Abstract
Tea seed oil (TSO) was investigated for its effects on rumen fermentation and in vitro parameters of bacterial communities in water buffalo diets containing Siraitia grosvenorii and soybean residues. TSO was added at rates of 0% (control group (CT)), 0.5% (T1), 1% (T2), and 2% (T3) of the in vitro fermentation substrate weight (dry matter (DM) basis). T2 and T3 had significantly lower acetate and total volatile fatty acid contents but a significantly higher microbial crude protein content than CT. The lowest NH3-N content was observed in T1 and T2. Treatment significantly increased DM digestibility, with the highest percentage observed in T2. T2 showed significantly higher crude protein digestibility than CT. TSO supplementation significantly increased the C18:2n6c, C18:2 trans-10, cis-12, and C20:4n6 concentrations compared to those in CT. The total number of bacteria was significantly lower in T2 than in CT. TSO supplementation decreased the total bacteria, fungi, and methanogen populations but increased rumen microorganism diversity and richness. In conclusion, TSO can regulate the number and flora of rumen microorganisms through antimicrobial activity, thereby affecting rumen fermentation patterns, reducing methane production, and improving nutrient digestibility, and an optimal supplementation rate appears to be achieved with 1% TSO (DM basis).
1. Introduction
Siraitia grosvenorii (Luo hanguo or monk fruit, SG) is a valuable and traditional medicinal herb grown in China for more than two centuries and occurs mainly in the Guangxi province of China. SG contains rich functional and nutritional chemical components such as glycosides, flavonoids, polysaccharides, proteins, and essential oils [1]. SG residue (SGR) is a by-product of extracting SG glycosides and still contains functional components and protein, polysaccharide, and antioxidant substances [2]. Today, when antibiotics are prohibited and non-resistant production is advocated, SGR is a safe and high-quality functional raw material and has certain application value in animal feeding [3].
Soybean residue (SR) is a by-product of the processing of tofu, soymilk, and other soy products using soybeans as raw materials [4]. With the high demand for tofu and soy products in China, the corresponding production of SR is high, producing approximately 70 million tons of SR every year [5,6]. SR contains nutrients such as protein, sugar, and fat, with a high development and utilization value [7,8,9]. Using SR as animal feed can reduce production costs and is a cost-effective protein supplement. Furthermore, feeding livestock and poultry with SR instead of some protein feed not only addresses resource waste but also reduces feed costs, achieving a virtuous ecological cycle of production of by-products, production, environmental protection, and comprehensive utilization, which will generate significant social benefits.
Ruminant livestock systems contribute substantially to the emissions of methane (CH4), a potent greenhouse gas; a portion of the ingested energy (2–15%) is emitted as CH4 by rumen fermentation [10]. Thus, reasonable regulation of rumen fermentation can not only reduce the waste from feed resources but also improve the production performance of ruminants to a certain extent. With the prohibition of growth-promoting antibiotics in animal feed, plant extracts have attracted widespread attention as a new type of “green” feed additive. Essential oils (EOs) have been proposed as substitutes for chemical feed additives due to their potential as rumen fermentation modifiers; their antibacterial, antifungal, and antioxidant properties make them useful as natural additives in animal feeds [11,12]. Furthermore, EOs may affect rumen development due to their effect on microorganism populations and may subsequently change rumen fermentation profiles, improving feed efficiency [13,14].
Tea seed oil (TSO) refers to the edible oil derived from the seeds of Camellia oleifera. TSO is rich in monounsaturated oleic acid, with concentrations ranging from 60 to 80%, and various bioactive compounds [15]. The seeds of plants usually contain various antioxidant factors; the naturally occurring active components in tea seeds are different from other kinds of oil seeds [16]. The potent antioxidant activity of TSO confers protection from free-radical-related diseases [17]. Thus, TSO can be considered a potential alternative for rumen fermentation modifiers and natural additives. Therefore, we hypothesized that feeding water buffalo SGR and SR together with EO additives could complement dietary nutrients and reduce CH4 production while improving feed digestibility and fermentation characteristics, thereby making it possible to effectively use locally available feed resources. However, to our knowledge, relatively little information is available on in vitro ruminal fermentation characteristics of SGR and SR mixtures with or without TSO.
Therefore, the study objective was to evaluate the effects of increasing TSO supplementation rates on water buffalo in vitro fermentation parameters, fatty acid, gas production, and ruminal bacterial communities under a diet containing SGR and SR.
2. Materials and Methods
2.1. Substrates and Treatments
The substrate was composed of 70% SGR and 30% SR on a dry matter (DM) basis. Details of the chemical composition of the substrate are given in Table 1. Four treatments containing 1 g of the substrate (70% SGR and 30% SR mixture) were supplemented with 0% (CT), 0.5% (T1), 1% (T2), and 2% (T3) TSO (>99% purity; Yihai Kerry Arawana Holdings Co, Ltd., Shanghai, China) and were applied in a completely randomized design (Table 2). Each treatment group had six incubation bottles as replicates per run.
Table 1.
Chemical composition of Siraitia grosvenorii residue and soybean residue.
Table 2.
Experimental design.
2.2. In Vitro Batch Culture
Three healthy water buffalo (average body weight 650 ± 50 kg) fitted with permanent rumen cannulas were used as ruminal fluid donors. The buffalo were cared for according to the guidelines of the Ethics Committee of the Guangxi Buffalo Research Institute, China. Rumen fluid was collected from the buffalo before morning feeding and strained through four layers of cheesecloth and combined on an equal volume basis. The combined filtrate was mixed with CO2-bubbled artificial saliva at a 1:2 volume ratio. The artificial saliva was prepared anaerobically as described by Guo et al. [18]. A total of 50 mL of buffered ruminal fluid was transferred to serum bottles (180 mL) containing 1 g of ground sample with or without TSO and was flushed with CO2 to preserve an anaerobic environment. The bottles were capped with a butyl rubber stopper and sealed with an aluminum cap. Incubation was performed at 39 °C for 72 h in a water bath with a shaker (100 strokes/min). Two experimental runs were performed for two consecutive weeks using the same experimental conditions.
