Comparative Phylogeography of Two Specialist Rodents in Forest Fragments in Kenya
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Area
2.2. Field Sampling Design
2.3. DNA Extraction, Amplification, Sequencing, and Sequence Alignment
2.4. Data Analysis
2.4.1. Phylogenetic Analysis and Species Delimitation
2.4.2. Genetic Diversity and Population Structure Analyses
2.4.3. Demographic Structure, Lineage Divergence, and Historical Demography Analyses
2.4.4. Morphological Trait Analysis
2.4.5. Climate and Human Activity Impacts on Species Ranges
3. Results
3.1. Sampling/Sample Summary
3.2. Morphological Differentiation
3.3. Phylogenetic Associations
3.4. Genetic Diversity and Genetic Relationships
3.5. Evolutionary Divergence, Historical Biogeography, and Population Dynamics
3.6. Climate- and Human-Driven Habitat Changes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Gene | Primers | PCR Conditions | |||
---|---|---|---|---|---|
Primer ID | Primer Sequence | Reference | Denaturation | Annealing | Extension | # Cycles | ||
Cytb | F | 14724-L | GGACTTATGACATGAAAAATCATCGTTG | [132] | 30 s 95.0 °C | 30 s, 59.0 °C | 60 s, 72.0 °C | 40 |
R | 14139-H | GATTCCCCATTTCTGGTTTACAAGAC | |||
D-loop | F | Dloop-L | CTGGTCTTGTAAACCAGAAATG | [14] | 30 s, 95.0 °C | 30 s, 56.0 °C | 30 s, 72.0 °C | 35 |
R | Dloop-H | CCATCTAAGCATTTTCAGTGCTTT | |||
RBP3-1 | F | RBP-L1 | ATGACGAGAGAATGGGCCC | [133] | 20 s, 94.0 °C | 20 s, 52.0 °C | 80 s, 72.0 °C | 10 |
R | RBP-H1 | CTGGTGAGGACCACCACATCCTT | |||
RBP3-2 | F | RBP-L2 | ATGGCCAAGGTCCTCTTGGATAACTACTGCTT | 20 s, 94.0 °C | 20 s, 56.0 °C | 80 s, 72.0 °C | 20 | |
R | RBP-H2 | CGCAGGTCCATGATGAGGTGCTCCGTGTCCTG |
Taxon | Mean | 2.5% Quantile | 97.5% Quantile | M | S | Estimated Time | Range |
---|---|---|---|---|---|---|---|
Acomys | 5.76 | 5.34 | 6.22 | 1.751 | 0.039 | 5.76 | 5.30–6.22 |
Praomys | 5.69 | 5.16 | 6.25 | 1.737 | 0.049 | 5.68 | 0.00–6.25 |
Hylomyscus | 6.56 | 2.45 | 12.5 | 1.780 | 0.451 | 5.93 | 0.00–14.34 |
Praomys jacksoni | 2.29 | 1.24 | 3.55 | 0.788 | 0.292 | 3.08 | 2.19–3.90 |
Hylomyscus endorobae | 5.53 | 3.53 | 8.24 | 1.686 | 0.216 | 5.40 | 4.17–8.25 |
References
- Fahrig, L. Effects of Habitat Fragmentation on Biodiversity. Annu. Rev. Ecol. Evol. Syst. 2003, 34, 487–515. [Google Scholar] [CrossRef]
- Schlaepfer, D.R.; Braschler, B.; Rusterholz, H.-P.; Baur, B. Genetic effects of anthropogenic habitat fragmentation on remnant animal and plant populations: A meta-analysis. Ecosphere 2018, 9, e02488. [Google Scholar] [CrossRef]
- Kuipers, K.J.J.; Hilbers, J.P.; Garcia-Ulloa, J.; Graae, B.J.; May, R.; Verones, F.; Huijbregts, M.A.J.; Schipper, A.M. Habitat fragmentation amplifies threats from habitat loss to mammal diversity across the world’s terrestrial ecoregions. One Earth 2021, 4, 1505–1513. [Google Scholar] [CrossRef]
- Wilson, M.C.; Chen, X.-Y.; Corlett, R.T.; Didham, R.K.; Ding, P.; Holt, R.D.; Holyoak, M.; Hu, G.; Hughes, A.C.; Jiang, L. Habitat fragmentation and biodiversity conservation: Key findings and future challenges. Landsc. Ecol. 2016, 31, 219–227. [Google Scholar] [CrossRef]
- Lopez, S.; Rousset, F.; Shaw, F.H.; Shaw, R.G.; Ronce, O. Joint Effects of Inbreeding and Local Adaptation on the Evolution of Genetic Load after Fragmentation. Conserv. Biol. 2009, 23, 1618–1627. [Google Scholar] [CrossRef] [PubMed]
- Laland, K.N.; Odling-Smee, F.J.; Feldman, M.W. Evolutionary consequences of niche construction and their implications for ecology. Proc. Natl. Acad. Sci. USA 1999, 96, 10242–10247. [Google Scholar] [CrossRef]
- Males, J.; Neate-Clegg, M.H.C.; Tingley, M.W. Building a mechanistic understanding of climate-driven elevational shifts in birds. PLoS Clim. 2023, 2, e0000174. [Google Scholar]
- Maslin, M.A.; Brierley, C.M.; Milner, A.M.; Shultz, S.; Trauth, M.H.; Wilson, K.E. East African climate pulses and early human evolution. Quat. Sci. Rev. 2014, 101, 1–17. [Google Scholar] [CrossRef]
