Occurrence and Genotypic Identification of Blastocystis spp., Enterocytozoon bieneusi, and Giardia duodenalis in Leizhou Black Goats in Zhanjiang City, Guangdong Province, China
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. DNA Extraction
2.3. PCR Amplification
2.4. Sequencing and Phylogenetic Analysis
2.5. Statistical Analysis
3. Results
3.1. Occurrence of Blastocystis spp., E. bieneusi, and G. duodenalis
3.2. Distributions of Blastocystis spp. Subtypes
3.3. Genotypes of E. bieneusi
3.4. Genotypes and Subtypes of G. duodenalis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Muadica, A.S.; Köster, P.C.; Dashti, A.; Bailo, B.; Hernández-de-Mingo, M.; Reh, L. Molecular diversity of Giardia duodenalis, Cryptosporidium spp. and Blastocystis sp. in asymptomatic school children in Leganés, Madrid (Spain). Microorganisms 2020, 8, 466. [Google Scholar] [CrossRef] [Scilit]
- Zhang, K.; Zheng, S.; Wang, Y.; Wang, K.; Wang, Y.; Gazizova, A. Occurrence and molecular characterization of Cryptosporidium spp., Giardia duodenalis, Enterocytozoon bieneusi, and Blastocystis sp. in captive wild animals in zoos in Henan. BMC Vet. Res. 2021, 17, 332–341. [Google Scholar] [CrossRef] [Scilit]
- Feng, Y.; Xiao, L. Zoonotic potential and molecular epidemiology of Giardia species and giardiasis. Clin. Microbiol. Rev. 2011, 24, 110–140. [Google Scholar] [CrossRef] [Scilit]
- Santín, M.; Fayer, R. Microsporidiosis: Enterocytozoon bieneusi in domesticated and wild animals. Res. Vet. Sci. 2011, 90, 363–371. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Fu, Y.; Bian, X.; Han, H.; Dong, H.; Zhao, G. Molecular characterization and prevalence of Cryptosporidium spp. in sheep and goats in western Inner Mongolia, China. Parasitol. Int. 2023, 122, 537–545. [Google Scholar] [CrossRef] [Scilit]
- Rauff-Adedotun, A.A.; Zain, S.N.M.; Haziqah, M.T.F. Current status of Blastocystis sp. in animals from Southeast Asia: A review. Parasitol. Res. 2020, 119, 3559–3570. [Google Scholar] [CrossRef] [Scilit]
- Zhou, T.Z.; Ju, R.C.; Huang, S.X.; Qin, J.J.; Xiao, H.C.; Li, J.C.; Li, F.M.; Peng, J.B. Progress in the Blastocystis research of bovine, sheep and goats. Chin. J. Vet. Med. 2022, 58, 92–95. [Google Scholar]
- Song, J.K.; Yin, Y.L.; Yuan, Y.J.; Tang, H.; Ren, G.J.; Zhang, H.J. First genotyping of Blastocystis sp. in dairy, meat, and cashmere goats in northwestern China. Acta Trop. 2017, 176, 277–282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tan, T.C.; Tan, P.C.; Sharma, R.; Sugnaseelan, S.; Suresh, K.G. Genetic diversity of rodent Blastocystis sp. from Peninsular Malaysia. Parasitol. Res. 2018, 35, 85–89. [Google Scholar] [CrossRef] [Scilit]
- Jiang, Y.; Liu, L.; Yuan, Z.; Liu, A.; Cao, J.; Shen, Y. Molecular identification and genetic characteristics of Cryptosporidium spp., Giardia duodenalis, and Enterocytozoon bieneusi in human immunodeficiency virus/acquired immunodeficiency syndrome patients in Shanghai, China. Parasites Vectors 2023, 16, 53–62. [Google Scholar] [CrossRef] [Scilit]
- Li, W.; Feng, Y.; Santin, M. Host Specificity of Enterocytozoon bieneusi and Public Health Implications. Trends Parasitol. 2019, 35, 436–451. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.Y.; Qin, R.L.; Mei, J.J.; Zou, Y.; Zhang, Z.H.; Zheng, W.B. Molecular detection and genotyping of Enterocytozoon bieneusi in beef cattle in Shanxi province, North China. Animals 2022, 12, 2961. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, T.; Ren, G.; Zhou, H.; Qiang, Y.; Li, J.; Zhang, Y. Molecular prevalence and genetic diversity analysis of Enterocytozoon bieneusi in humans in Hainan province, China: High diversity and unique endemic genetic characteristics. Front. Public Health 2022, 27, 1007130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Taghipour, A.; Bahadory, S.; Javanmard, E. The global molecular epidemiology of microsporidia infection in sheep and goats with focus on Enterocytozoon bieneusi: A systematic review and meta-analysis. Trop. Med. Health 2021, 49, 66–78. [Google Scholar] [CrossRef] [Scilit]