2.3. Total Gas, Hydrogen (H2), and CH4 Production Analysis
The gas production was measured from the serum bottles using air syringes as described by Guo et al. [18]. At the same time as gas measurement, the H2 and CH4 production was measured using gas chromatography (GC) (8860, Agilent Technologies Co., Ltd., Shanghai, China). The cumulative H2 and CH4 production in 72 h was the sum of the actual H2 and CH4 production of the incubation bottle at each time point.
2.4. Rumen Fermentation Parameter Analysis
After incubation for 72 h, fermentation was stopped by swirling the bottles in ice. The pH was measured immediately after opening the bottles using a pH meter (PH8180–0–00; Smart Sensor Co., Ltd., Dongguan, China). Separate subsamples of the supernatant were used to determine volatile fatty acid (VFA) fractions using GC (7890A; Agilent Technologies, Santa Clara, CA, USA) as described by Azizi et al. [19]. The microbial crude protein (MCP) content was analyzed by colorimetry using an ultraviolet-visible spectrophotometer (PE Lambda 35, Shanghai Pudi Biotechnology Co., Ltd., Shanghai, China). The ammonia N (NH3-N) was determined using the phenol-hypochlorite procedure [20].
2.5. Fatty Acid Analysis
The extraction, methylation, and determination of medium and long-chain fatty acids in rumen fluid using the GC system (Trace1300, Thermo Fisher Scientific, Waltham, MA, USA) were determined using a GC hydrogen flame ionization detector (GC–MS), and automatic sampler (ISQ7000, Thermo Fisher Scientific, Waltham, MA, USA) as described by Guo et al. [21]. The fatty acid methyl ester was determined using a capillary column, and the concentration of long-chain fatty acids was detected using C19:0 as an internal standard. The chromatographic column was a DB-5ms capillary column, with specifications of 60 m × 0.25 mm × 0.25 μm. The conditions were as follows: injection volume: 1 μL; injection temperature: 260 °C; split ratio: 5:1; carrier gas: helium (99.999%); flow: 1.5 mL/min; column temperature: 140 °C for 5 min, to 180 °C at 10 °C/min, 3 min up to 210 °C at 2 °C/min and up to 280 °C at 5 °C/min, held for 15 min.
2.6. Nutrient Digestibility Analysis
For the determination of nutrient digestibility, the bottle contents were passed through previously weighed filter paper, and the residue was washed with hot distilled water. Afterward, the filter paper containing the residue was oven-dried until a constant weight at 105 °C. The crude protein (CP) contents were analyzed according to method 976.05 of the Association of Official Analytical Chemists [22]. Neutral detergent fiber (NDF) and acid detergent fiber (ADF) in the feed substrate and residues were determined according to the methods described by Van Soest et al. [23]. The DM, CP, ADF, and NDF digestibility (%) was calculated as: digestibility (%) = (1 − weight of residue after digestion/weight of substrate before digestion) × 100.
2.7. DNA Extraction and the Microbial Population Analysis
The total microbial DNA was extracted from rumen fluid using the cetyltrimethylammonium bromide (CTAB) method as described by Denman and McSweeney [24]. The determination of the number of microorganisms in rumen fluid was carried out using quantitative real-time PCR (qRT-PCR), with a high throughput sequencing instrument [25]. The primers used for total bacteria were UniF(306) (GTGSTGCAYGGYYGTCGTCA) and UniR(309) (ACGTCRTCCMCNCCTTCCTC) [26]; for methanogens, Met630F(501) (GGATTAGATACCCSGGTAGT) and Met803R (GTT-GARTCCAATTAAACCGCA) [18]; for Protozoa, ProtozoaF (GCTTTCGWTGGTAGTGTATT) and PotozoaR (CTTGCCCTCYAATCGTWCT) [27]; for fungi, FungiF (GAGGAAGTAAAAGTCGTAACAAGGTTTC) and FungiR (CAAATTCACAAAGGGTAGGATGATT) [24]. PCR was performed using the SYBRGreen fluorescent dye in a Roche light cycler 480 RT-PCR machine (Roche, Basel, Switzerland). The results were then transformed to log10 copies/mL of the sample for further statistical analysis.
2.8. 16S rDNA Gene Sequencing and Bioinformatic Analysis
High throughput (Illumina MiSeq) sequencing of the 16S rDNA gene was carried out using barcoded primers for the V3–V4 region (front end primers: 343F TACGGRAGGCAGCAG, backend primers: 798R AGGGTATCTAATCCT). Based on the original data, the paired reads were spliced into a sequence according to the overlapping relationship between raw reads, and then the samples were identified and distinguished according to the barcode tag sequence and primer sequence at the beginning and end of the sequence to obtain data for each sample. Finally, the quality of each sample data and the effect of the merge were filtered by quality control to obtain the effective sequence of each sample. The rumen bacterial composition of samples was determined using species annotation and abundance analysis, and further alpha diversity analysis was conducted to determine the differences among samples. Bioinformatic analysis of the OTU data was conducted using the Oebiotech cloud platform (https://cloud.oebiotech.cn/, accessed on 11 November 2022) provided by Shanghai OE Biotech Co., Ltd. (Shanghai, China) to determine the relative abundance, microbial diversity matrices, and other parameters.
2.9. Statistical Analysis
Data were analyzed by analysis of variance using a general linear model in SAS software (version 9.2; SAS Institute, Cary, NC, USA). Duncan’s test was used to identify differences (p < 0.05) between the means. The Alpha diversity index was calculated using Mothur software (version v.1.30). The microbial Beta diversity was determined using principal coordinate analysis. PERMANOVA amongst all groups was performed (using 999 permutations). p-values less than 0.05 were considered statistically significant.
3. Results
3.1. In Vitro Ruminal Gas Production
Although no significant (p > 0.05) change in gas production (total gas, H2, and CH4) was observed in response to the treatments (Table 3), the total gas and CH4 decreased and H2 increased when TSO was added, compared to the control.
Table 3.
In vitro ruminal gas production of substrates supplemented with tea seed oil.
3.2. In Vitro Rumen Fermentation Parameters
Compared to CT, T2 and T3 had lower (p < 0.05) acetate and total VFA but higher MCP (p < 0.05) content (Table 4). The lowest NH3-N content was found in T1 and T2 (p < 0.05), followed by T3 and CT. The content of valerate in T1 was higher (p < 0.05) than in the control. There was no effect (p > 0.05) of TSO on the pH, propionate, isobutyrate, butyrate, isovalerate, and acetate/propionate in vitro in water buffalo rumen fluid.