- Peyron, O.; Jolly, D.; Bonnefille, R.; Vincens, A.; Guiot, J. Climate of East Africa 6000 14C Yr B.P. as Inferred from Pollen Data. Quat. Res. 2017, 54, 90–101. [Google Scholar] [CrossRef]
- Peter, B.d. African climate change and faunal evolution during the Pliocene–Pleistocene. Earth Planet. Sci. Lett. 2004, 220, 3–24. [Google Scholar]
- Maslin, M.A.; Christensen, B. Tectonics, orbital forcing, global climate change, and human evolution in Africa: Introduction to the African paleoclimate special volume. J. Hum. Evol. 2007, 53, 443–464. [Google Scholar] [CrossRef] [PubMed]
- Baxter, A.J.; Verschuren, D.; Peterse, F.; Miralles, D.G.; Martin-Jones, C.M.; Maitituerdi, A.; Van der Meeren, T.; Van Daele, M.; Lane, C.S.; Haug, G.H.; et al. Reversed Holocene temperature–moisture relationship in the Horn of Africa. Nature 2023, 620, 336–343. [Google Scholar] [CrossRef] [PubMed]
- Marchant, R. Climate Change in Eastern Africa. Oxf. Res. Encycl. Afr. Hist. 2021. [Google Scholar] [CrossRef]
- Huhndorf, M.H.; Kerbis Peterhans, J.C.; Loew, S.S. Comparative phylogeography of three endemic rodents from the Albertine Rift, east central Africa. Mol. Ecol. 2007, 16, 663–674. [Google Scholar] [CrossRef]
- Nicolas, V.; Missoup, A.D.; Denys, C.; Kerbis Peterhans, J.; Katuala, P.; Couloux, A.; Colyn, M. The roles of rivers and Pleistocene refugia in shaping genetic diversity in Praomys misonnei in tropical Africa. J. Biogeogr. 2011, 38, 191–207. [Google Scholar] [CrossRef]
- Bryja, J.; Mikula, O.; Patzenhauerová, H.; Oguge, N.O.; Šumbera, R.; Verheyen, E.; Riddle, B. The role of dispersal and vicariance in the Pleistocene history of an East African mountain rodent, Praomys delectorum. J. Biogeogr. 2014, 41, 196–208. [Google Scholar] [CrossRef]
- Mizerovská, D.; Nicolas, V.; Demos, T.C.; Akaibe, D.; Colyn, M.; Denys, C.; Kaleme, P.K.; Katuala, P.; Kennis, J.; Kerbis Peterhans, J.C.; et al. Genetic variation of the most abundant forest-dwelling rodents in Central Africa (Praomys jacksoni complex): Evidence for Pleistocene refugia in both montane and lowland forests. J. Biogeogr. 2019, 46, 1466–1478. [Google Scholar] [CrossRef]
- Nicolas, V.; Fabre, P.H.; Bryja, J.; Denys, C.; Verheyen, E.; Missoup, A.D.; Olayemi, A.; Katuala, P.; Dudu, A.; Colyn, M.; et al. The phylogeny of the African wood mice (Muridae, Hylomyscus) based on complete mitochondrial genomes and five nuclear genes reveals their evolutionary history and undescribed diversity. Mol. Phylogenet. Evol. 2020, 144, 106703. [Google Scholar] [CrossRef]
- Komarova, V.A.; Kostin, D.S.; Bryja, J.; Mikula, O.; Bryjová, A.; Čížková, D.; Šumbera, R.; Meheretu, Y.; Lavrenchenko, L.A. Complex reticulate evolution of speckled brush-furred rats (Lophuromys) in the Ethiopian centre of endemism. Mol. Ecol. 2021, 30, 2349–2365. [Google Scholar] [CrossRef]
- Onditi, K.O.; Demos, T.C.; Kerbis Peterhans, J.; Chen, Z.Z.; Bryja, J.; Lavrenchenko, L.A.; Musila, S.; Verheyen, E.; Van de Perre, F.; Akaibe, B.D.; et al. Historical biogeography, systematics, and integrative taxonomy of the non-Ethiopian speckled pelage brush-furred rats (Lophuromys flavopunctatus group). BMC Ecol. Evol. 2021, 21, 89. [Google Scholar] [CrossRef]
- Burton, A.C.; Beirne, C.; Gaynor, K.M.; Sun, C.; Granados, A.; Allen, M.L.; Alston, J.M.; Alvarenga, G.C.; Calderón, F.S.Á.; Amir, Z.; et al. Mammal responses to global changes in human activity vary by trophic group and landscape. Nat. Ecol. Evol. 2024, 8, 924–935. [Google Scholar] [CrossRef] [PubMed]
- Rowan, J.; Du, A.; Lundgren, E.J.; Faith, J.T.; Beaudrot, L.; Campisano, C.J.; Joordens, J.C.; Lazagabaster, I.A.; Locke, E.M.; Smail, I.E.; et al. Long-term biotic homogenization in the East African Rift System over the last 6 million years of hominin evolution. Nat. Ecol. Evol. 2024, 8, 1751–1759. [Google Scholar] [CrossRef] [PubMed]
- Mammal Diversity Database. Mammal Diversity Database (Version 1.13) [Data Set]. Zenodo. Available online: https://mammaldiversity.org/ (accessed on 13 August 2024).
