Skip to Content
MDPIMDPI

Advanced

CancersCancers
PDF
  • Article
  • Open Access

17 February 2026

20 Pages

Repurposing Alkylating Agents in Melanoma via ERCC8 Silencing: A Novel Therapeutic Strategy

,
,
,
,
and
Unit of Molecular Genetics of Aging, Department of Ecological and Biological Sciences, University of Tuscia, 01100 Viterbo, Italy
*
Authors to whom correspondence should be addressed.
Cancers2026, 18(4), 647;https://doi.org/10.3390/cancers18040647
This article belongs to the Special Issue A New Road for Cancer Drug Discovery
Version Notes
Review Reports
Order Reprints

Simple Summary

Melanoma is an aggressive skin cancer that can become resistant to modern immunotherapies and targeted treatments. When this occurs, chemotherapy drugs such as temozolomide and dacarbazine are still used, but their benefit is limited because melanoma cells can repair the DNA damage caused by these drugs, and high doses may cause significant side effects. In this study, we investigated a protein called CSA, which is involved in DNA repair and helps cells survive under stress. We found that melanoma cells depend strongly on CSA to maintain their growth and resist chemotherapy. By reducing CSA levels using antisense oligonucleotides, we weakened melanoma cells, reduced their ability to grow and migrate, and increased cell death. Importantly, CSA inhibition made melanoma cells much more sensitive to low doses of chemotherapy, while normal cells were largely spared. These findings suggest that targeting CSA could improve the effectiveness and selectivity of existing chemotherapy, particularly in resistant or metastatic melanoma, and may represent a new strategy to enhance treatment options for patients with advanced disease.

Abstract

Background/Objectives: Melanoma is the deadliest form of skin cancer. Resistance to alkylating agents such as Temozolomide (TMZ) and Dacarbazine (DTIC) limits their clinical benefit, as these drugs remain palliative options when immunotherapies and targeted treatments fail. CSA/ERCC8 is a key component of transcription-coupled nucleotide excision repair (TC-NER), a pathway responsible for removing UV-induced DNA lesions. In principle, loss of a DNA repair factor would be expected to increase carcinogenesis. However, although CSA loss-of-function causes Cockayne Syndrome (CS), affected patients do not exhibit increased skin cancer incidence, suggesting that CSA impairment promotes apoptosis rather than tumor development. This paradox raises the possibility that CSA inhibition may selectively target melanoma cell survival pathways. Methods: The expression of CSA/ERCC8 was analyzed by qRT-PCR and Western blot. ERCC8 was silenced using antisense oligonucleotides. Cell viability, apoptosis, cell cycle progression, drug sensitivity, and DNA damage were assessed by functional assays, including IC50 determination and Bliss analysis for drug interactions. Results: We identified CSA/ERCC8 as a driver of melanoma chemoresistance. CSA was markedly overexpressed in primary and metastatic melanoma cells. ERCC8 silencing reduced proliferation, induced apoptosis, and significantly enhanced sensitivity to low doses of TMZ and DTIC while sparing normal cells. Conclusions: CSA represents a promising therapeutic target to overcome chemoresistance in melanoma. Its inhibition enhances the efficacy and selectivity of alkylating agents, supporting its potential as a salvage strategy for refractory disease and warranting further preclinical and clinical investigation.