Table 4.
Effects of tea seed oil supplementation on in vitro fermentation characteristics.
3.3. In Vitro Ruminal Nutrient Digestibility
Treatments increased (p < 0.05) the DM digestibility (Table 5); the highest percentage (56.68%) was observed for T2 followed by T3 (56.26%) and T1 (55.50%), compared to CT. The T2 showed higher CP digestibility than the CT group (p < 0.05). However, the results revealed no effect (p > 0.05) of TSO on the NDF and ADF digestibility.
Table 5.
Effects of substrates supplemented with tea seed oil on in vitro ruminal nutrient digestibility.
3.4. Fatty Acid Composition
The effects of TSO supplementation on the fatty acid content of rumen fluid are shown in Table 6. T3 had a higher C18:3n6 concentration than T1 (p < 0.05). Supplementation with TSO increased the concentrations of C18:2n6c, C18:2 trans-10, cis-12, and C20:4n6 compared to those in CT, whereas T2 and T3 were significantly higher in CT and T1, respectively (p < 0.05). However, compared to CT, TSO supplementation decreased the C18:1n9c concentration, which was significantly lower in T3 (p < 0.05). The C18:0 concentration in T2 was significantly lower than that in CT (p < 0.05). C20:3n3 and C24:0 concentrations were significantly lower in CT and T1 than in T3 (p < 0.05). The C22:5n6 concentrations in T1 and T2 were higher than those in CT and T3, respectively (p < 0.05).
Table 6.
Effects of tea seed oil on in vitro rumen fatty acid profile of water buffalo (μg/mL).
3.5. Rumen Microbial Populations
The number of total bacteria in T2 was lower (p < 0.05) compared to CT (Table 7). However, the results revealed no effect (p > 0.05) of TSO on the microbial populations of methanogens, protozoa, and fungi.
Table 7.
Effects of tea seed oil supplementation on microbial populations (log10 copies per g of rumen contents).
3.6. Rumen Bacterial Diversity
Bacterial alpha diversity parameters in the present study are shown in Figure 1. There were no differences (p > 0.05) in the Shannon, Simpson, Chao, Ace, observed_species, and goods_coverage index, indicating that the sequencing depth was desirable for the current analysis and that TSO supplementation did not affect the richness and diversity of the bacterial community.
Figure 1.
Changes in alpha diversity indices in the bacterial community in the in vitro rumen fermentation with increasing tea seed oil supplementation. (a) Shannon index; (b) Simpson index; (c) Chao index; (d) Ace index; (e) Observed_species index; (f) goods_coverage.
The composition of the bacterial community was compared between various treatments and analyzed using beta diversity analysis. As illustrated by PCoA (Figure 2), the treatment and control groups did not cluster separately, indicating a similarity in the composition of the rumen flora.
Figure 2.
Principal coordinate analysis of the bacterial community in the in vitro rumen fermentation with increasing tea seed oil supplementation.
3.7. Relative Abundance of Bacterial Populations
The relative abundance of microorganisms in the rumen contents of water buffalo at the phylum and genus levels is shown in Figure 3. Firmicutes and Bacteroidota were dominant phyla that accounted for more than 85% of the whole rumen bacteriome (Figure 3a). Other major bacterial phyla were Spirochaetota, Proteobacteria, Desulfobacterota, Actinobacteriota, Elusimicrobiota, Patescibacteria, Campylobacterota, Fibrobacteriota, Acidobacteriota, Verrucomicrobiota, Planctomycetota, Gemmatimonadiota and Nitrospirota. However, no difference in the relative abundance of Firmicutes and Bacteroidota among the groups was observed (p > 0.05).
Figure 3.
Relative abundance of rumen microflora of buffalo at the phylum level (a) and genus level (b).
The relative abundance of Acidobacteriota in T3 was higher than in other groups (p < 0.05) (Figure 4a). Compared with the CT and T1 group, the relative abundance of Campylobacterota was higher in T3 (Figure 4b) (p < 0.05). The relative abundance of Actinobacteriota was lower in T3 than in CT and T1 (p < 0.05) (Figure 4c).
Figure 4.
Effect of tea seed oil supplementation on the relative abundance of different bacteria phyla. Asterisk sign was used when the p values were less than 0.05 (* 0.01 < p ≤ 0.05, ** 0.001 < p ≤ 0.01, *** p ≤ 0.001). (a) Acidobacteriota; (b) Campylobacterota; (c) Actinobacteriota.
The relative abundance of major bacterial genera is shown in Figure 3b. Rikenellaceae_RC9_gut_group was the dominant genus with the highest relative abundance among the four groups, and the secondary dominant genera were all less than 11%, including F082, Christensenellaceae_R-7_group, Prevotella, Muribaculaceae, NK4A214_group, [Eubacterium]_oxidoreducens_group, UCG-011, and Bacteroidales_BS11_gut_group, etc. The relative abundance of Muribaculaceae in T3 was increased compared with CT and T1 groups (p < 0.05) (Figure 5a). However, the relative abundance of Family_XIII_AD3011_group in the T3 group was lower than in other groups (Figure 5b) (p < 0.05). The relative abundance of Anaerovorax was higher in T3 as compared to the CT and T1 group (p < 0.05) (Figure 5c), and T2 was higher than T1 (p < 0.05). The relative abundance of Ruminococcus was higher in T1 than in T2 and T3 (p < 0.05) (Figure 5d). The relative abundance of [Eubacterium]_oxidoreductens_group was higher in T2 than in the other groups (p < 0.05) (Figure 5e). The CT and T1 groups had higher [Ruminococcus]_gauvreauii_group relative abundance, but lower relative abundance of Lachnospiraceae_UCG-008 compared to T2 and T3, respectively (p < 0.05) (Figure 5f,g). The relative abundance of Anaerovibrio in T2 was higher than in CT and T1 (p < 0.05) (Figure 5h). The relative abundance of Prevotellaceae_NK3B31_group in the T3 group was higher than in the other groups (Figure 5i) (p < 0.05). However, the relative abundance of Mogibacterium in T3 was lower than in CT and T1; T2 was lower than T1 (Figure 5j) (p < 0.05).