- Monadjem, A.; Taylor, P.J.; Denys, C.; Cotterill, F.P.D.; Monadjem, A.; Taylor, P.J.; Denys, C.; Cotterill, F.P.D. Rodents of Sub-Saharan Africa: A Biogeographic and Taxonomic Synthesis; Walter de Gruyter GmbH & Co KG.: Berlin, Germany, 2015; pp. i–x, 1-1092. [Google Scholar]
- Burgin, C.J.; Wilson, D.E.; Mittermeier, R.A.; Rylands, A.B.; Lacher, T.E.; Sechrest, W. (Eds.) Illustrated Checklist of the Mammals of the World; Lynx Edicions: Barcelona, Spain, 2020. [Google Scholar]
- Wilson, D.E.; Thomas E Lacher, J.; Mittermeier, R.A.; François, T.L. Volume 7: Rodents II. In Handbook of the Mammals of the World (HMW); Lynx Edicions: Barcelona, Spain, 2019. [Google Scholar]
- Musila, S.; Monadjem, A.; Webala, P.W.; Patterson, B.D.; Hutterer, R.; De Jong, Y.A.; Butynski, T.M.; Mwangi, G.; Chen, Z.Z.; Jiang, X.L. An annotated checklist of mammals of Kenya. Zool. Res. 2019, 40, 3–52. [Google Scholar] [CrossRef] [PubMed]
- Kerbis Peterhans, J.C.; Hutterer, R.; Krasova, J.; Doty, J.; Malekani, J.; Moyer, D.; Bryja, J.; Banasiak, R.; Demos, T. Four new species of the Hylomyscus anselli group (Mammalia: Rodentia: Muridae) from the Democratic Republic of Congo and Tanzania. Bonn. Zool. Bull. 2020, 69, 55–83. [Google Scholar]
- Mahaney, W. Holocene glaciations and paleoclimate of mount Kenya and other East African mountains. Quat. Sci. Rev. 1988, 7, 211–225. [Google Scholar] [CrossRef]
- Mahaney, W.C.; Harmsen, R.; Spence, J.R. Glacial-interglacial cycles and development of the Afroalpine ecosystem on East African Mountains: I. Glacial and postglacial geological record and paleoclimate of Mount Kenya. J. Afr. Earth Sci. (Middle East) 1991, 12, 505–512. [Google Scholar] [CrossRef]
- Michael, C. Climate Change Impacts on East Africa: A Review of the Scientific Literature; WFF-World Wide Fund For Nature: Gland, Switzerland, 2006. [Google Scholar]
- Jaramillo, J.; Muchugu, E.; Vega, F.E.; Davis, A.; Borgemeister, C.; Chabi-Olaye, A. Some like it hot: The influence and implications of climate change on coffee berry borer (Hypothenemus hampei) and coffee production in East Africa. PLoS ONE 2011, 6, e24528. [Google Scholar] [CrossRef] [PubMed]
- Schüler, L.; Hemp, A.; Zech, W.; Behling, H. Vegetation, climate and fire-dynamics in East Africa inferred from the Maundi crater pollen record from Mt Kilimanjaro during the last glacial–interglacial cycle. Quat. Sci. Rev. 2012, 39, 1–13. [Google Scholar] [CrossRef]
- Leclerc, C.; Mwongera, C.; Camberlin, P.; Moron, V. Cropping System Dynamics, Climate Variability, and Seed Losses among East African Smallholder Farmers: A Retrospective Survey. Weather Clim. Soc. 2014, 6, 354–370. [Google Scholar] [CrossRef]
- Menegon, M.; Loader, S.P.; Marsden, S.J.; Branch, W.R.; Davenport, T.R.; Ursenbacher, S. The genus Atheris (Serpentes: Viperidae) in East Africa: Phylogeny and the role of rifting and climate in shaping the current pattern of species diversity. Mol. Phylogenet. Evol. 2014, 79, 12–22. [Google Scholar] [CrossRef]
- Liu, X.; Rendle-Bühring, R.; Henrich, R. High-and low-latitude forcing of the East African climate since the LGM: Inferred from the elemental composition of marine sediments off Tanzania. Quat. Sci. Rev. 2018, 196, 124–136. [Google Scholar] [CrossRef]
- Musila, S.; Chen, Z.Z.; Li, Q.; Yego, R.; Zhang, B.; Onditi, K.; Muthoni, I.; He, S.W.; Omondi, S.; Mathenge, J.; et al. Diversity and distribution patterns of non-volant small mammals along different elevation gradients on Mt. Kenya, Kenya. Zool. Res. 2019, 40, 53–60. [Google Scholar] [CrossRef] [PubMed]
- Onditi, K.O.; Peterhans, J.K.; Demos, T.C.; Musila, S.; Chen, Z.Z.; Jiang, X.L. Morphological and genetic characterization of Mount Kenya brush-furred rats (Peters 1874); relevance to taxonomy and ecology. Mammal Res. 2020, 65, 387–400. [Google Scholar] [CrossRef]
- Sikes, R.S.; The Animal Care Use Committee of the American Society of Mammalogists. 2016 Guidelines of the American Society of Mammalogists for the use of wild mammals in research and education. J. Mammal. 2016, 97, 663–688. [Google Scholar] [CrossRef]
- Underwood, W.; Anthony, R. AVMA guidelines for the euthanasia of animals: 2020 edition. Retrieved March 2020, 2013, 2020–2021. [Google Scholar]