1. Introduction

Skin cancer is among the most prevalent malignancies worldwide, affecting individuals of all genders [1]. It is primarily categorized into three types: Basal Cell Carcinoma (BCC), Squamous Cell Carcinoma (SCC), and Melanoma [2]. Of these, melanoma is the most aggressive, accounting for roughly 75% of skin cancer-related deaths despite being less common than BCC and SCC [3]. Melanoma progression is influenced by a complex interplay of genetic, epigenetic, environmental, and behavioral factors [4].
For early-stage melanoma, wide local excision remains the standard of care and may also be used in combination with other therapies in advanced cases. In metastatic melanoma, first-line treatments typically involve targeted therapy and/or immunotherapy, both of which have dramatically improved patient outcomes over the past decade. Notably, these approaches have increased median overall survival from approximately six months to over five years. Targeted therapies focus on inhibiting components of the MAPK signaling pathway, particularly in patients with the BRAFV600E mutation, which occurs in about 50% of metastatic melanomas [5,6,7].
These include BRAF inhibitors (e.g., vemurafenib, dabrafenib) and MEK inhibitors (e.g., trametinib, cobimetinib) [8]. Immunotherapy, effective regardless of BRAF mutation status, employs immune checkpoint inhibitors to reactivate anti-tumor immunity. These include agents targeting CTLA-4 (e.g., ipilimumab), PD-1 (e.g., nivolumab), and PD-L1 (e.g., atezolizumab) [9,10,11].
When patients are refractory to immunotherapy, conventional chemotherapy—most commonly Dacarbazine (DTIC) and Temozolomide (TMZ)—remains a treatment option, particularly for those with central nervous system metastases [12]. However, both drugs are limited by low objective response rates, modest survival benefits, and substantial toxicity that can significantly impair the quality of life. These drawbacks underscore the urgent need for more effective and better-tolerated therapeutic strategies [13,14]. DTIC and TMZ are alkylating agents that exert cytotoxic effects primarily by methylating DNA, generating lesions such as O6-methylguanine and N7-methylguanine, which are processed by MGMT, BER, and MMR repair pathways [15]. Although Transcription-Coupled Nucleotide Excision Repair (TC-NER) is not the main mechanism responsible for removing these lesions, it may be engaged when RNA polymerase II stalls at methylated sites within actively transcribed genes [16]. In such contexts, CSA—a core component of the TC-NER machinery—plays a critical role in restoring transcriptional integrity [17].
Given these considerations, we selected CSA as a candidate target in melanoma because this tumor type is characterized by high oxidative stress [18,19], elevated transcriptional output and transcriptional plasticity [20,21], and a strong dependence on genome-stability and DNA damage–response pathways [22,23]. CSA supports these processes by coordinating TC-NER and suppressing p53- and ATF3-mediated apoptosis [24,25,26]. Together with our previous findings showing that CSA depletion sensitizes tumor cells to chemotherapy [27], these observations led us to hypothesize that melanoma—particularly metastatic and therapy-resistant subtypes—may be functionally dependent on CSA and thus highly vulnerable to its silencing in combination with alkylating agents, such as DTIC and TMZ. In this study, we demonstrate that CSA knockdown reduces tumorigenic properties in both primary and metastatic melanoma cells and markedly enhances their sensitivity to DTIC and TMZ, supporting the therapeutic potential of CSA inhibition as a strategy to overcome chemoresistance.

2. Results

2.1. CSA/ERCC8 Expression in Melanoma Cell Lines and Fibroblasts

To characterize CSA/ERCC8 expression in the experimental models used in this study, CSA levels were analyzed in primary (WM115) and metastatic (WM266-4) melanoma cell lines and compared with normal human fibroblasts (FB789) at both the protein and mRNA levels. Western blot analysis (Figure 1A) showed higher CSA protein levels in WM115 and WM266-4 cells relative to FB789 fibroblasts. Densitometric quantification normalized to ß-TUB (Figure 1B) confirmed a significant increase in CSA protein abundance in WM115 (1.87 ± 0.3) and WM266-4 (2.0 ± 0.4) cells compared to FB789 (p < 0.001). Consistently, ERCC8 mRNA levels assessed by qRT-PCR and normalized to ACTB (Figure 1C) were higher in WM115 (2.4 ± 0.12) and WM266-4 (1.49 ± 0.25) cells relative to FB789 fibroblasts (p < 0.001). These data indicate that CSA is expressed in both melanoma and non-malignant cells, with higher levels observed in the melanoma cell lines analyzed. This analysis provides a baseline characterization of CSA expression in the cellular models employed in this study and does not allow us to conclude that the higher CSA levels observed in melanoma cell lines are specifically associated with tumorigenicity, as they may also reflect features of melanocytic lineage rather than malignant transformation per se. To provide clinical context for our findings, we analyzed ERCC8 expression in melanoma patient samples from the TCGA-SKCM cohort. ERCC8 was consistently expressed across both primary and metastatic tumors, with no significant difference between disease stages (Figure 1D and Supplementary Table S1). Importantly, ERCC8 expression significantly correlated with copy number alterations. Tumors harboring ERCC8 copy number gains exhibited increased mRNA levels, whereas shallow deletions were associated with reduced expression (Figure 1D). No differences were observed in diploid tumors, supporting a gene dosage-dependent effect. These data indicate that ERCC8 levels are genomically modulated in human melanoma and vary across patient tumors, demonstrating that the CSA-dependent pathway investigated here operates within the biological spectrum of clinical disease.
Figure 1. (A) Western blot analysis showing CSA protein levels, with β-TUB used as a loading control. (B) Quantification of CSA protein levels in FB789, WM115, and WM266 cells, normalized to β-TUB. (C) qRT-PCR analysis of ERCC8 mRNA expression. Data are presented as mean ± standard deviation (SD) from three independent experiments. Statistical significance is indicated by * p < 0.05, as calculated by one-way ANOVA followed by Tukey’s multiple comparison test. (D) ERCC8 mRNA expression levels (Z-score) in patient tumor samples stratified by clinical and genomic features. Statistical significance is denoted as ** p < 0.01, **** p < 0.0001, ns = not significant.