Figure 5.
Effect of tea seed oil supplementation on the relative abundance of different bacteria genera. Asterisk sign was used when the p values were less than 0.05 (* 0.01 < p ≤ 0.05, ** 0.001 < p ≤ 0.01, *** p ≤ 0.001). (a) Muribaculaceae; (b) Family_XIII_AD3011_group; (c) Anaerovorax; (d) Ruminococcus; (e) [Eubacterium]_oxidoreductens_group; (f) [Ruminococcus]_gauvreauii_group; (g) Lachnospiraceae_UCG-008; (h) Anaerovibrio; (i) Prevotellaceae_NK3B31_group; (j) Mogibacterium.
4. Discussion
In the current study, SGR had higher DM, NDF, and ADF contents relative to SR, indicating that SGR could be used as a feed resource for ruminants. SR had higher CP (29.32% DM), but lower DM, DM, NDF, and ADF contents. One of the methods facilitating the reuse of residues is their application in animal feed industries. Accordingly, using SGR and SR, by-products of industry and agriculture, as animal feed, not only reduces production costs and is a cost-effective protein supplement feed, but also improves the utilization of feed resource waste and ultimately makes the feed more nutritionally balanced.
Gas production in the rumen is basically the result of the fermentation of carbohydrates into VFA and substantial changes in carbohydrate fractions are reflected by the total gas produced [28,29,30,31]. H2 is produced in the rumen during the microbial fermentation of dietary carbohydrates and is consumed as an energy source by H2-using microbes, especially the CH4-forming methanogens [32]. Ruminal CH4 is produced through the CO2–H2 reduction pathway under the action of methanogens [21]. Natural additives have the potential to modulate rumen fermentation and improve animal performance [33,34].
In the present study, although dietary supplementation with TSO did not markedly alter the gas production during in vitro incubation, total gas production and CH4 in the treatment group were lower than in the control group. This might be associated with the potential of bioactive compounds of TSO to act as rumen fermentation modifiers to possibly mitigate enteric gas and CH4 production.
Rumen health and internal environmental stability are of great significance to ruminants. The rumen pH is an important factor in the process of anaerobic fermentation, which has an obvious effect on the hydrolysis and acidogenesis of rumen microorganisms [35]. In the current study, the changes in ruminal pH of the substrate with or without three different levels of TSO were maintained within the normal range (5.5 to 7.5) [36], indicating that all diets produced stable rumen fermentation levels, which can be attributed to the GSR and SR diets with TSO supplementation that enhance ruminal fermentation capacity. VFA production by ruminal micro-organisms accounts for 60–70% of the metabolizable energy supply in ruminants [37]. The effect of EOs or any feed additive on rumen fermentation is considered positive when there is increased total volatile fatty acid (TVFA) and propionate production and a decreased acetate-to-propionate ratio [38,39]. Some of the studies in the literature indicate a detrimental effect of higher EO inclusion on in vitro rumen fermentation, including a reduction in TVFA production and a reduction in CH4 synthesis [40,41,42,43,44,45]. The decrease in VFA and NH3-N production at the higher doses of TSO in the present study might be due to a depressing effect on microbial fermentation [46]. Fermentation end products are very complex and the variability in the response of EOs might be due to the chemical composition of EOs affecting their antimicrobial activities. This is highly variable and depends on many factors, such as plant species, stage of growth, parts of a plant, and extraction method [47]. Rumen microorganisms can degrade crude protein from feed and saliva to produce ammonia, small peptides, and amino acids, and use these degradation products as nitrogen sources to synthesize MCP [48,49,50]. In the rumen, the MCP level usually reflects the growth rate and the population of rumen microbes [49]. The increase in MCP observed in response to TSO treatments in the present study is favorable, particularly in the case of the T2 and T3 groups, suggesting the positive effect of TSO on microbial populations.
The digestibility of feed nutrients is influenced by various factors, such as dietary quality, animal feed intake, feed retention time in the rumen, chyme flow rate, and rumen microbial activity [51]. In the current study, treatments increased the DM digestibility; the highest percentage (56.68%) was observed for T2, followed by T3 (56.26%), and T1 (55.50%). This could be due to oil prolonging the residence time of feed in the digestive tract, thereby improving the digestibility and absorption of feed nutrients. The degradation of rumen microorganisms is the main factor influencing protein digestion and utilization; thus, in the rumen of ruminants, protein is first degraded by protein-decomposing bacteria into amino acids, small peptides, and ammonia, and then converted into microbial proteins through energy conversion in the rumen, which are finally utilized by an animal [52]. In the current study, T2 had higher CP digestibility than the CT group. This may be caused by the ability of TSO to promote the growth of protein-decomposing microorganisms by providing protein-degrading enzymes that aid digestion by degrading proteins with complex structures and high molecular weights [53].
Feed lipids are quickly hydrolyzed and free fatty acids are released under the action of microbial lipase after they enter the rumen; unsaturated fatty acids are quickly hydrogenated into saturated fat fatty acids by microorganisms [54,55]. However, due to the incomplete hydrogenation process, a series of intermediate products such as trans11-C18:1, C18:1, conjugated linoleic acid, and its isomers are generated [56]. Furthermore, reductase, isomerase, and rumen esterase also play an important role in fatty acid metabolism, which further protects polyunsaturated fatty acids from microbial hydrogenation [57]. Supplementation with TSO increased the concentrations of C18:3n6, C18:2n6c, C18:2 trans-10, cis-12, and C20:4n6 compared to the control. These positive effects may be related to the oleic-acid-rich composition and the presence of varying bioactive compounds in TSO [58]. However, compared to CT, supplementation with TSO decreased the concentration of C18:1n9c and C18:0. The inhibition effect of fatty acids on rumen fermentation may be due to fatty acids adhering to the feed surface, hindering microorganism decomposition of the feed substrate [59].