- Sambrook, J.; Edward, F.F.; Tom, M. Molecular Cloning: A Laboratory Manual, 2nd ed.; Cold Spring Harbor Laboratory Press: New York, NY, USA, 1989. [Google Scholar]
- Agnarsson, I.; May-Collado, L.J. The phylogeny of Cetartiodactyla: The importance of dense taxon sampling, missing data, and the remarkable promise of cytochrome b to provide reliable species-level phylogenies. Mol. Phylogenet. Evol. 2008, 48, 964–985. [Google Scholar] [CrossRef]
- Tobe, S.S.; Kitchener, A.C.; Linacre, A.M.T. Reconstructing Mammalian Phylogenies: A Detailed Comparison of the Cytochrome b and Cytochrome Oxidase Subunit I Mitochondrial Genes. PLoS ONE 2010, 5, e14156. [Google Scholar] [CrossRef]
- Onditi, K.O.; Song, W.Y.; Li, X.Y.; Chen, Z.Z.; Li, Q.; He, S.W.; Musila, S.; Kioko, E.; Jiang, X.L. Patterns and Predictors of Small Mammal Phylogenetic and Functional Diversity in Contrasting Elevational Gradients in Kenya. Front. Ecol. Evol. 2022, 9, 742524. [Google Scholar] [CrossRef]
- Sayers, E.W.; Cavanaugh, M.; Clark, K.; Ostell, J.; Pruitt, K.D.; Karsch-Mizrachi, I. GenBank. Nucleic Acids Res. 2020, 48, D84–D86. [Google Scholar]
- Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef]
- Talavera, G.; Castresana, J. Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Syst. Biol. 2007, 56, 564–577. [Google Scholar] [CrossRef] [PubMed]
- Steenwyk, J.L.; Buida, T.J., III; Li, Y.; Shen, X.-X.; Rokas, A. ClipKIT: A multiple sequence alignment trimming software for accurate phylogenomic inference. PLoS Biol. 2020, 18, e3001007. [Google Scholar] [CrossRef] [PubMed]
- Vences, M.; Patmanidis, S.; Kharchev, V.; Renner, S.S. Concatenator, a user-friendly program to concatenate DNA sequences, implementing graphical user interfaces for MAFFT and FastTree. Bioinform. Adv. 2022, 2, vbac050. [Google Scholar] [CrossRef]
- Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.F.; von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef]
- Nguyen, L.T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef] [PubMed]
- Minh, B.Q.; Nguyen, M.A.; von Haeseler, A. Ultrafast approximation for phylogenetic bootstrap. Mol. Biol. Evol. 2013, 30, 1188–1195. [Google Scholar] [CrossRef]
- Bouckaert, R.; Vaughan, T.G.; Barido-Sottani, J.; Duchene, S.; Fourment, M.; Gavryushkina, A.; Heled, J.; Jones, G.; Kuhnert, D.; De Maio, N.; et al. BEAST 2.5: An advanced software platform for Bayesian evolutionary analysis. PLoS Comput. Biol. 2019, 15, e1006650. [Google Scholar] [CrossRef]
- Rambaut, A.; Drummond, A.J. TreeAnnotator: MCMC Output Analysis, Version v2.7.7. 2024. Available online: https://www.beast2.org/treeannotator/ (accessed on 6 July 2024).
- Ondřej, M. Cutting tree branches to pick OTUs: A novel method of provisional species delimitation. bioRxiv 2018, 419887. [Google Scholar] [CrossRef]
- Kapli, P.; Lutteropp, S.; Zhang, J.; Kobert, K.; Pavlidis, P.; Stamatakis, A.; Flouri, T. Multi-rate Poisson tree processes for single-locus species delimitation under maximum likelihood and Markov chain Monte Carlo. Bioinformatics 2017, 33, 1630–1638. [Google Scholar] [CrossRef]
- Fujisawa, T.; Barraclough, T.G. Delimiting species using single-locus data and the Generalized Mixed Yule Coalescent approach: A revised method and evaluation on simulated data sets. Syst. Biol. 2013, 62, 707–724. [Google Scholar] [CrossRef]
- Puillandre, N.; Brouillet, S.; Achaz, G. ASAP: Assemble species by automatic partitioning. Mol. Ecol. Resour. 2021, 21, 609–620. [Google Scholar] [CrossRef] [PubMed]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Musser, G.G.; Carleton, M.D. Superfamily Muroidea. In Mammal Species of the World: A Taxonomic and Geographic Reference; Wilson, D.E., Reeder, D.M., Eds.; John Hopkins University Press: Baltimore, MD, USA, 2005; pp. 894–1531. [Google Scholar]
- Hutterer, R. Order Soricomorpha. In Mammal Species of the World: A Taxonomic and Geographic Reference; Wilson, D.E., Reeder, D.A.M., Eds.; John Hopkins University Press: Baltimore, MD, USA, 2005; pp. 220–300. [Google Scholar]
- Wilson, D.E.; Mittermeier, R.A.; François, T.L. (Eds.) Handbook of the Mammals of the World, Volume 8: Insectivores, Sloths and Colugos; Lynx Edicions in Association with Conservation International and IUCN: Barcelona, Spain, 2019; Volume 8. [Google Scholar]