2.2. Targeting CSA Reduces Tumorigenicity and Proliferative Capacity in Melanoma

Given the established role of the CSA protein in enhancing cellular robustness and suppressing pro-apoptotic signaling, we hypothesized that silencing ERCC8 expression would reduce the tumorigenic potential of melanoma cells by shifting the balance toward cell cycle arrest and apoptosis, and away from proliferation and survival. To investigate the functional consequences of ERCC8 silencing, we transfected melanoma cell lines (WM115 and WM266-4) and non-tumorigenic FB789 cells with antisense oligonucleotides (ASOs) specifically targeting ERCC8 mRNA. A sense oligonucleotide (SO) was used as a negative control alongside untreated (Medium) conditions. As shown in Figure 2A, ASO transfection resulted in a significant reduction in ERCC8 mRNA levels across all cell lines compared to both Medium and SO controls (p < 0.001). ERCC8 transcript levels were reduced by approximately 70% in FB789 and WM115 cells, and by around 45% in WM266-4 cells, indicating effective target knockdown. Consistently, Western blot analysis confirmed a marked reduction in CSA protein levels in both WM115 and WM266-4 cells following ASO treatment (Figure 2B), demonstrating that CSA silencing at the mRNA level efficiently translates into the suppression of CSA protein expression.
Figure 2. (A) qRT-PCR analysis of ERCC8 mRNA expression 48 h after transfection with antisense oligonucleotides (ASOs) or control treatments. Data are normalized to ACTB and presented as the mean ± SD of three independent experiments. *** p < 0.001 were calculated by one-way ANOVA followed by Tukey’s multiple comparison test. (B) Western blot analysis of CSA protein levels in WM115 and WM266-4 melanoma cell lines 48 h after transfection with scrambled oligonucleotide (SO) or ERCC8 antisense oligonucleotide (ASO). β-TUB was used as a loading control. (C) Relative cell viability measured by the MTT assay 48 h after transfection. Data are shown as the mean ± SD of three independent experiments. *** p < 0.001 was calculated by one-way ANOVA followed by Tukey’s multiple comparison test. (D) Graphs showing the percentage of apoptotic cells in FB789, WM115, and WM266-4 cell lines after treatment with SO or ERCC8 ASO for 24 h and 48 h. Data are based on counts of 500 cells per condition from three independent experiments. *** p < 0.001, as determined by two-way ANOVA followed by Tukey’s multiple comparisons test. Cell proliferation assay results for (E) normal fibroblasts (FB789), (F) primary melanoma cell line (WM115), and (G) metastatic melanoma cell line (WM266-4). Cells were counted at the time of seeding, and at 24 h and 48 h post-transfection. Data are presented as the mean ± SD of three independent experiments. Statistical analysis was performed using two-way ANOVA (non-repeated measures) followed by Tukey’s multiple comparisons test. ** p < 0.01 and *** p < 0.001. (H) Micrographs showing the results of a scratch cell migration assay conducted at different time points following mock, SO, or ASO treatment in FB789, WM115, and WM266-4 cells. The relative graph (I) illustrates the percentage of wound closure from 0 to 48 h. Data are presented as the mean ± standard deviation (SD) from three independent biological replicates. Statistical analysis was performed using two-way ANOVA (non-repeated measures) followed by Tukey’s multiple comparisons test. *** p < 0.001. (J) Representative images (40× magnification) of Transwell migration assay performed in WM115 and WM266-4 cells transfected with scrambled oligonucleotide (SO) or ERCC8 antisense oligonucleotide (ASO). (K) Quantification of migrated cells expressed as a percentage of cell viability. Data are presented as mean ± SD of three independent experiments. Statistical significance was assessed using the Student’s t-test. *** p < 0.001.
The impact of ERCC8 silencing on cell viability was assessed 48 h post-transfection (Figure 2C). While CSA depletion had minimal effects on FB789 fibroblasts, melanoma cell lines exhibited a significant reduction in viability, with both WM115 and WM266-4 showing more than a 50% decrease compared to the controls (p < 0.001). Importantly, this effect was reproduced using an independent silencing approach based on ERCC8-specific siRNA. Consistent with ASO-mediated depletion, ERCC8 siRNA significantly reduced melanoma cell viability compared to cells transfected with control siRNA, confirming that the observed phenotype is specifically associated with CSA depletion (Supplementary Figure S1A).
Consistent with the viability data, apoptosis analysis revealed a substantial increase in apoptotic cells upon ASO treatment in melanoma cell lines (Figure 2D). Specifically, CSA ablation resulted in a slight increase in apoptosis at 24 h post-transfection with ASO in both WM115 and WM266-4 melanoma cells, with apoptotic cell percentages of 4.3 ± 2.4% and 5.6 ± 2.3%, respectively. At 48 h post-transfection, the percentage of apoptotic cells significantly increased to 9.8 ± 1.7% in WM115 cells and 11.5 ± 1.5% in WM266-4 cells. In contrast, no significant induction of apoptosis was observed in the normal FB789 cell line after CSA downregulation, and no effects were seen in any cell lines treated with the control SO at either 24 h or 48 h post-transfection. Interestingly, expression of a CSA variant (CSA#) that cannot be targeted by the ASOs—because it carries mutations in the ASO target sequence—rescues cell viability. This result rules out the possibility that the observed effects of the ASOs are due to off-target activity, demonstrating that the rescue is specifically mediated by CSA.
Furthermore, proliferation assays monitored over a 48 h recovery period demonstrated that ERCC8 silencing markedly impaired melanoma cell growth (Figure 2F,G). While untreated WM115 and WM266-4 cells showed robust expansion, ASO-treated cells exhibited a significant reduction in cell number at 48 h (p < 0.01 for WM115; p < 0.001 for WM266-4). In contrast, FB789 cell proliferation was not significantly affected by ASO treatment (Figure 2E). Importantly, comparable results were obtained using ERCC8-specific siRNA, which similarly suppressed melanoma cell proliferation compared to control siRNA in both the WM115 and WM266-4 cells (Supplementary Figure S1B and Figure S1C, respectively).
Finally, we assessed the cell migration capability using a wound healing assay (Figure 2H,I). The results revealed a significant reduction in the migratory capacity of both WM115 and WM266-4 melanoma cells following CSA ablation. Specifically, in ASO-treated WM115 and WM266-4 cells, the percentage of wound closure was reduced to 35.7 ± 10.9% and 47.9 ± 4.6%, respectively, compared to the mock-treated cells. Notably, SO treatment did not affect wound healing in any of the cell lines. In contrast, normal FB789 cells exhibited proper wound healing, regardless of CSA expression.
To exclude the possibility that the impaired wound closure observed in CSA-silenced melanoma cells was merely a consequence of reduced proliferation or increased cell death, we performed an independent Transwell Migration Assay (Figure 2J,K). Consistently, CSA depletion significantly decreased the number of migrating WM115 and WM266-4 cells, confirming that CSA silencing directly impairs melanoma cell migratory ability. Together, these data indicate that CSA plays a crucial and selective role in sustaining melanoma cell migration, without affecting the physiological migratory properties of normal fibroblasts.