The microbial community of the rumen is complex and consists of bacteria, protozoa, archaea, and fungi. It has been established that the composition and activity of the rumen microbiota have a profound impact on the performance, health, and immune system of the host [60,61,62]. Quantitative PCR indicated that TSO treatments did not substantially alter the populations of methanogens, protozoa, and fungi. However, total bacterial populations were markedly decreased when diets were supplemented with TSO at 1% DM. The inhibitory activity of TSO against bacteria has been evidenced by the ability of TSO to form complexes with the cell wall and membrane of bacteria, causing morphological changes in the cell wall and the secretion of extracellular enzymes [63].
Microorganisms in the rumen are important intermediaries such that ruminants can digest nutrients in their diets [64]. The alpha diversity analysis of buffalo rumen flora in this study showed that the coverage of each group was higher than 98%, indicating that the sequencing results truly reflected the species and structural diversity of the rumen bacterial community. However, there were no marked differences in Shannon, Simpson, Chao, Ace, Observed_species, and goods_coverage indices, indicating that the sequencing depth was desirable for the analysis and that TSO supplementation did not affect the richness and diversity of the bacterial community. Beta diversity produced similar clusters in the treatment and control groups, indicating a similarity in rumen flora composition. Ruminant animals have a very diverse bacterial community [65]. In the current study, Firmicutes and Bacteroidota were the prevalent phyla, which concurs with the results of previous studies [18,21]. The relative abundance of Acidobacteriota, Muribaculaceae, Campylobacterota, Anaerovorax, Ruminococcus, [Eubacterium]_oxidoreducens_group, Anaerovibrio, and Prevotellaceae_NK3B31_group were increased but Actinobacteriota, Family_XIII_AD3011_group, Lachnospiraceae_UCG-008, and Mogibacterium decreased with the addition of TSO and may indicate an antibacterial potency of TSO [66,67]. The results indicated that the addition of TSO affected the composition of rumen bacteria to a certain extent.
5. Conclusions
Our study demonstrated that TSO could regulate the number and diversity of rumen microorganisms through antimicrobial activity, thereby affecting rumen fermentation patterns, reducing methane production, and improving nutrient digestibility. The modulation of fermentation by TSO inclusion altered many ruminal bacterial genera that are associated with feed digestibility and ruminal fermentation characteristics. Thus, an optimal feeding rate for future animal studies appears to be 1% TSO of dietary dry matter for ruminants. However, further in vivo experimental studies should be carried out to determine the optimal dose of TSO in diets for various dietary types and growth stages of ruminants, to evaluate its effect on the adaptive characteristics of rumen microbiota and animal production.
Author Contributions
Conceptualization, C.Y. and H.X.; methodology, H.X.; software, H.X.; validation, C.Y., H.X. and Y.G.; formal analysis, F.Z.; investigation, H.X. and Y.G.; resources, X.L. and L.P.; data curation, H.X.; writing—original draft preparation, H.X.; writing—review and editing, H.X. and C.Y.; supervision, C.Y.; project administration, H.X.; funding acquisition, H.X. and C.Y. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by the Guangxi Natural Science Foundation (2023GXNSFBA026301), the Guangxi Science and Technology Major Project (GuiKe AA22068099), and the National Modern Agricultural Industry Technology System Guangxi Dairy Buffalo In novation Team Project (nycytxgxcxtd-2021-21-03).
Institutional Review Board Statement
Sample collection and experimental protocols were performed in accordance with Chinese regulations on animal welfare. This project was approved by the Ethics committee of the Chinese Academy of Agriculture Sciences, Guangxi Buffalo Research Institute, China (Approval Number BRI-2020-007).
Informed Consent Statement
Not applicable.
Data Availability Statement
Data not available online are available from the authors upon request.
Conflicts of Interest
The authors declare no conflict of interest.
References
- Li, C.; Lin, L.M.; Sui, F.; Wang, Z.M.; Huo, H.R.; Dai, L.; Jiang, T.L. Chemistry and pharmacology of Siraitia grosvenorii: A review. Chin. J. Nat. Med. 2014, 12, 89–102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Y.; Zhang, Y.; Wang, M.; Wang, L.; Zheng, W.; Zeng, Q.; Wang, K. Comparison of the basic processes of aerobic, anaerobic, and aerobic-anaerobic coupling composting of Chinese medicinal herbal residues. Bioresour. Technol. 2023, 379, 128996. [Google Scholar] [CrossRef] [Scilit]
- Guo, Y.; Xie, H.; Peng, L.; Peng, K.; Huang, Y.; Yang, C. Research Progress on Nutritional Characteristics of Siraitia Grosvenorii Residue and Its Application in Animal Production. Cont. Anim. Hus. 2022, 12, 37–41. [Google Scholar]
- Salakkam, A.; Kingpho, Y.; Najunhom, S.; Aiamsonthi, K.; Kaewlao, S.; Reungsang, A. Bioconversion of soybean residue for use as alternative nutrient source for ethanol fermentation. Biochem. Eng. J. 2017, 125, 65–72. [Google Scholar] [CrossRef] [Scilit]