- Leigh, J.W.; Bryant, D.; Nakagawa, S. popart: Full-feature software for haplotype network construction. Methods Ecol. Evol. 2015, 6, 1110–1116. [Google Scholar] [CrossRef]
- Bandelt, H.J.; Forster, P.; Rohl, A. Median-joining networks for inferring intraspecific phylogenies. Mol. Biol. Evol. 1999, 16, 37–48. [Google Scholar] [CrossRef] [PubMed]
- Kimura, M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 1980, 16, 111–120. [Google Scholar] [CrossRef]
- Hebert, P.D.; Cywinska, A.; Ball, S.L.; DeWaard, J.R. Biological identifications through DNA barcodes. Proc. R. Soc. London. Ser. B Biol. Sci. 2003, 270, 313–321. [Google Scholar] [CrossRef]
- Rozas, J.; Ferrer-Mata, A.; Sanchez-DelBarrio, J.C.; Guirao-Rico, S.; Librado, P.; Ramos-Onsins, S.E.; Sanchez-Gracia, A. DnaSP 6: DNA Sequence Polymorphism Analysis of Large Data Sets. Mol. Biol. Evol. 2017, 34, 3299–3302. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, H.; Sato, J.J.; Tsuchiya, K.; Luo, J.; Zhang, Y.-P.; Wang, Y.-X.; Jiang, X.-L. Molecular phylogeny of wood mice (Apodemus, Muridae) in East Asia. Biol. J. Linn. Soc. 2003, 80, 469–481. [Google Scholar] [CrossRef]
- Rambaut, A.; Drummond, A.J.; Xie, D.; Baele, G.; Suchard, M.A. Posterior Summarization in Bayesian Phylogenetics Using Tracer 1.7. Syst. Biol. 2018, 67, 901–904. [Google Scholar] [CrossRef]
- Yu, Y.; Harris, A.J.; Blair, C.; He, X. RASP (Reconstruct Ancestral State in Phylogenies): A tool for historical biogeography. Mol. Phylogenet. Evol. 2015, 87, 46–49. [Google Scholar] [CrossRef] [PubMed]
- Matzke, N.J. Probabilistic Historical Biogeography: New Models for Founder-Event Speciation, Imperfect Detection, and Fossils Allow Improved Accuracy and Model-Testing; University of California: Berkeley, CA, USA, 2013. [Google Scholar]
- Matzke, N.J. Model selection in historical biogeography reveals that founder-event speciation is a crucial process in island clades. Syst. Biol. 2014, 63, 951–970. [Google Scholar] [CrossRef] [PubMed]
- Ree, R.H.; Smith, S.A. Maximum likelihood inference of geographic range evolution by dispersal, local extinction, and cladogenesis. Syst. Biol. 2008, 57, 4–14. [Google Scholar] [CrossRef] [PubMed]
- Mousset, S.; Derome, N.; Veuille, M. A Test of Neutrality and Constant Population Size Based on the Mismatch Distribution. Mol. Biol. Evol. 2004, 21, 724–731. [Google Scholar] [CrossRef] [PubMed]
- Grant, W.S. Problems and cautions with sequence mismatch analysis and Bayesian skyline plots to infer historical demography. J. Hered. 2015, 106, 333–346. [Google Scholar] [CrossRef]
- Oksanen, J.; Blanchet, F.G.; Friendly, M.; Kindt, R.; Legendre, P.; McGlinn, D.; Minchin, P.R.; O’Hara, R.B.; Simpson, G.L.; Solymos, P.; et al. vegan: Community Ecology Package, R Package Version 2.5-5. 2019. Available online: https://CRAN.R-project.org/package=vegan (accessed on 6 July 2024).
- Philipp, B.; Niklaus, E.Z.; Chantal, H.; Loïc, P.; Dirk Nikolaus, K. CHELSA-BIOCLIM+ A Novel Set of Global Climate-Related Predictors at Kilometre-Resolution. EnviDat [Online] 2022. [Google Scholar] [CrossRef]
- Hu, W.-H.; Onditi, K.O.; Jiang, X.-L.; Wu, H.-L.; Chen, Z.-Z. Modeling the Potential Distribution of Two Species of Shrews (Chodsigoa hypsibia and Anourosorex squamipes) under Climate Change in China. Diversity 2022, 14, 87. [Google Scholar] [CrossRef]
- Dunne, J.P.; Horowitz, L.; Adcroft, A.; Ginoux, P.; Held, I.; John, J.; Krasting, J.P.; Malyshev, S.; Naik, V.; Paulot, F. The GFDL Earth System Model version 4.1 (GFDL-ESM 4.1): Overall coupled model description and simulation characteristics. J. Adv. Model. Earth Syst. 2020, 12, e2019MS002015. [Google Scholar] [CrossRef]
- Riahi, K.; Rao, S.; Krey, V.; Cho, C.; Chirkov, V.; Fischer, G.; Kindermann, G.; Nakicenovic, N.; Rafaj, P. RCP 8.5—A scenario of comparatively high greenhouse gas emissions. Clim. Chang. 2011, 109, 33–57. [Google Scholar] [CrossRef]
- Schwalm, C.R.; Glendon, S.; Duffy, P.B. RCP 8.5 tracks cumulative CO2 emissions. Proc. Natl. Acad. Sci. USA 2020, 117, 19656–19657. [Google Scholar] [CrossRef]
- Hijmans, R.J. terra: Spatial Data Analysis, R Package Version 1.7-83. 2024. Available online: https://CRAN.R-project.org/package=terra (accessed on 6 July 2024).
