Identification of Flo11-like Adhesin in Schizosaccharomyces pombe and the Mechanism of Small-Molecule Compounds Mediating Biofilm Formation in Yeasts
Abstract
1. Introduction
2. Materials and Methods
2.1. Strains and Media
2.2. Construction of the SPBPJ4664.02Δ Deletion Mutant
2.3. Construction of the SPBPJ4664.02Δ/flo11OE
2.4. Molecular Characterization of SPBPJ4664.02Δ/flo11OE for Flo11-GFP Expression
2.4.1. Colony PCR of SPBPJ4664.02Δ/flo11OE
2.4.2. Confocal Laser Scanning Microscopy (CLSM)
2.5. Assays of Biofilm Formation in S. pombe
2.6. The Plate-Washing Assay
2.7. Effects of IAA and Dodecanol on C. albicans Growth
2.8. Assays for the Biofilm Formation of C. albicans
2.9. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
2.10. Statistical Analysis
3. Results and Discussion
3.1. Rescue of the SPBPJ4664.02Δ Mutant by flo11 Overexpression
3.2. Impacts of SPBPJ4664.02 (Flo11-like) in the Small-Molecule Signaling Pathway for Biofilm Formation and Filamentation
3.2.1. Effects of IAA and Dodecanol on S. pombe Biofilm Formation and Cell Adhesion
3.2.2. Effects of IAA and Dodecanol on S. pombe Invasive Growth
3.3. Effects of IAA and Dodecanol on C. albicans Biofilm Formation
3.4. Transcriptional Analysis of C. albicans Biofilm-Related Genes
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Willaert, R.G.; Kayacan, Y.; Devreese, B. The Flo Adhesin Family. Pathogens 2021, 10, 1397. [Google Scholar] [CrossRef]
- Kusakabe, T.; Lin, W.Y.; Cheong, J.G.; Singh, G.; Ravishankar, A.; Yeung, S.T.; Mesko, M.; DeCelie, M.B.; Carriche, G.; Zhao, Z.; et al. Fungal microbiota sustains lasting immune activation of neutrophils and their progenitors in severe COVID-19. Nat. Immunol. 2023, 24, 1879–1889. [Google Scholar] [CrossRef]
- Amoah-Buahin, E.; Bone, N.; Armstrong, J. Hyphal growth in the fission yeast Schizosaccharomyces pombe. Eukaryot. Cell 2005, 4, 1287–1297. [Google Scholar] [CrossRef] [PubMed]
- Baillie, G.S.; Douglas, L.J. Role of dimorphism in the development of Candida albicans biofilms. J. Med. Microbiol. 1999, 48, 671–679. [Google Scholar] [CrossRef] [PubMed]
- Talapko, J.; Juzbašić, M.; Matijević, T.; Pustijanac, E.; Bekic, S.; Kotris, I.; Skrlec, I. Candida albicans—The virulence factors and clinical manifestations of infection. J. Fungi 2021, 7, 79. [Google Scholar] [CrossRef] [PubMed]
- Alnuaimi, A.D.; O’Brien-Simpson, N.M.; Reynolds, E.C.; McCullough, M.J. Clinical isolates and laboratory reference Candida species and strains have varying abilities to form biofilms. FEMS Yeast Res. 2013, 13, 689–699. [Google Scholar] [CrossRef] [PubMed]
- Bouyx, C.; Schiavone, M.; François, J.M. FLO11, a developmental gene conferring impressive adaptive plasticity to the yeast Saccharomyces cerevisiae. Pathogens 2021, 10, 1509. [Google Scholar] [CrossRef] [PubMed]
- Brown, G.D.; Denning, D.W.; Gow, N.A.R.; Levitz, S.M.; Netea, M.G.; White, T.C. Hidden killers: Human fungal infections. Sci. Transl. Med. 2012, 4, 165rv13. [Google Scholar] [CrossRef] [PubMed]
- Kraushaar, T.; Brückner, S.; Veelders, M.; Rhinow, D.; Schreiner, F.; Birke, R.; Pagenstecher, A.; Mösch, H.U.; Essen, L.O. Interactions by the fungal Flo11 adhesin depend on a fibronectin type III-like adhesin domain girdled by aromatic bands. Structure 2015, 23, 1005–1017. [Google Scholar] [CrossRef]