- Hu, Y.; Piao, C.; Chen, Y.; Zhou, Y.; Wang, D.; Yu, H.; Xu, B. Soybean residue (okara) fermentation with the yeast Kluyveromyces marxianus. Food Biosci. 2019, 31, 10439. [Google Scholar] [CrossRef] [Scilit]
- Li, B.; Qiao, M.; Lu, F. Composition, Nutrition, and Utilization of Okara (Soybean residue). Food Rev. Int. 2012, 28, 231–252. [Google Scholar] [CrossRef] [Scilit]
- Redondo-Cuenca, A.; Villanueva-Suarez, M.J.; Mateos-Aparicio, I. Soybean seeds and its by-product okara as sources of dietary fibre. Measurement by AOAC and Englyst methods. Food Chem. 2008, 108, 1099–1105. [Google Scholar] [CrossRef] [Scilit]
- O’Toole, D.K. Characteristics and Use of Okara, the Soybean Residue from Soy Milk ProductionsA Review. J. Agric. Food Chem. 1999, 47, 363–371. [Google Scholar] [CrossRef] [Scilit]
- Vong, W.C.; Liu, S.-Q. Biovalorisation of okara (soybean residue) for food and nutrition. Trends Food Sci. Technol. 2016, 52, 139–147. [Google Scholar] [CrossRef] [Scilit]
- Cobellis, G.; Trabalza-Marinucci, M.; Yu, Z. Critical evaluation of essential oils as rumen modifiers in ruminant nutrition: A review. Sci. Total Environ. 2016, 545–546, 556–568. [Google Scholar] [CrossRef] [Scilit]
- Castillejos, L.; Calsamiglia, S.; Ferret, A. Effect of Essential Oil Active Compounds on Rumen Microbial Fermentation and Nutrient Flow in In Vitro Systems. J. Dairy Sci. 2006, 89, 2649–2658. [Google Scholar] [CrossRef] [Scilit]
- Kolling, G.J.; Stivanin, S.C.B.; Gabbi, A.M.; Machado, F.S.; Ferreira, A.L.; Campos, M.M.; Tomich, T.R.; Cunha, C.S.; Dill, S.W.; Pereira, L.G.R.; et al. Performance and methane emissions in dairy cows fed oregano and green tea extracts as feed additives. J. Dairy Sci. 2018, 101, 4221–4234. [Google Scholar] [CrossRef] [Scilit]
- Santos, F.H.; De Paula, M.R.; Lezier, D.; Silva, J.T.; Santos, G.; Bittar, C.M. Essential oils for dairy calves: Effects on performance, scours, rumen fermentation and intestinal fauna. Animal 2015, 9, 958–965. [Google Scholar] [CrossRef] [Scilit]
- Nunes, H.P.B.; Maduro Dias, C.; Borba, A.E.S. Bioprospecting essential oils of exotic species as potential mitigations of ruminant enteric methanogenesis. Heliyon 2023, 9, e12786. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liew, F.F.; Chan, K.W.; Ooi, D.J. Biological activities of tea seed (Camellia oleifera Abel.) oil. In Multiple Biological Activities of Unconventional Seed Oils; Academic Press: Cambridge, MA, USA; Elsevier: Amsterdam, The Netherlands, 2022; pp. 237–251. [Google Scholar]
- Lee, C.P.; Yen, G.C. Antioxidant activity and bioactive compounds of tea seed (Camellia oleifera Abel.) oil. J. Agric. Food Chem. 2006, 54, 779–784. [Google Scholar] [CrossRef] [Scilit]
- Chaicharoenpong, C. Chapter 22–Tea (Camellia oleifera) Seeds: Use of Tea Seeds in Human Health. In Nuts and Seeds in Health and Disease Prevention, 2nd ed.; Preedy, V.R., Watson, R.R., Eds.; Academic Press: Cambridge, MA, USA; Elsevier: Amsterdam, The Netherlands, 2020; pp. 299–313. [Google Scholar]
- Guo, Y.; Hassan, F.-U.; Li, M.; Xie, H.; Peng, L.; Tang, Z.; Yang, C. Effect of Sodium Nitrate and Cysteamine on In Vitro Ruminal Fermentation, Amino Acid Metabolism and Microbiota in Buffalo. Microorganisms 2022, 10, 2038. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Azizi, A.; Sharifi, A.; Fazaeli, H.; Azarfar, A.; Jonker, A.; Kiani, A. Effect of transferring lignocellulose-degrading bacteria from termite to rumen fluid of sheep on in vitro gas production, fermentation parameters, microbial populations and enzyme activity. J. Integr. Agric. 2020, 19, 1323–1331. [Google Scholar] [CrossRef] [Scilit]
- Broderick, G.A.; Kang, J.H. Automated Simultaneous Determination of Ammonia and Total Amino Acids in Ruminal Fluid and In Vitro Media. J. Dairy Sci. 1980, 63, 64–75. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, Y.; Hassan, F.U.; Li, M.; Tang, Z.; Peng, L.; Peng, K.; Yang, C. Effect of Hydrogen-Consuming Compounds on In Vitro Ruminal Fermentation, Fatty Acids Profile, and Microbial Community in Water Buffalo. Curr. Microbiol. 2022, 79, 220. [Google Scholar] [CrossRef] [Scilit]
- AOAC. Official Methods of Analysis, 15th ed.; Association of Official Analytical Chemists: Arlington, VA, USA, 1990. [Google Scholar]
- Van Soest, P.J.; Robertson, J.B.; Lewis, B.A. Methods for Dietary Fiber, Neutral Detergent Fiber, and Nonstarch Polysaccharides in Relation to Animal Nutrition. J. Dairy Sci. 1991, 74, 3583–3597. [Google Scholar] [CrossRef] [Scilit]
- Denman, S.E.; McSweeney, C.S. Development of a real-time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within the rumen. FEMS Microbiol. Ecol. 2006, 58, 572–582. [Google Scholar] [CrossRef] [Scilit]
- Ebeid, H.M.; Li, M.; Kholif, A.E.; Faizul, H.; Peng, L.; Liang, X.; Yang, C. Moringa Oleifera Oil Modulates Rumen Microflora to Mediate In Vitro Fermentation Kinetics and Methanogenesis in Total Mix Rations. Curr. Microbiol. 2020, 77, 1271–1282. [Google Scholar] [CrossRef] [Scilit]