- Kass, J.M.; Vilela, B.; Aiello-Lammens, M.E.; Muscarella, R.; Merow, C.; Anderson, R.P. Wallace: A flexible platform for reproducible modeling of species niches and distributions built for community expansion. Methods Ecol. Evol. 2018, 9, 1151–1156. [Google Scholar] [CrossRef]
- Kass, J.M.; Pinilla-Buitrago, G.E.; Paz, A.; Johnson, B.A.; Grisales-Betancur, V.; Meenan, S.I.; Attali, D.; Broennimann, O.; Galante, P.J.; Maitner, B.S.; et al. wallace 2: A shiny app for modeling species niches and distributions redesigned to facilitate expansion via module contributions. Ecography 2023, 2023, e06547. [Google Scholar] [CrossRef]
- Phillips, S.J.; Anderson, R.P.; Schapire, R.E. Maximum entropy modeling of species geographic distributions. Ecol. Model. 2006, 190, 231–259. [Google Scholar] [CrossRef]
- Li, X.; Yu, L.; Sohl, T.L.; Clinton, N.; Li, W.; Zhu, Z.; Liu, X.; Gong, P. A cellular automata downscaling based 1 km global land use datasets (2010–2100). Sci. Bull. 2016, 61, 1651–1661. [Google Scholar] [CrossRef]
- Demos, T.C.; Agwanda, B.; Hickerson, M.J. Integrative taxonomy within the Hylomyscus denniae complex (Rodentia: Muridae) and a new species from Kenya. J. Mammal. 2013, 95, E1–E15. [Google Scholar] [CrossRef]
- Morgan, K.; Mboumba, J.-F.; Ntie, S.; Mickala, P.; Miller, C.; Zhen, Y.; Harrigan, R.; Underwood, V.; Ruegg, K.; Fokam, E.; et al. Precipitation and vegetation shape patterns of genomic and craniometric variation in the central African rodent Praomys misonnei. Proc. R. Soc. B Biol. Sci. 2020, 287, 20200449. [Google Scholar] [CrossRef]
- Mairal, M.; Sanmartin, I.; Herrero, A.; Pokorny, L.; Vargas, P.; Aldasoro, J.J.; Alarcon, M. Geographic barriers and Pleistocene climate change shaped patterns of genetic variation in the Eastern Afromontane biodiversity hotspot. Sci. Rep. 2017, 7, 45749. [Google Scholar] [CrossRef]
- Genung, M.A.; Schweitzer, J.A.; Úbeda, F.; Fitzpatrick, B.M.; Pregitzer, C.C.; Felker-Quinn, E.; Bailey, J.K. Genetic variation and community change—Selection, evolution, and feedbacks. Funct. Ecol. 2011, 25, 408–419. [Google Scholar] [CrossRef]
- Allendorf, F.W. Genetic drift and the loss of alleles versus heterozygosity. Zoo. Biol. 1986, 5, 181–190. [Google Scholar] [CrossRef]
- Barton, N.H.; Charlesworth, B. Genetic revolutions, founder effects, and speciation. Annu. Rev. Ecol. Syst. 1984, 15, 133–164. [Google Scholar] [CrossRef]
- Romiguier, J.; Gayral, P.; Ballenghien, M.; Bernard, A.; Cahais, V.; Chenuil, A.; Chiari, Y.; Dernat, R.; Duret, L.; Faivre, N. Comparative population genomics in animals uncovers the determinants of genetic diversity. Nature 2014, 515, 261–263. [Google Scholar] [CrossRef] [PubMed]
- Naciri, Y.; Linder, H.P. The genetics of evolutionary radiations. Biol. Rev. 2020, 95, 1055–1072. [Google Scholar] [CrossRef] [PubMed]
- Bragg, J.G.; Supple, M.A.; Andrew, R.L.; Borevitz, J.O. Genomic variation across landscapes: Insights and applications. New Phytol. 2015, 207, 953–967. [Google Scholar] [CrossRef]
- Hand, B.K.; Lowe, W.H.; Kovach, R.P.; Muhlfeld, C.C.; Luikart, G. Landscape community genomics: Understanding eco-evolutionary processes in complex environments. Trends Ecol. Evol. 2015, 30, 161–168. [Google Scholar] [CrossRef]
- Mallet, J.; Besansky, N.; Hahn, M.W. How reticulated are species? Bioessays 2016, 38, 140–149. [Google Scholar] [CrossRef]
- Slatkin, M. Gene flow and the geographic structure of natural populations. Science 1987, 236, 787–792. [Google Scholar] [CrossRef]
- Cai, L.; Xi, Z.; Lemmon, E.M.; Lemmon, A.R.; Mast, A.; Buddenhagen, C.E.; Liu, L.; Davis, C.C. The Perfect Storm: Gene Tree Estimation Error, Incomplete Lineage Sorting, and Ancient Gene Flow Explain the Most Recalcitrant Ancient Angiosperm Clade, Malpighiales. Syst. Biol. 2020, 70, 491–507. [Google Scholar] [CrossRef]
- Bayne, B.L. (Ed.) Chapter 1—Phylogeny. In Developments in Aquaculture and Fisheries Science; Elsevier: Amsterdam, The Netherlands, 2017; Volume 41, pp. 1–46. [Google Scholar]
- Schoville, S.D.; Roderick, G.K.; Kavanaugh, D.H. Testing the ‘Pleistocene species pump’ in alpine habitats: Lineage diversification of flightless ground beetles (Coleoptera: Carabidae: Nebria) in relation to altitudinal zonation. Biol. J. Linn. Soc. 2012, 107, 95–111. [Google Scholar] [CrossRef]
- Janzen, T.; Etienne, R.S. Inferring the role of habitat dynamics in driving diversification: Evidence for a species pump in Lake Tanganyika cichlids. bioRxiv 2017, 085431. [Google Scholar] [CrossRef]
- Kimura, M.; Weiss, G.H. The Stepping Stone Model of Population Structure and the Decrease of Genetic Correlation with Distance. Genetics 1964, 49, 561–576. [Google Scholar] [CrossRef]
- Slatkin, M. Isolation by Distance in Equilibrium and Non-Equilibrium Populations. Evolution 1993, 47, 264–279. [Google Scholar] [CrossRef] [PubMed]
- Morley, C.; Harper, R.; Wigger, S. Introduction to the East African Rift System. In Geoscience of Rift Systems—Evolution of East Africa: AAPG Studies in Geology; Morley, C., Ed.; American Association of Petroleum Geologists: Tulsa, OK, USA, 1999; Volume 44, pp. 1–18. [Google Scholar]