- Peng, X.Q.; Tian, G.R.; Ren, G.J.; Yu, Z.-Q.; Lok, J.B.; Zhang, L.X. Infection rate of Giardia duodenalis, Cryptosporidium spp. and Enterocytozoon bieneusi in cashmere, dairy and meat goats in China. Infect. Genet. Evol. 2016, 41, 26–31. [Google Scholar] [CrossRef] [Scilit]
- Savioli, L.; Smith, H.; Thompson, A. Giardia and Cryptosporidium join the ‘Neglected Diseases Initiative’. Trends Parasitol. 2006, 22, 203–208. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cai, W.; Ryan, U.; Xiao, L.; Feng, Y. Zoonotic giardiasis: An update. Parasitol. Res. 2021, 120, 4199–4218. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zou, Y.; Li, X.D.; Meng, Y.M.; Wang, X.L.; Wang, H.N.; Zhu, X.Q. Prevalence and multilocus genotyping of Giardia duodenalis in zoo animals in three cities in China. Parasitol. Res. 2022, 121, 2359–2366. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tian, H.C.; Deng, M.; Guo, Y.Q.; Liu, G.B.; Wu, L.F.; Sun, B.L. Analysis of differences in serum physiological and biochemical indicators and meat quality between Leizhou black goats and Chuanzhong black goats. Heilongjiang Anim. Sci. Vet. Med. 2020, 22, 55–58. [Google Scholar]
- Santín, M.; Trout, J.M.; Fayer, R. Prevalence of Enterocytozoon bieneusi in post-weaned dairy calves in the eastern United States. Parasitol. Res. 2004, 93, 287–289. [Google Scholar] [CrossRef] [Scilit]
- Feng, Y.; Li, N.; Dearen, T.; Lobo, M.L.; Matos, O.; Cama, V. Development of a multilocus sequence typing tool for high-resolution genotyping of Enterocytozoon bieneusi. Appl. Environ. Microbiol. 2011, 77, 4822–4828. [Google Scholar] [CrossRef] [Scilit]
- Lalle, M.; Pozio, E.; Capelli, G.; Bruschi, F.; Crotti, D.; Cacciò, S.M. Genetic heterogeneity at the β-giardin locus among human and animal isolates of Giardia duodenalis and identification of potentially zoonotic subgenotypes. Int. J. Parasitol. 2005, 35, 207–213. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sulaiman, I.M.; Fayer, R.; Bern, C.; Gilman, R.H.; Trout, J.M.; Schantz, P.M. Triosephosphate isomerase gene characterization and potential zoonotic transmission of Giardia duodenalis. Emerg. Infect. Dis. 2003, 9, 1444–1452. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cacciò, S.M.; Beck, R.; Lalle, M.; Marinculic, A.; Pozio, E. Multilocus genotyping of Giardia duodenalis reveals striking differences between assemblages A and B. Int. J. Parasitol. 2008, 38, 1523–1531. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karimi, P.; Shafaghi-Sisi, S.; Meamar, A.R.; Razmjou, E. Molecular identification of Cryptosporidium, Giardia, and Blastocystis from stray and household cats and cat owners in Tehran, Iran. Sci. Rep. 2023, 13, 1554–1566. [Google Scholar] [CrossRef] [Scilit]
- Liu, L.K.; Wang, P.L.; Han, H.; Wang, R.J.; Jian, F.C. Current status of Blastocystis infection in China. Chin. J. Zoonoses 2021, 37, 548–562. [Google Scholar]