- Shingfield, K.J.; Kairenius, P.; Arola, A.; Paillard, D.; Muetzel, S.; Ahvenjarvi, S.; Vanhatalo, A.; Huhtanen, P.; Toivonen, V.; Griinari, J.M.; et al. Dietary fish oil supplements modify ruminal biohydrogenation, alter the flow of fatty acids at the omasum, and induce changes in the ruminal Butyrivibrio population in lactating cows. J. Nutr. 2012, 142, 1437–1448. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Denman, S.E.; Tomkins, N.W.; McSweeney, C.S. Quantitation and diversity analysis of ruminal methanogenic populations in response to the antimethanogenic compound bromochloromethane. FEMS Microbiol. Ecol. 2007, 62, 313–322. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xie, H.; Xie, F.; Guo, Y.; Liang, X.; Peng, L.; Li, M.; Tang, Z.; Peng, K.; Yang, C. Fermentation quality, nutritive value and in vitro ruminal digestion of Napier grass, sugarcane top and their mixed silages prepared using lactic acid bacteria and formic acid. Grassl. Sci. 2023, 69, 23–32. [Google Scholar] [CrossRef] [Scilit]
- Akinfemi, A.; Adesanya, A.O.; Ay, V.E. Use of an in vitro gas production technique to evaluate some Nigerian feedstuffs. Am.-Euras. J. Sci. Res. 2009, 4, 240–245. [Google Scholar]
- Getachew, G.; Robinson, P.H.; DePeters, E.J.; Taylor, S.J. Relationships between chemical composition, dry matter degradation and in vitro gas production of several ruminant feeds. Anim. Feed Sci. Technol. 2004, 111, 57–71. [Google Scholar] [CrossRef] [Scilit]
- Melesse, A.; Steingass, H.; Boguhn, J.; Rodehutscord, M. In vitro fermentation characteristics and effective utilisable crude protein in leaves and green pods of Moringa stenopetala and Moringa oleifera cultivated at low and mid-altitudes. J. Anim. Physiol. Anim. Nutr. 2013, 97, 537–546. [Google Scholar] [CrossRef] [Scilit]
- Wang, M.; Janssen, P.H.; Sun, X.Z.; Muetzel, S.; Tavendale, M.; Tan, Z.L.; Pacheco, D. A mathematical model to describe in vitro kinetics of H2 gas accumulation. Anim. Feed Sci. Technol. 2013, 184, 1–16. [Google Scholar] [CrossRef] [Scilit]
- Ornaghi, M.G.; Passetti, R.A.C.; Torrecilhas, J.A.; Mottin, C.; Vital, A.C.P.; Guerrero, A.; Sañudo, C.; del Mar Campo, M.; Prado, I.N. Essential oils in the diet of young bulls: Effect on animal performance, digestibility, temperament, feeding behaviour and carcass characteristics. Anim. Feed Sci. Technol. 2017, 234, 274–283. [Google Scholar] [CrossRef] [Scilit]
- Geraci, J.I.; Garciarena, A.D.; Gagliostro, G.A.; Beauchemin, K.A.; Colombatto, D. Plant extracts containing cinnamaldehyde, eugenol and capsicum oleoresin added to feedlot cattle diets: Ruminal environment, short term intake pattern and animal performance. Anim. Feed Sci. Technol. 2012, 176, 123–130. [Google Scholar] [CrossRef] [Scilit]
- Hu, Z.H.; Wang, G.; Yu, H.Q. Anaerobic degradation of cellulose by rumen microorganisms at various pH values. Biochem. Eng. J. 2004, 21, 59–62. [Google Scholar] [CrossRef] [Scilit]
- Luan, J.; Feng, X.; Yang, D.; Yang, M.; Zhou, J.; Geng, C. Effects of medium-chain fatty acids (MCFAs) on in vitro rumen fermentation, methane production, and nutrient digestibility under low- and high-concentrate diets. Anim. Sci. J. 2023, 94, e13818. [Google Scholar] [CrossRef] [Scilit]
- Seymour, W.M.; Campbell, D.R.; Johnson, Z.B. Relationships between rumen volatile fatty acid concentrations and milk production in dairy cows: A literature study. Anim. Feed Sci. Technol. 2005, 119, 155–169. [Google Scholar] [CrossRef] [Scilit]
- Pawar, M.M.; Kamra, D.N.; Agarwal, N.; Chaudhary, L.C. Effects of Essential Oils on In Vitro Methanogenesis and Feed Fermentation with Buffalo Rumen Liquor. Agric. Res. 2014, 3, 67–74. [Google Scholar] [CrossRef] [Scilit]
- Castillejos, L.; Calsamiglia, S.; Martín-Tereso, J.; Ter Wijlen, H. In vitro evaluation of effects of ten essential oils at three doses on ruminal fermentation of high concentrate feedlot-type diets. Anim. Feed Sci. Technol. 2008, 145, 259–270. [Google Scholar] [CrossRef] [Scilit]
- Cardozo, P.W.; Calsamiglia, S.; Ferret, A.; Kamel, C. Screening for the effects of natural plant extracts at different pH on in vitro rumen microbial fermentation of a high-concentrate diet for beef cattle. J. Anim. Sci. 2005, 83, 2572–2579. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Busquet, M.; Calsamiglia, S.; Ferret, A.; Kamel, C. Plant Extracts Affect In Vitro Rumen Microbial Fermentation. J. Dairy Sci. 2006, 89, 761–771. [Google Scholar] [CrossRef] [Scilit]
- Castillejos, L.; Calsamiglia, S.; Ferret, A.; Losa, R. Effects of dose and adaptation time of a specific blend of essential oil compounds on rumen fermentation. Anim. Feed Sci. Technol. 2007, 132, 186–201. [Google Scholar] [CrossRef] [Scilit]
- Patra, A.K. Effects of Essential Oils on Rumen Fermentation, Microbial Ecology and Ruminant Production. Asian J. Anim. Vet. Adv. 2011, 6, 416–428. [Google Scholar] [CrossRef] [Scilit]
- Kumar, R.; Kamra, D.N.; Agarwal, N.; Chaudhary, L.C. Effect of Eucalyptus (Eucalyptus globulus) Oil on in vitro Methanogenesis and Fermentation of Feed with Buffalo Rumen Liquor. Anim. Nutr. Feed Techn. 2009, 9, 237–243. [Google Scholar]
- Macheboeuf, D.; Morgavi, D.P.; Papon, Y.; Mousset, J.L.; Arturo-Schaan, M. Dose–response effects of essential oils on in vitro fermentation activity of the rumen microbial population. Anim. Feed Sci. Technol. 2008, 145, 335–350. [Google Scholar] [CrossRef] [Scilit]
- Roy, D.; Tomar, S.K.; Sirohi, S.K.; Kumar, V.; Kumar, M. Efficacy of different essential oils in modulating rumen fermentation in vitro using buffalo rumen liquor. Vet. World 2014, 7, 213–218. [Google Scholar] [CrossRef] [Scilit]