2.3. ERCC8 Gene Silencing Enhances Chemosensitivity and Selectivity of DTIC and TMZ in Melanoma Cells

To evaluate the impact of ERCC8 gene silencing on chemosensitivity, we determined the half-maximal inhibitory concentration (IC50) values for DTIC and TMZ, both alone and in combination with ASO-mediated CSA depletion, in normal fibroblasts and melanoma cells. Cell viability was measured 24 h after treatment. For DTIC, the drug was administered at concentrations ranging from 105 to 0.3 µM, while for TMZ, the dose ranged from 4630.5 to 3.5 µM (Supplementary Figure S2). The IC50 for each treatment was calculated (Figure 3A). In normal fibroblasts, IC50 values remained high across all treatments (DTIC: 68.6 ± 3.2 µM; ASO + DTIC: 72.42 ± 5.2 µM; TMZ: 3603 ± 39 µM; ASO + TMZ: 2276 ± 10.2 µM), indicating low sensitivity. In contrast, both melanoma cell lines showed markedly increased sensitivity to chemotherapy upon ERCC8 silencing. In primary WM115 melanoma cells, the IC50 for DTIC decreased from 45.25 ± 0.5 µM to 7.95 ± 2.9 µM with ASO + DTIC, and for TMZ from 1753.8 ± 7.2 µM to 369 ± 4.2 µM with ASO + TMZ. The effect was even more pronounced in metastatic WM266-4 melanoma cells, where the IC50 for DTIC dropped from 23.21 ± 1.83 µM to 0.58 ± 0.07 µM and for TMZ from 369 ± 4.2 µM to 3.85 ± 0.02 µM following CSA knockdown. To validate our findings, we extended the analysis to four additional melanoma cell lines, including one derived from a primary tumor (WM1366) and three from metastatic lesions (UACC-62, UACC-257, and RPMI-7951), each exhibiting distinct responses to DTIC and TMZ. Firstly, we verified that ERCC8-targeting ASO resulted in a significant reduction in ERCC8 mRNA levels across all melanoma cell lines tested compared to both the untreated controls (CTRL) and cells treated with SO (Supplementary Figure S3). The effect was highly significant in UACC-62, UACC-257, RPMI7951, and WM1366 cells (p < 0.001), and significant in FB789 (p < 0.01), confirming the specificity and efficacy of ASO-mediated silencing. Notably, the basal expression of CSA (CTRL and SO groups) varied considerably among the different melanoma cell lines: WM1366 exhibited the highest ERCC8 mRNA levels, followed by UACC-62, while FB789, UACC-257, and RPMI7951 showed lower basal expression. This heterogeneity in basal CSA expression highlights intrinsic differences among melanoma cell lines, which may reflect distinct regulatory mechanisms or cellular states. Importantly, in all cases, ASO treatment consistently reduced ERCC8 mRNA to comparable low levels, regardless of the initial expression. Next, we determined the IC50 values for DTIC and TMZ in each cell line before and after ERCC8 silencing. For example, in UACC-257 cells, a highly resistant line, treatment with DTIC alone resulted in an IC50 of 323 ± 13.12 µM, whereas the combination with ASO reduced the IC50 dramatically to 4.2 ± 0.2 µM. Similarly, TMZ monotherapy in UACC-257 showed a high IC50 of 256.6 ± 8.3 µM, while the ASO + TMZ combination lowered it to 3.9 ± 0.4 µM, highlighting a substantial increase in drug efficacy. Comparable trends were observed in RPMI-7951 cells, where ASO co-treatment significantly decreases the IC50 of DTIC from 110.2 ± 7.3 µM to 1.3 ± 0.09 µM, and that of TMZ from 145.2 ± 8.3 µM to 31.2 ± 0.9 µM. Regarding the two sensitive lines (UACC-62 and WM1366), these exhibited relatively low baseline IC50 values for both drugs, consistent with their inherent sensitivity. Upon ERCC8 silencing, a significant, albeit modest, further reduction in IC50 was observed. The IC50 values reported in Figure 3A are graphically summarized in Figure 3B.