- Nicolas, V.; Wendelen, W.; Barriere, P.; Dudu, A.; Colyn, M. Morphometric variation in Hylomyscus alleni and H. stella (Rodentia: Muridae), and description of a new species. J. Mammal. 2008, 89, 222–231. [Google Scholar] [CrossRef]
- Nicolas, V.; Querouil, S.; Verheyen, E.; Verheyen, W.; Mboumba, J.F.; Dillen, M.; Colyn, M. Mitochondrial phylogeny of African wood mice, genus Hylomyscus (Rodentia, Muridae): Implications for their taxonomy and biogeography. Mol. Phylogenet. Evol. 2006, 38, 779–793. [Google Scholar] [CrossRef] [PubMed]
- Carleton, M.D.; Kerbis Peterhans, J.C.; Kerbis Peterhans, J.C.; Stanley, W.T.; Graves, G.R. Review of the Hylomyscus denniae group (Rodentia: Muridae) in eastern Africa, with comments on the generic allocation of Epimys endorobae Heller. Proc. Biol. Soc. Wash. 2006, 119, 293–325. [Google Scholar] [CrossRef]
- Carleton, M.D.; Stanley, W.T.; Graves, G.R. Review of the Hylomyscus denniae complex (Rodentia: Muridae) in Tanzania, with a description of a new species. Proc. Biol. Soc. Wash. 2005, 118, 619–646. [Google Scholar] [CrossRef]
- Lapin, K.; Hoffmann, J.A.; Braun, M.; Oettel, J. Identification and prioritization of stepping stones for biodiversity conservation in forest ecosystems. Conserv. Sci. Pract. 2024, 6, e13161. [Google Scholar] [CrossRef]
- Theodoridis, S.; Fordham, D.A.; Brown, S.C.; Li, S.; Rahbek, C.; Nogues-Bravo, D. Evolutionary history and past climate change shape the distribution of genetic diversity in terrestrial mammals. Nat. Commun. 2020, 11, 2557. [Google Scholar] [CrossRef]
- Bennun, L.A.; Njoroge, P. Important Bird Areas in Kenya; East Africa Natural History Society (EANHS): Nairobi, Kenya, 1999. [Google Scholar]
- Bradshaw, C.J.A.; Sodhi, N.S.; Brook, B.W. Tropical turmoil: A biodiversity tragedy in progress. Front. Ecol. Environ. 2008, 7, 79–87. [Google Scholar] [CrossRef]
- Chrisphine, O.; Odhiambo, A.; Boitt, K. Assessment of hydrological impacts of Mau Forest, Kenya. Hydrol. Curr. Res. 2016, 7. [Google Scholar] [CrossRef]
- Gichuhi, M. Ecological management of the Mau catchment area and its impact on Lake Nakuru national park. J. Agric. Sci. Technol. 2013, 15, 81–101. [Google Scholar]
- Karanja, F.; Tessema, Y.; Barrow, E.G. Equity in the Loita/Purko Naimina Enkiyio Forest in Kenya: Securing Maasai Rights to and Responsibilities for the Forest; IUCN: Gland, Switzerland, 2002. [Google Scholar]
- Kundu, P.M.; Olang, L.O. Automated extraction of morphologic and hydrologic properties for River Njoro catchment in Eastern Mau, Kenya. AGSE 2011, 2011, 147. [Google Scholar]
- Maundu, P.; Berger, D.; Ole Saitabau, C.; Nasieku, J.; Kipelian, M.; Mathenge, S.; Morimoto, Y.; Höft, R. Ethnobotany of the Loita Maasai. In People and Plants Working Paper; UNESCO: Paris, France, 2001; Volume 8. [Google Scholar]
- Mbuvi, M.T.; Musyoki, J.K.; Ongugo, P.O. Equity Mechanisms in traditional forest management Systems: A case study of Loita forest in Kenya. J. Sustain. For. 2015, 34, 380–405. [Google Scholar] [CrossRef]
- Olang, L.O.; Kundu, P.M. Land degradation of the Mau forest complex in Eastern Africa: A review for management and restoration planning. Environ. Monit. 2011, 15, 245–262. [Google Scholar]
- Tsingalia, M.H. Animals and the Regeneration of an African Rainforest Tree; University of California, Berkeley: Berkeley, CA, USA, 1988. [Google Scholar]
- Allaire, J.J.; Xie, Y.; Dervieux, C.; McPherson, J.; Luraschi, J.; Ushey, K.; Atkins, A. Rmarkdown: Dynamic Documents for r (Version R Package 2.28). 2024. Available online: https://github.com/rstudio/rmarkdown (accessed on 6 July 2024).
- Boettiger, C. Knitcitations: Citations for ‘Knitr’ Markdown Files (Version R Package 1.0.12). 2021. Available online: https://CRAN.R-project.org/package=knitcitations (accessed on 6 July 2024).
- Hijmans, R.J. Raster: Geographic Data Analysis and Modeling (Version R Package 3.6-26). 2023. Available online: https://CRAN.R-project.org/package=raster (accessed on 6 July 2024).
- Merow, C.; Maitner, B.; Owens, H.; Kass, J.; Enquist, B.; Guralnik, R.; Zurrell, D.; Koenig, C. rangeModelMetadata: Provides Templates for Metadata Files Associated with Species Range Models (Version R Package 0.1.5). 2023. Available online: https://CRAN.R-project.org/package=rangeModelMetadata (accessed on 6 July 2024).
- Xie, Y. Knitr: A Comprehensive Tool for Reproducible Research in R. In Implementing Reproducible Computational Research; Stodden, V., Leisch, F., Peng, R.D., Eds.; Chapman & Hall/CRC: Boca Raton, FL, USA, 2014. [Google Scholar]
- Dynamic Documents with R and Knitr, 2nd ed.; Chapman & Hall/CRC: Boca Raton, FL, USA, 2015; Available online: https://yihui.org/knitr/ (accessed on 6 July 2024).
- Knitr: A General-Purpose Package for Dynamic Report Generation in r (Version R Package 1.48). 2024. Available online: https://yihui.org/knitr/ (accessed on 6 July 2024).