- Cobellis, G.; Trabalza-Marinucci, M.; Marcotullio, M.C.; Yu, Z. Evaluation of different essential oils in modulating methane and ammonia production, rumen fermentation, and rumen bacteria in vitro. Anim. Feed Sci. Technol. 2016, 215, 25–36. [Google Scholar] [CrossRef] [Scilit]
- Pang, D.G.; Yang, H.J.; Cao, B.B.; Wu, T.T.; Wang, J.Q. The beneficial effect of Enterococcus faecium on the in vitro ruminal fermentation rate and extent of three typical total mixed rations in northern China. Livest. Sci. 2014, 167, 154–160. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.L.; Zhang, Z.H.; Wang, W.K.; Wu, Q.C.; Zhang, F.; Li, W.J.; Li, S.L.; Wang, W.; Cao, Z.J.; Yang, H.J. The Effect of γ-Aminobutyric Acid Addition on In Vitro Ruminal Fermentation Characteristics and Methane Production of Diets Differing in Forage-to-Concentrate Ratio. Fermentation 2023, 9, 105. [Google Scholar] [CrossRef] [Scilit]
- Chanthakhoun, V.; Wanapat, M.; Berg, J. Level of crude protein in concentrate supplements influenced rumen characteristics, microbial protein synthesis and digestibility in swamp buffaloes (Bubalus bubalis). Livest. Sci. 2012, 144, 197–204. [Google Scholar] [CrossRef] [Scilit]
- Cherif, C.; Hassanat, F.; Claveau, S.; Girard, J.; Gervais, R.; Benchaar, C. Faba bean (Vicia faba) inclusion in dairy cow diets: Effect on nutrient digestion, rumen fermentation, nitrogen utilization, methane production, and milk performance. J. Dairy Sci. 2018, 101, 8916–8928. [Google Scholar] [CrossRef] [Scilit]
- Dewhurst, R.J.; Davies, D.R.; Merry, R.J. Microbial protein supply from the rumen. Anim. Feed Sci. Technol. 2000, 85, 1–21. [Google Scholar] [CrossRef] [Scilit]
- Joch, M.; Kudrna, V.; Hakl, J.; Božik, M.; Homolka, P.; Illek, J.; Tyrolová, Y.; Výborná, A. In vitro and in vivo potential of a blend of essential oil compounds to improve rumen fermentation and performance of dairy cows. Anim. Feed Sci. Technol. 2019, 251, 176–186. [Google Scholar] [CrossRef] [Scilit]
- Bionaz, M.; Vargas-Bello-Perez, E.; Busato, S. Advances in fatty acids nutrition in dairy cows: From gut to cells and effects on performance. J. Anim. Sci. Biotechnol. 2020, 11, 110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jenkins, T.C. Lipid Metabolism in the Rumen. J. Dairy Sci. 1993, 76, 3851–3863. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wahle, K.W.; Heys, S.D.; Rotondo, D. Conjugated linoleic acids: Are they beneficial or detrimental to health? Prog. Lipid Res. 2004, 43, 553–587. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arif, M.; Sarwar, M.; Mehr-Un-Nisa; Hayat, Z.; Younas, M. Effect of Supplementary sodium nitrate and sulphur on methane production and growth rates in sheep and goats fed forage based diet low in true protein. J. Anim. Plant Sci. 2016, 26, 69–78. [Google Scholar]
- Zarringhalami, S.; Sahari, M.A.; Barzegar, M.; Hamidi-Esfehani, Z. Changes in Oil Content, Chemical Properties, Fatty Acid Composition and Triacylglycerol Species of Tea Seed Oil during Maturity Period. J. Food Biochem. 2011, 35, 1161–1169. [Google Scholar] [CrossRef] [Scilit]
- Yang, Z.; Liu, S.; Xie, T.; Wang, Q.; Wang, Z.; Yang, H.; Li, S.; Wang, W. Effect of Unsaturated Fatty Acid Ratio In Vitro on Rumen Fermentation, Methane Concentration, and Microbial Profile. Fermentation 2022, 8, 540. [Google Scholar] [CrossRef] [Scilit]
- Wang, B.; Ma, M.P.; Diao, Q.Y.; Tu, Y. Saponin-Induced Shifts in the Rumen Microbiome and Metabolome of Young Cattle. Front. Microbiol. 2019, 10, 356. [Google Scholar] [CrossRef] [Scilit]
- Jami, E.; White, B.A.; Mizrahi, I. Potential role of the bovine rumen microbiome in modulating milk composition and feed efficiency. PLoS ONE 2014, 9, e85423. [Google Scholar] [CrossRef] [Scilit]
- Huws, S.A.; Creevey, C.J.; Oyama, L.B.; Mizrahi, I.; Denman, S.E.; Popova, M.; Munoz-Tamayo, R.; Forano, E.; Waters, S.M.; Hess, M.; et al. Addressing Global Ruminant Agricultural Challenges Through Understanding the Rumen Microbiome: Past, Present, and Future. Front. Microbiol. 2018, 9, 2161. [Google Scholar] [CrossRef] [Scilit]
- Dong, L.; Liu, J.; Zhong, Z.; Wang, S.; Wang, H.; Huo, Y.; Wei, Z.; Yu, L. Dietary tea tree oil supplementation improves the intestinal mucosal immunity of weanling piglets. Anim. Feed Sci. Technol. 2019, 255, 114209. [Google Scholar] [CrossRef] [Scilit]
- Kong, F.; Liu, Y.; Wang, S.; Zhang, Y.; Wang, W.; Yang, H.; Lu, N.; Li, S. Nutrient Digestibility, Microbial Fermentation, and Response in Bacterial Composition to Methionine Dipeptide: An In Vitro Study. Biology 2022, 11, 93. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, M.; Morrison, M.; Yu, Z. Status of the phylogenetic diversity census of ruminal microbiomes. FEMS Microbiol. Ecol. 2011, 76, 49–63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, R.; Wu, J.; Lang, X.; Liu, L.; Casper, D.P.; Wang, C.; Zhang, L.; Wei, S. Effects of oregano essential oil on in vitro ruminal fermentation, methane production, and ruminal microbial community. J. Dairy Sci. 2020, 103, 2303–2314. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ferme, D.; Banjac, M.; Calsamiglia, S.; Busquet, M.; Kamel, C.; Avgu Tin, G. The effects of plant extracts on microbial community structure in a rumen-simulating continuous-culture system as revealed by molecular profiling. Folia Microbiol. 2004, 49, 151–155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).