- Liu, Z.H.; Li, R.P.; Dong, Q.; Bian, L.Z.; Li, X.S.; Yuan, S. Characterization of the non-sexual flocculation of fission yeast cells that results from the deletion of ribosomal protein L32. Yeast 2015, 32, 439–449. [Google Scholar] [CrossRef]
- Li, R.P.; Li, X.S.; Sun, L.; Chen, F.F.; Liu, Z.X.; Gu, Y.Y.; Gong, X.Y.; Liu, Z.H.; Wei, H.; Huang, Y.; et al. Reduction of ribosome level triggers flocculation of fission yeast cells. Eukaryot. Cell 2013, 12, 450–459. [Google Scholar] [CrossRef]
- Gagiano, M.; Bauer, F.F.; Pretorius, I.S. The sensing of nutritional status and the relationship to filamentous growth in Saccharomyces cerevisiae. FEMS Yeast Res. 2002, 2, 433–470. [Google Scholar]
- Prusty, R.; Grisafi, P.; Fink, G.R. The plant hormone indoleacetic acid induces invasive growth in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 2004, 101, 4153–4157. [Google Scholar] [CrossRef]
- Zara, G.; Budroni, M.; Mannazzu, L.; Fancello, F.; Zara, S. Yeast biofilm in food realms: Occurrence and control. World J. Microbiol. Biotechnol. 2020, 36, 134. [Google Scholar] [CrossRef]
- Rao, R.P.; Hunter, A.; Kashpur, O.; Normanly, J. Aberrant synthesis of indole-3-acetic acid in Saccharomyces cerevisiae triggers morphogenic transition, a virulence trait of pathogenic fungi. Genetics 2010, 185, 211–220. [Google Scholar] [CrossRef]
- Di Martino, P.; Fursy, R.; Bret, L.; Sundararaju, B.; Phillips, R.S. Indole can act as an extracellular signal to regulate biofilm formation of Escherichia coli and other indole-producing bacteria. Can. J. Microbiol. 2003, 49, 443–449. [Google Scholar] [CrossRef] [PubMed]
- Davis-Hanna, A.; Piispanen, A.E.; Stateva, L.I.; Hogan, D.A. Farnesol and dodecanol effects on the Candida albicans Ras1-CAMP signaling pathway and the regulation of morphogenesis. Mol. Microbiol. 2007, 67, 47–62. [Google Scholar] [CrossRef] [PubMed]
- Chauhan, N.M.; Karuppayil, S.M. Dual identities for various alcohols in two different yeasts. Mycology 2020, 12, 25–38. [Google Scholar] [CrossRef] [PubMed]
- Lin, L.; Chen, L.; Tran, P.T. Fission yeast neddylation ligase Dcn1 facilitates cohesin cleavage and chromosome segregation at anaphase. Biol. Open 2017, 6, 844–849. [Google Scholar] [CrossRef] [PubMed]
- Bähler, J.; Wu, J.Q.; Longtine, M.S.; Shah, N.G.; McKenzie, A.; Steever, A.B.; Wach, A.; Philippsen, P.; Pringle, J.R. Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast 1998, 14, 943–951. [Google Scholar] [CrossRef]
- Siam, R.; Dolan, W.P.; Forsburg, S.L. Choosing and using Schizosaccharomyces pombe plasmids. Methods 2004, 33, 189–198. [Google Scholar] [CrossRef]
- Kimani, B.G.; Kerekes, E.B.; Szebenyi, C.; Krisch, J.; Vágvölgyi, C.; Papp, T.; Takó, M. In vitro activity of selected phenolic compounds against planktonic and biofilm cells of food-contaminating yeasts. Foods 2021, 10, 1652. [Google Scholar] [CrossRef]
- Cullen, P.J. The plate-washing assay: A simple test for filamentous growth in budding yeast. Cold Spring Harb. Protoc. 2015, 2, 168–171. [Google Scholar] [CrossRef]
- Ramage, G.; Saville, S.P.; Wickes, B.L.; López-Ribot, J.L. Inhibition of Candida albicans biofilm formation by farnesol, a quorum-sensing molecule. Appl. Environ. Microbiol. 2002, 68, 5459–5463. [Google Scholar] [CrossRef]
- Matsuda, Y.; Cho, O.; Sugita, T.; Ogishima, D.; Takeda, S. Culture supernatants of Lactobacillus gasseri and L. crispatus inhibit Candida albicans biofilm formation and adhesion to HeLa cells. Mycopathologia 2018, 183, 691–700. [Google Scholar] [CrossRef]