Figure 3. ERCC8 silencing enhances sensitivity to alkylating agents in melanoma cell lines. (A) Half maximal inhibitory concentration (IC50, µM) values for DTIC and TMZ, alone or in combination with antisense oligonucleotides (ASOs) targeting ERCC8 in a panel of melanoma cell lines. IC50 values are expressed as the mean ± standard deviation (SD) from three independent biological experiments. (B) Bar graph showing the IC50 values reported in panel (A), illustrating the effect of ERCC8 silencing on DTIC- and TMZ-induced cytotoxicity across different melanoma cell lines. Black bars indicate DTIC, dark gray bars ASO + DTIC, medium gray bars TMZ, and light gray bars ASO + TMZ. Statistical significance is indicated by *** p < 0.001, as determined by one-way ANOVA followed by Tukey’s multiple comparisons test. (C) Selectivity index (SI) values for DTIC and TMZ, alone or in combination with ASO, in melanoma cell lines. SI values were calculated as the ratio between IC50 values in normal cells and those in melanoma cells, indicating increased tumor selectivity upon CSA silencing. (D) Bliss independence analysis of ERCC8 silencing combined with temozolomide (TMZ) or dacarbazine (DTIC) in primary (WM115) and metastatic (WM266-4) melanoma cells. ΔBliss values (Eobserved—Eexpected) are plotted as a function of Log10 (drug dose). Positive ΔBliss values indicate synergistic interactions.
The next step was to calculate the selectivity index (SI) (Figure 3C). SI, calculated as the ratio of the drug’s toxicity to normal cells (IC50) to its effectiveness against target cells (IC50), reflects how selectively a compound targets cancer cells over healthy cells [28]. A higher SI indicates greater selectivity, meaning that the compound is more toxic to cancer cells than to normal cells, thereby highlighting its therapeutic potential. For WM115 cells, the SI increased from 1.51 with DTIC and 2.05 with TMZ to 9.1 (ASO + DTIC) and 240.3 (ASO + TMZ), respectively. For WM266-4 cells, the SI increased from 2.9 (DTIC) and 9.8 (TMZ) to 124.9 (ASO + DTIC) and 591.2 (ASO + TMZ), respectively. For UACC-257 cells, the SI increased from 0.21 with DTIC and 14.04 with TMZ to 17.7 (ASO + DTIC) and 583.6 (ASO + TMZ), respectively. For RPMI7951 cells, the SI increased from 0.62 with DTIC and 24.8 with TMZ to 57.2 (ASO + DTIC) and 72.9 (ASO + TMZ), respectively. Conversely, our study showed that the sensitive cell lines (UACC-62, WM1366) did not gain a significant advantage from CSA silencing, as reflected by their SI values, indicating no meaningful increase in sensitivity to DTIC and TMZ. Overall, these results demonstrate that CSA silencing significantly enhances the chemosensitivity and selectivity of DTIC and TMZ toward melanoma cells, particularly in the metastatic setting, while minimizing toxicity to normal cells.
To quantitatively assess the interaction between ERCC8 silencing and alkylating agents, drug combination effects were analyzed using the Bliss independence model. In primary WM115 melanoma cells, combinations of ERCC8 ASO with either temozolomide (TMZ) or dacarbazine (DTIC) yielded predominantly negative or near-zero ΔBliss values across most of the tested dose range, indicating antagonistic or weakly additive interactions. Only a narrow window of modest synergy was observed at intermediate DTIC concentrations. In contrast, metastatic WM266-4 cells exhibited consistently positive ΔBliss values for both alkylating agents, indicative of robust synergistic interactions. Notably, synergy was particularly strong and sustained in combination with TMZ, where ΔBliss values remained markedly positive across a broad range of doses (Figure 3D). These results demonstrate that CSA inhibition synergistically enhances the cytotoxic effects of alkylating agents in metastatic melanoma cells, whereas primary melanoma cells derive limited combinatorial benefit, highlighting a progression-dependent vulnerability to CSA targeting.