- Yang, F.; Gou, J.M.; Yang, B.K.; Du, J.Y.; Yao, H.Z.; Ren, M. Prevalence and subtype distribution of Blastocystis in Tibetan sheep in Qinghai province, Northwestern China. Protist 2020, 174, 125948. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Fu, Y.; Bian, X.; Han, H.; Dong, H.; Zhao, G. Molecular identification and genotyping of Blastocystis sp. in sheep and goats from some areas in Inner Mongolia, Northern China. Parasitol. Int. 2023, 94, 102739. [Google Scholar] [CrossRef] [Scilit]
- Song, J.; Yang, X.; Ma, X.; Wu, X.; Wang, Y.; Li, Z. Molecular characterization of Blastocystis sp. in Chinese bamboo rats (Rhizomys sinensis). Parasite 2021, 28, 81–87. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Ge, Y.; Wang, R.; Dong, H.; Yang, X.; Zhang, L. First report of Blastocystis infection in Pallas’s squirrels (Callosciurus erythraeus) in China. Vet. Res. Commun. 2021, 45, 441–445. [Google Scholar] [CrossRef] [Scilit]
- Cian, A.; Safadi, D.E.; Osman, M.; Moriniere, R.; Gantois, N.; Benamrouz-Vanneste, S. Molecular epidemiology of Blastocystis sp. in various animal groups from two French zoos and Evaluation of Potential Zoonotic Risk. PLoS ONE 2017, 12, e0169659. [Google Scholar] [CrossRef] [Scilit]
- Alfellani, M.A.; Taner-Mulla, D.; Jacob, A.S.; Imeede, C.A.; Yoshikawa, H.; Stensvold, C.R. Genetic diversity of blastocystis in livestock and zoo animals. Protist 2013, 164, 497–509. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, W.; Owen, H.; Traub, R.J.; Cuttell, L.; Inpankaew, T.; Bielefeldt-Ohmann, H. Molecular epidemiology of Blastocystis in pigs and their in-contact humans in Southeast Queensland, Australia, and Cambodia. Vet. Parasitol. 2014, 203, 264–269. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xie, S.C.; Zou, Y.; Li, Z.; Yang, J.F.; Zhu, X.Q.; Zou, F.C. Molecular detection and genotyping of Enterocytozoon bieneusi in black goats (Capra hircus) in Yunnan province, Southwestern China. Animals 2021, 11, 3387. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, H.H.; Zheng, X.L.; Ma, T.M.; Qi, M.; Cao, Z.X.; Chao, Z. Genotype identification and phylogenetic analysis of Enterocytozoon bieneusi in farmed black goats (Capra hircus) from China’s Hainan province. Parasite 2019, 26, 62–69. [Google Scholar] [CrossRef] [Scilit]
- Chen, D.; Wang, S.S.; Zou, Y.; Li, Z.; Xie, S.C.; Shi, L.Q. Prevalence and multi-locus genotypes of Enterocytozoon bieneusi in black-boned sheep and goats in Yunnan province, southwestern China. Infect. Genet. Evol. 2018, 65, 385–391. [Google Scholar] [CrossRef] [Scilit]
- Al-Herrawy, A.Z.; Gad, M.A. Microsporidial Spores in Fecal Samples of Some Domesticated Animals Living in Giza, Egypt. Iran. J. Parasitol. 2016, 11, 195–203. [Google Scholar]
- Udonsom, R.; Prasertbun, R.; Mahittikorn, A.; Chiabchalard, R.; Sutthikornchai, C.; Palasuwan, A. Identification of Enterocytozoon bieneusi in goats and cattle in Thailand. BMC Vet. Res. 2019, 15, 308–315. [Google Scholar] [CrossRef] [Scilit]
- Wang, P.; Zheng, L.; Liu, L.; Yu, F.; Jian, Y.; Wang, R. Genotyping of Cryptosporidium spp, Giardia duodenalis and Enterocytozoon bieneusi from sheep and goats in China. BMC Vet. Res. 2022, 18, 361–372. [Google Scholar] [CrossRef] [Scilit]