- de Groot, P.W.J.; Hellingwerf, K.J.; Klis, F.M. Genome-wide identification of fungal GPI proteins. Yeast 2003, 20, 781–796. [Google Scholar] [CrossRef]
- Watson, P.; Davey, J. Characterization of the Prk1 protein kinase from Schizosaccharomyces pombe. Yeast 1998, 14, 485–492. [Google Scholar] [CrossRef]
- Younes, S.S.; Khalaf, R.A. The Candida albicans Hwp2p can complement the lack of filamentation of a Saccharomyces cerevisiae flo11 null strain. Microbiology 2013, 159, 1160–1164. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues, C.F.; Černáková, L. Farnesol and tyrosol: Secondary metabolites with a crucial quorum-sensing role in Candida biofilm development. Genes 2020, 11, 444. [Google Scholar] [CrossRef] [PubMed]
- Egbe, N.E.; Dornelles, T.O.; Paget, C.M.; Castelli, L.M.; Ashe, M.P. Farnesol inhibits translation to limit growth and filamentation in C. albicans and S. cerevisiae. Microb. Cell 2017, 4, 294–304. [Google Scholar] [CrossRef] [PubMed]
- Kwon, E.J.G.; Laderoute, A.; Chatfield-Reed, K.; Vachon, L.; Karagiannis, J.; Chua, G. Deciphering the transcriptional-regulatory network of flocculation in Schizosaccharomyces pombe. PLoS Genet. 2012, 8, e1003104. [Google Scholar] [CrossRef] [PubMed]
- Matsuzawa, T.; Morita, T.; Tanaka, N.; Tohda, H.; Takegawa, K. Identification of a galactose-specific flocculin essential for non-sexual flocculation and filamentous growth in Schizosaccharomyces pombe. Mol. Microbiol. 2011, 82, 1531–1544. [Google Scholar] [CrossRef] [PubMed]
- Desai, J.V.; Bruno, V.M.; Ganguly, S.; Stamper, R.J.; Mitchell, K.F.; Solis, N.; Hill, E.M.; Xu, W.J.; Filler, S.G.; Andes, D.R.; et al. Regulatory role of glycerol in Candida albicans biofilm formation. mBio 2013, 4, e00637-12. [Google Scholar] [CrossRef] [PubMed]
Application | Name of Primers | Sequence (5′-3′) |
---|---|---|
PCR of the gene flo11 amplified from the gDNA of S. cerevisiae | F_Bgl II-flo11 | 5′CGCTTTGTTAAACTCGAGAGATCTCGCTTTGTTAAACTCGAGAGATCT3′ |
R_Not I-flo11 | 5′TCTTCTCCTTTACTCAAGCGGCCGCGGAATACAACTGGAAGAGCGAGTAGCAACCA3′ | |
Colony PCR of SPBPJ4664.02∆/flo11OE | F_nmt | 5′TTCGGCAATGTGCAGCGAAAC3′ |
R_GFP | 5′CCTTCACCCTCTCCACTGACAGA3′ |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Y.-G.; Zhang, T.; Lin, L. Identification of Flo11-like Adhesin in Schizosaccharomyces pombe and the Mechanism of Small-Molecule Compounds Mediating Biofilm Formation in Yeasts. Microorganisms 2024, 12, 358. https://doi.org/10.3390/microorganisms12020358
Zhang Y-G, Zhang T, Lin L. Identification of Flo11-like Adhesin in Schizosaccharomyces pombe and the Mechanism of Small-Molecule Compounds Mediating Biofilm Formation in Yeasts. Microorganisms. 2024; 12(2):358. https://doi.org/10.3390/microorganisms12020358
Chicago/Turabian StyleZhang, Yu-Gang, Tong Zhang, and Lan Lin. 2024. "Identification of Flo11-like Adhesin in Schizosaccharomyces pombe and the Mechanism of Small-Molecule Compounds Mediating Biofilm Formation in Yeasts" Microorganisms 12, no. 2: 358. https://doi.org/10.3390/microorganisms12020358
APA StyleZhang, Y.-G., Zhang, T., & Lin, L. (2024). Identification of Flo11-like Adhesin in Schizosaccharomyces pombe and the Mechanism of Small-Molecule Compounds Mediating Biofilm Formation in Yeasts. Microorganisms, 12(2), 358. https://doi.org/10.3390/microorganisms12020358