- Xie, Y.; Allaire, J.J.; Grolemund, G. R Markdown: The Definitive Guide; Chapman Hall/CRC: Boca Raton, FL, USA, 2018; Available online: https://bookdown.org/yihui/rmarkdown (accessed on 6 July 2024).
- Xie, Y. Christophe Dervieux, and Emily Riederer. In R Markdown Cookbook; Chapman Hall/CRC: Boca Raton, FL, USA, 2020; Available online: https://bookdown.org/yihui/rmarkdown-cookbook (accessed on 6 July 2024).
- He, K.; Li, Y.J.; Brandley, M.C.; Lin, L.K.; Wang, Y.X.; Zhang, Y.P.; Jiang, X.L. A multi-locus phylogeny of Nectogalini shrews and influences of the paleoclimate on speciation and evolution. Mol. Phylogenet. Evol. 2010, 56, 734–746. [Google Scholar] [CrossRef]
- Stanhope, M.J.; Smith, M.R.; Waddell, V.G.; Porter, C.A.; Shivji, M.S.; Goodman, M. Mammalian evolution and the interphotoreceptor retinoid binding protein (IRBP) gene: Convincing evidence for several superordinal clades. J. Mol. Evol. 1996, 43, 83–92. [Google Scholar] [CrossRef]
(a) H. endorobae | ||||||||
Site | Within | Mt. Kenya | Mau | Aberdare | ||||
Mt. Kenya | 0.301% | |||||||
Mau | 0.235% | 0.358% | ||||||
Aberdare | 0.135% | 0.248% | 0.262% | |||||
(b) Kenyan P. jacksoni | ||||||||
Site | Within | Aberdare | Kakamega | Mau | Loita | Mt. Elgon | Cherangani | Mt. Kenya |
Aberdare | 0.316% | |||||||
Kakamega | 0.622% | 0.607% | ||||||
Mau | 0.315% | 0.427% | 0.763% | |||||
Loita | 0.233% | 0.517% | 0.747% | 0.700% | ||||
Mt. Elgon | 0.975% | 1.110% | 1.211% | 1.307% | 1.231% | |||
Cherangani | 0.576% | 0.440% | 0.715% | 0.481% | 0.679% | 1.206% | ||
Mt. Kenya | 0.430% | 2.443% | 2.652% | 2.664% | 2.624% | 2.795% | 2.579% |
Statistic | H. endorobae | P. jacksoni | ||||||
---|---|---|---|---|---|---|---|---|
Diversity Index | All | Aberdares | Mau | Mt. Kenya | All | Aberdares | Mau | Mt. Kenya |
Sequences | 181 | 10 | 21 | 150 | 891 | 9 | 287 | 55 |
Total sites * | 1094 | 1120 | 1120 | 1094 | 519 | 519 | 1113 | 743 |
Polymorphic sites | 62 | 6 | 14 | 50 | 95 | 4 | 106 | 37 |
Mutations | 63 | 6 | 14 | 51 | 100 | 4 | 110 | 38 |
Haplotypes | 49 | 6 | 10 | 34 | 115 | 4 | 87 | 19 |
Haplotype diversity | 0.908 | 0.844 | 0.919 | 0.881 | 0.887 | 0.583 | 0.941 | 0.81 |
Nucleotide diversity | 0.003 | 0.001 | 0.002 | 0.003 | 0.006 | 0.002 | 0.003 | 0.004 |
Nucleotide differences | 3.225 | 1.511 | 2.638 | 3.144 | 3.24 | 0.889 | 3.534 | 2.801 |
Fu and Li’s D test statistic | −2.224 | −0.939 | 0.0316 | −2.432 | −3.257 | −1.8 | −4.107 | −3.54 |
Statistical significance | p > 0.05 | p > 0.10 | p > 0.10 | p < 0.05 | p < 0.05 | p > 0.05 | p < 0.02 | p < 0.02 |
Fu and Li’s F test statistic | −2.631 | −1.122 | −0.372 | −2.702 | −3.196 | −1.948 | −3.926 | −3.646 |
Statistical significance | p < 0.05 | p > 0.10 | p > 0.10 | p < 0.05 | p < 0.02 | p > 0.05 | p < 0.02 | p < 0.02 |
Tajima’s D | −2.147 | −1.189 | −1.165 | −2.003 | −2.136 | −1.61 | −2.419 | −2.218 |
Statistical significance | p < 0.01 | p > 0.10 | p > 0.10 | p < 0.05 | p < 0.01 | p > 0.05 | p < 0.0 | p < 0.01 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mweu, A.W.; Onditi, K.O.; Khanal, L.; Musila, S.; Kioko, E.; Jiang, X. Comparative Phylogeography of Two Specialist Rodents in Forest Fragments in Kenya. Life 2024, 14, 1469. https://doi.org/10.3390/life14111469
Mweu AW, Onditi KO, Khanal L, Musila S, Kioko E, Jiang X. Comparative Phylogeography of Two Specialist Rodents in Forest Fragments in Kenya. Life. 2024; 14(11):1469. https://doi.org/10.3390/life14111469
Chicago/Turabian StyleMweu, Alois Wambua, Kenneth Otieno Onditi, Laxman Khanal, Simon Musila, Esther Kioko, and Xuelong Jiang. 2024. "Comparative Phylogeography of Two Specialist Rodents in Forest Fragments in Kenya" Life 14, no. 11: 1469. https://doi.org/10.3390/life14111469
APA StyleMweu, A. W., Onditi, K. O., Khanal, L., Musila, S., Kioko, E., & Jiang, X. (2024). Comparative Phylogeography of Two Specialist Rodents in Forest Fragments in Kenya. Life, 14(11), 1469. https://doi.org/10.3390/life14111469