2.4. CSA Silencing Sensitizes Metastatic Melanoma Cells to Alkylating Agents via Enhanced DNA Damage and Apoptosis

To elucidate the mechanism underlying ERCC8 silencing-mediated chemo-sensitization, we measured DNA damage and apoptosis in melanoma cells treated with DTIC and TMZ. Figure 4A, B shows the results of the neutral comet assay, which quantifies DNA damage as the mean tail moment (TM), in the melanoma cell lines WM115 and WM266-4. For both DTIC and TMZ, two different doses were used: a low dose (LD) corresponding to the IC50 in the presence of the ASO (DTIC: 7.95 µM for WM115 and 0.58 µM for WM266-4; TMZ: 369 µM for WM115 and 3.85 µM for WM266-4), and a high dose (HD) corresponding to the IC50 in the absence of the ASO (DTIC: 45.25 µM for WM115 and 23.21 µM for WM266-4; TMZ: 1753.8 µM for WM115 and 369 µM for WM266-4). Under control conditions (Medium, SO), both cell lines exhibited low TM values, indicating minimal baseline DNA damage.
Figure 4. DNA damage and apoptosis analysis upon ERCC8 silencing and treatment with DTIC or TMZ agents in WM115 and WM266-4 melanoma cells. DNA damage analysis by neutral comet assay. WM115 and WM266-4 cells were treated with ASO ERCC8, DTIC (high dose, HD; low dose, LD), TMZ (HD; LD), or their combinations with ASO ERCC8. LD and HD correspond to IC50 values in the presence or absence of ASO, as detailed in the main text. Mean tail moment (TM) was measured as an indicator of DNA double-strand breaks. (A) Representative fluorescence micrographs of the comet assay in WM115 and WM266-4 melanoma cells under the indicated treatment conditions. (B) Data are presented as the mean ± standard deviation (SD) from three independent biological replicates. Statistical significance is indicated by ** p < 0.01 and *** p < 0.001, as determined by one-way ANOVA followed by Tukey’s multiple comparisons test. (C) Representative fluorescence micrographs of apoptosis in WM115 and WM266-4 melanoma cells under the indicated treatment conditions using a combination of three vital dyes. Cells were stained with HOECHST (nuclei of living cells in blue), FDA (cytoplasm of living cells in green), and PI (nuclei of dead cells in red) to quantify live, apoptotic, and/or necrotic cells. (D) Data are presented as the mean ± SD from three independent biological replicates. Statistical significance is indicated by *** p < 0.001, as determined by one-way ANOVA followed by Tukey’s multiple comparisons test.
Depletion of the CSA protein (ASO) alone led to a slight increase in DNA damage, which was more pronounced in WM115 cells. Treatment with high doses of DTIC or TMZ resulted in a marked increase in TM, particularly in WM266-4 cells. Notably, the combination of ERCC8 silencing with low doses of DTIC or TMZ (ASO + DTIC LD or ASO + TMZ LD) produced a significant increase in TM compared to single treatments, suggesting a synergistic effect on DNA damage—especially evident in WM266-4 cells. Figure 4C,D shows the percentage of apoptotic cells under the same experimental conditions. Control cells displayed low levels of apoptosis, while ERCC8 silencing alone moderately increased apoptosis in both melanoma cell lines. High-dose DTIC and TMZ induced a strong apoptotic response, again more pronounced in WM266-4 cells. Strikingly, the combination of ASO with low-dose DTIC or TMZ led to a dramatic increase in apoptosis, reaching 70% in WM266-4 cells treated with ASO plus either DTIC LD or TMZ LD. Interestingly, in WM115 cells, the combination of ASO with low-dose DTIC or TMZ did not further increase apoptosis beyond the level observed with ASO treatment alone.
Based on the comet assay and apoptosis data, WM266-4 cells showed a markedly higher sensitivity to ERCC8 silencing and to alkylating agents compared to WM115. WM266-4 cells exhibited greater DNA damage accumulation and higher apoptosis levels upon CSA depletion, especially in combination with chemotherapeutic treatments. In contrast, FB789 fibroblasts did not show detectable changes in viability, apoptosis, DNA damage, or cell-cycle distribution following ERCC8 silencing or chemotherapy (Figure 2 and Figure 3). Accordingly, cell-cycle analysis was performed only in melanoma cells, with a focus on WM266-4, the line showing the strongest measurable response to ERCC8 knockdown under genotoxic stress.