- Shi, K.; Li, M.; Wang, X.; Li, J.; Karim, M.R.; Wang, R. Molecular survey of Enterocytozoon bieneusi in sheep and goats in China. Parasites Vectors 2016, 9, 23–31. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Mi, R.; Yang, J.; Wang, J.; Gong, H.; Huang, Y. Enterocytozoon bieneusi genotypes in farmed goats and sheep in Ningxia, China. Infect. Genet. Evol. 2020, 85, 104559. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, W.; Zhang, W.; Yang, D.; Zhang, L.; Wang, R.; Liu, A. Prevalence of Enterocytozoon bieneusi and genetic diversity of ITS genotypes in sheep and goats in China. Infect. Genet. Evol. 2015, 32, 265–270. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Q.; Zhang, Z.; Ai, S.; Wang, X.; Zhang, R.; Duan, Z. Cryptosporidium spp., Enterocytozoon bieneusi, and Giardia duodenalis from animal sources in the Qinghai-Tibetan Plateau Area (QTPA) in China. Comp. Immunol. Microbiol. Infect. Dis. 2019, 67, 101346. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Valenčáková, A.; Danišová, O. Molecular characterization of new genotypes Enterocytozoon bieneusi in Slovakia. Acta Trop. 2018, 191, 217–220. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, W.C.; Wang, K.; Gu, Y.F. Detection and genotyping study of Enterocytozoon bieneusi in sheep and goats in East-central China. Acta Parasitol. 2019, 64, 44–50. [Google Scholar] [CrossRef] [Scilit]
- Chang, Y.; Wang, Y.; Wu, Y.; Niu, Z.; Li, J.; Zhang, S. Molecular characterization of Giardia duodenalis and Enterocytozoon bieneusi isolated from Tibetan sheep and Tibetan goats under natural grazing conditions in Tibet. J. Eukaryot. Microbiol. 2020, 67, 100–106. [Google Scholar] [CrossRef] [Scilit]
- Dong, H.; Zhao, Z.; Zhao, J.; Fu, Y.; Lang, J.; Zhang, J. Molecular characterization and zoonotic potential of Enterocytozoon bieneusi in ruminants in northwest China. Acta Trop. 2020, 234, 106622. [Google Scholar] [CrossRef] [Scilit]
- Geng, H.L.; Yan, W.L.; Wang, J.M.; Meng, J.X.; Zhang, M.; Zhao, J.X. Meta-analysis of the prevalence of Giardia duodenalis in sheep and goats in China. Microb. Pathog. 2023, 179, 106097. [Google Scholar] [CrossRef] [Scilit]
- Jafari, H.; Jalali, M.H.R.; Shapouri, M.S.A.; Hajikolaii, M.R.H. Determination of Giardia duodenalis genotypes in sheep and goat from Iran. J. Parasit. Dis. 2014, 38, 81–84. [Google Scholar] [CrossRef] [Scilit]
- Zhang, W.; Zhang, X.; Wang, R.; Liu, A.; Shen, Y.; Ling, H. Genetic characterizations of Giardia duodenalis in sheep and goats in Heilongjiang province, China and possibility of zoonotic transmission. PLoS Negl. Trop. Dis. 2012, 6, e1826. [Google Scholar] [CrossRef] [Scilit]
- Yin, Y.L.; Zhang, H.J.; Yuan, Y.J.; Tang, H.; Chen, D.; Jing, S. Prevalence and multi-locus genotyping of Giardia duodenalis from goats in Shaanxi province, northwestern China. Acta Trop. 2018, 182, 202–206. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, J.; Wang, H.; Wang, R.; Zhang, L. Giardia duodenalis infections in humans and other animals in China. Front. Microbiol. 2017, 8, 2004. [Google Scholar] [CrossRef] [Scilit]
- Garcia-R, J.C.; Ogbuigwe, P.; Pita, A.B.; Velathanthiri, N.; Knox, M.A.; Biggs, P.J. First report of novel assemblages and mixed infections of Giardia duodenalis in human isolates from New Zealand. Acta Trop. 2021, 220, 105969. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Helmy, Y.A.; Klotz, C.; Wilking, H.; Krücken, J.; Nöckler, K.; Samson-Himmelstjerna, G.V. Epidemiology of Giardia duodenalis infection in ruminant livestock and children in the Ismailia province of Egypt: Insights by genetic characterization. Parasites Vectors 2014, 7, 321. [Google Scholar] [CrossRef] [Scilit]
- Zhong, M.L.; Zhang, H.J.; Chen, X.J.; Li, F.K.; Qiu, X.X.; Li, Y.; Huang, F.Q.; Wang, N.N.; Yu, X.G. Infection status and molecular characterization of Giardia dunodinalis in pigs in Guangdong province. Chin. Anim. Husb. Vet. Med. 2022, 49, 1592–1598. [Google Scholar]
- Wang, H.C.; Mu, X.R.; Zhong, M.L.; Li, B.; Yuan, K.J.; Wu, A.F.; Li, J.N.; Yu, X.G.; Zhang, H.J. Prevalence and molecular characterization of Giardia duodenalis in dairy cattle in parts of Guangdong province. Prog. Vet. Med. 2023, 44, 16–22. [Google Scholar]




