 7, 241–253. [Google Scholar] [CrossRef] [Scilit]
- Kojima-Yuasa, A. Biological and pharmacological effects of polyphenolic compounds from Ecklonia cava. In Polyphenols: Mechanisms of Action in Human Health and Disease; Academic Press: Cambridge, MA, USA, 2018; pp. 41–52. [Google Scholar] [CrossRef] [Scilit]
- Ko, S.C.; Lee, M.; Lee, J.H.; Lee, S.H.; Lim, Y.; Jeon, Y.J. Dieckol, a phlorotannin isolated from a brown seaweed, Ecklonia cava, inhibits adipogenesis through AMP-activated protein kinase (AMPK) activation in 3T3-L1 preadipocytes. Environ. Toxicol. Pharmacol. 2013, 36, 1253–1260. [Google Scholar] [CrossRef] [Scilit]
- Hamouda, R.A.; Hamza, H.A.; Salem, M.L.; Kamal, S.; Alhasani, R.H.; Alsharif, I.; Abdella, A. Synergistic Hypolipidemic and Immunomodulatory Activity of Lactobacillus and Spirulina platensis. Fermentation 2022, 8, 220. [Google Scholar] [CrossRef] [Scilit]
- Fau, A.S.; Amin, H.A.; Fau, A.H.; Abdel-Hamid, G.A.; Abdel-Hamid, G.A. A histological and immunohistochemical study of beta cells in streptozotocin diabetic rats treated with caffeine. Med. Histol. 2014, 1, 1897–5631. [Google Scholar]
- Abo-Shady, A.M.; Gheda, S.F.; Ismail, G.A.; Cotas, J.; Pereira, L.; Abdel-Karim, O.H. Antioxidant and antidiabetic activity of algae. Life 2023, 13, 460. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nagy, M.A.; Amin, K.A. Biochemical and histopathological analysis of Cystoseira myrica aqueous extract on alloxan induced diabetic rats. Indian J. Clin. Biochem. 2015, 9, 081–091. [Google Scholar]
- Akbarzadeh, S.; Farzadinia, P.; Daneshi, A.; Ramavandi, B.; Moazzeni, A.; Keshavarz, M.; Bargahi, A. Anti-diabetic effects of Sargassum oligocystum on streptozotocin-induced diabetic rat. Iran. J. Basic Med. Sci. 2018, 21, 342. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tatar, M.; Qujeq, D.; Feizi, F.; Parsian, H.; Sohan Faraji, A.; Halalkhor, S.; Abassi, R.; Abedian, Z.; Pourbagher, R.; Aghajanpour Mir, S.M.; et al. Effects of Teucrium Polium Aerial Parts extract on oral glucose tolerance tests and pancreas histopathology in Streptozocin-induced diabetic rats. Int. J. Mol. Cell. Med. 2012, 1, 44–49. [Google Scholar] [PubMed]
- Gheda, S.F.; Abo-Shady, A.M.; Abdel-Karim, O.H.; Ismail, G.A. Antioxidant and Antihyperglycemic Activity of Arthrospira platensis (Spirulina platensis) Methanolic Extract: In vitro and in vivo study. Egypt. J. Bot. 2021, 61, 71–93. [Google Scholar] [CrossRef] [Scilit]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).