Flow cytometry analysis revealed that CSA depletion profoundly affected cell cycle progression in WM266-4 cells, especially in combination with DNA-damaging agents (Figure 5). In control cells (K), the distribution was typical of a proliferating population, with 64.32% of cells in the G1 phase, 22.46% in the S phase, and 13.20% in G2/M. Silencing CSA alone induced a marked accumulation of cells in the G1 phase (71.99%), accompanied by a reduction in S phase (17.19%) and a slight decrease in G2/M (10.80%), suggesting the activation of a G1 checkpoint even in the absence of exogenous DNA damage.
Figure 5. Bivariate flow cytometry analysis of the cell cycle distribution in WM266-4 cells upon ERCC8 silencing and alkylating agent treatment. WM266-4 cells were treated with antisense oligonucleotides targeting ERCC8 (ASO), DTIC (high dose, HD; low dose, LD), TMZ (HD; LD), or the corresponding combinations. LD and HD correspond to IC50 values in the presence or absence of ASO, as detailed in the main text. Untreated control cells (K) and cells treated with ASO alone were included. Cells were pulse-labeled with BrdU and stained with propidium iodide (PI; PerCP channel, x-axis) to assess DNA content, and with anti-BrdU–FITC (y-axis) to detect DNA synthesis. Bivariate dot plots show representative data from a single experiment, illustrating the distribution of cells in the G1, S, and G2/M phases of the cell cycle. The percentages of cells in each phase are reported as mean ± SD from three (n = 3) independent biological experiments.
Treatment with DTIC, both at high and low doses, induced detectable alterations in cell cycle distribution compared to the control (K). DTIC HD increased the G1 population (72.53% vs. 64.32% in control) and reduced the proportion of cells in the S phase (16.12% vs. 22.46% in control), suggesting that DTIC can activate a G1 checkpoint or impair G1/S transition. A similar trend was observed with DTIC LD (G1: 70.40%, S: 17.63%). These data indicate that DTIC, even at low doses, affects cell cycle progression by reducing DNA synthesis activity, although the magnitude of this effect is less pronounced than that observed with TMZ or with the combination treatments involving CSA depletion. Remarkably, the combination of DTIC LD with ERCC8 silencing led to a profound G1 arrest, with 81.72% of cells accumulated in this phase, coupled with a dramatic reduction in the S-phase population to 8.61%. This suggests that in the absence of CSA, even low-dose DTIC triggers a robust checkpoint response that prevents entry into DNA synthesis, likely due to the accumulation of unrepaired DNA lesions.
A different pattern was observed upon TMZ treatment. High-dose TMZ induced a significant accumulation of cells in the S phase (34.20%) and G2/M (22.72%), with a concomitant decrease in the G1 population (43.08%). This profile is consistent with replication stress and impaired S-phase progression induced by alkylating lesions. Notably, a marked reduction in the G1 population was observed without the appearance of a distinct sub-G1 peak, despite the increased apoptosis detected in Figure 4. This reflects a methodological limitation of the BrdU/PI assay, which does not effectively resolve apoptotic DNA fragmentation: late-apoptotic cells may be lost during processing or fall outside the gating, and TMZ/HD-driven S/G2 accumulation further reduces the apparent G1 fraction. As a result, apoptosis does not necessarily manifest as a sub-G1 population in this assay.
TMZ at low dose had a milder effect, with a cell cycle distribution comparable to the control (G1: 68.43%, S: 20.84%, G2/M: 10.72%).
Strikingly, the combination of TMZ LD with ERCC8 knockdown recapitulated the phenotype observed with DTIC LD plus ASO, leading to a strong G1 arrest (77.55%) and a marked decrease in S-phase cells (11.33%). This finding indicates that CSA depletion prevents cells from initiating DNA replication in the presence of TMZ-induced DNA damage.
Overall, these results suggest that ERCC8 knockdown exacerbates the impact of alkylating agents by activating a robust G1 checkpoint, thereby blocking cell cycle progression prior to DNA synthesis. This cell cycle arrest correlates with the increased DNA damage and apoptosis previously observed, supporting the idea that CSA plays a critical role in protecting melanoma cells from genotoxic stress and in sustaining their proliferative capacity under DNA-damaging conditions. The restriction of this analysis to WM266-4 cells is justified by their higher dependency on CSA-mediated genome maintenance pathways, as evidenced by their greater vulnerability in the previous experiments.