| Gene | Nucleotide Sequences of Primer (5′-3′) | Expected Product Size (bp) | Annealing Temperature (°C) | Reference |
|---|---|---|---|---|
| bg gene of G. duodenalis | BG1: AAGCCCGACGACCTCACCCGCAGTGC | 515 | 55 | [22] |
| BG2: GAGGCCGCCCTGGATCTTCGAGACGAC | ||||
| BG3: GAACGAACGAGATCGAGGTCCG | 55 | |||
| BG4: CTCGACGAGCTTCGTGTT | ||||
| tpi gene of G. duodenalis | TPI1:AAATYATGCCTGCTCGTCG | 530 | 57 | [23] |
| TPI2:CAAACCTTYTCCGCAAACC | ||||
| TPI3:CCCTTCATCGGYGGTAACTT | 57 | |||
| TPI4:GTGGCCACCACYCCCGTGCC | ||||
| gdh gene of G. duodenalis | Gdh1: TTCCGTRTYCAGTACAACTC | 530 | 59 | [24] |
| Gdh2: ACCTCGTTCTGRGTGGCGCA | ||||
| Gdh3: ATGACYGAGCTYCAGAGGCACGT | 59 | |||
| Gdh4: GTGGCGCARGGCATGATGCA | ||||
| ITS gene of E. bieneusi | ITS1: GATGGTCATAGGGATGAAGAGCTT | 392 | 57 | [21] |
| ITS2: TATGCTTAAGTCCAGGGAG | ||||
| ITS3: AGGGATGAAGAGCTTCGGCTCTG | 55 | |||
| ITS4: AGTGATCCTGTATTAGGGATATT | ||||
| SSU rRNA of Blastocystis spp. | SSU rRNAF: ATCTGGTTGATCCTGCCAGT | 600 | 55 | [20] |
| SSU rRNAR: GAGCTTTTTAACTGCAACAACG |
| Age (Months) | Sample Size (n) | Blastocystis | E. bieneusi | G. duodenalis | ||||||
|---|---|---|---|---|---|---|---|---|---|---|
| No. Positive | Prevalence % (95% CI) | Subtypes (n) | No. Positive | Prevalence % (95% CI) | Genotype (n) | No. Positive | Prevalence% (95% CI) | Assemblage (n) | ||
| Growing goats (4–18 months) | 96 | 22 | 22.91% (14.4–31.5) | ST10 (12) ST14 (8) ST21 (2) | 24 | 25.00% (16.2–33.8) | CHG3 (22) ET-L2 (2) | 26 | 27.08% (18–36.1) | E (26) |
| Reserve goats (19–30 months) | 64 | 30 | 46.88% (34.3–59.4) | ST10 (20) ST14 (2) ST21 (4) ST5 (4) | 12 | 18.75% (8.9–28.6) | CHG3 (8) CM21 (4) | 26 | 40.63% (28.3–53) | E (24) A + E (2) |
| Adult goats (>30 months) | 66 | 24 | 36.36% (24.4–48.3) | ST10 (18) ST14 (4) ST5 (2) | 4 | 6.06% (0.1–12) | CHG3 (2) CHG1 (2) | 4 | 6.06% (0.1–12) | E (4) |
| Total | 226 | 76 | 33.63% (27.4–39.8) | ST5 (6) ST10 (50) ST14 (14) ST21 (6) | 40 | 17.70% (12.7–22.7) | CHG3 (32) CHG1 (2) CM21 (4) ET-L2 (2) | 56 | 24.78% (19.1–30.5) | E (54) A + E (2) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yu, X.; Wang, H.; Li, Y.; Mu, X.; Yuan, K.; Wu, A.; Guo, J.; Hong, Y.; Zhang, H. Occurrence and Genotypic Identification of Blastocystis spp., Enterocytozoon bieneusi, and Giardia duodenalis in Leizhou Black Goats in Zhanjiang City, Guangdong Province, China. Animals 2023, 13, 2777. https://doi.org/10.3390/ani13172777
Yu X, Wang H, Li Y, Mu X, Yuan K, Wu A, Guo J, Hong Y, Zhang H. Occurrence and Genotypic Identification of Blastocystis spp., Enterocytozoon bieneusi, and Giardia duodenalis in Leizhou Black Goats in Zhanjiang City, Guangdong Province, China. Animals. 2023; 13(17):2777. https://doi.org/10.3390/ani13172777
Chicago/Turabian StyleYu, Xingang, Hongcai Wang, Yilong Li, Xuanru Mu, Kaijian Yuan, Anfeng Wu, Jianchao Guo, Yang Hong, and Haoji Zhang. 2023. "Occurrence and Genotypic Identification of Blastocystis spp., Enterocytozoon bieneusi, and Giardia duodenalis in Leizhou Black Goats in Zhanjiang City, Guangdong Province, China" Animals 13, no. 17: 2777. https://doi.org/10.3390/ani13172777
APA StyleYu, X., Wang, H., Li, Y., Mu, X., Yuan, K., Wu, A., Guo, J., Hong, Y., & Zhang, H. (2023). Occurrence and Genotypic Identification of Blastocystis spp., Enterocytozoon bieneusi, and Giardia duodenalis in Leizhou Black Goats in Zhanjiang City, Guangdong Province, China. Animals, 13(17), 2777. https://doi.org/10.3390/ani13172777