3. Discussion

Despite the success of immunotherapies and BRAF/MEK inhibitors, a subset of melanoma patients—particularly those with brain metastases or refractory disease—still relies on conventional chemotherapy. In this setting, DNA-methylating agents such as Dacarbazine (DTIC) and Temozolomide (TMZ) remain among the few available options, although their clinical benefit is limited by low response rates and significant toxicity. Therefore, strategies aimed at improving the efficacy and therapeutic index of these agents are urgently needed [29].
In this study, we demonstrate that antisense oligonucleotide (ASO)-mediated silencing of CSA/ERCC8 strongly sensitizes melanoma cells to DTIC and TMZ [see graphical abstract]. CSA knockdown reduced IC50 values in primary WM115 cells by approximately fivefold, while the effect was dramatically amplified in metastatic WM266-4 cells, with reductions of ~40-fold for DTIC and ~95-fold for TMZ. Consequently, the selectivity index (SI) increased markedly, indicating that CSA inhibition may allow for substantial dose reduction while enhancing therapeutic efficacy and tolerability.
Although some TMZ concentrations required to reach the IC50 values in vitro exceed clinically achievable plasma levels, in vitro systems lack pharmacokinetic and microenvironmental parameters that influence drug activity in vivo. Therefore, the relevant observation is the pronounced shift in TMZ sensitivity following CSA depletion rather than the absolute drug concentration per se. Consistent with these findings, combined ERCC8 silencing and low-dose DTIC or TMZ induced DNA damage levels comparable to or exceeding those observed with high-dose chemotherapy alone. This effect was particularly evident in metastatic cells and correlated with a strong induction of apoptosis, reaching nearly 80% in WM266-4 cells treated with ASO + TMZ. The weaker response observed in WM115 cells suggests a greater dependence of metastatic melanoma on CSA-mediated DNA repair and survival pathways. The partial dissociation between comet assay results and apoptosis is in line with the fact that early apoptotic stages are not always associated with extensive DNA fragmentation detectable by neutral comet analysis.
Importantly, CSA ablation alone significantly reduced the tumorigenic potential and fitness of melanoma cells without affecting normal fibroblasts, highlighting a high degree of tumor selectivity. While fibroblasts were used as a model of normal CSA-proficient cells, we acknowledge that lineage-specific differences may exist and that future studies including primary melanocytes will help further refine the assessment of tumor-specific dependency. This observation nonetheless raises the question of why melanoma cells are particularly dependent on CSA. Previous studies, including our own, have shown that CSA promotes cancer cell survival by coordinating DNA repair, hypoxia responses, unfolded protein response activation, and the suppression of pro-apoptotic pathways including p53- and ATF3-mediated signaling [27,30].
These functions likely underpin the strong reliance of melanoma cells on CSA to sustain proliferation and resistance to stress. In line with this concept, the analysis of TCGA datasets indicates that ERCC8 expression is variable in human tumors and modulated in association with genomic alterations, with increased heterogeneity particularly evident in metastatic samples. The variability of ERCC8 expression observed in human tumors, particularly in metastatic contexts, suggests that CSA-dependent proteostatic and ubiquitin-mediated processes may represent context-dependent vulnerabilities rather than uniform features of all cancers.
The enhanced sensitization observed in metastatic WM266-4 cells may reflect selective pressures acquired during melanoma progression. Proteomic analyses have shown increased ATM and DNA-PK activity in these cells, suggesting elevated DNA damage signaling and p53 activation. Under such conditions, melanoma cells may become increasingly dependent on CSA to counterbalance pro-apoptotic signals and maintain viability.
Cell-cycle analysis further supports this model. ERCC8 silencing reduced the S-phase population in WM266-4 cells, consistent with G1/S checkpoint activation due to unresolved DNA damage caused by impaired transcription-coupled nucleotide excision repair (TC-NER). CSA depletion also shifted TMZ-induced arrest from the S phase to G1, suggesting that CSA facilitates S-phase entry under genotoxic stress. This G1 retention may represent a vulnerable state that enhances sensitivity to alkylating agents, providing a mechanistic rationale for the observed synthetic lethality [31].
Importantly, the G1 arrest observed upon CSA depletion does not appear to be driven by canonical p53 activation. Western blot analyses in both WM115 and WM266-4 cells showed that ASO-mediated CSA silencing did not significantly increase the total or Ser15-phosphorylated p53 levels, in contrast to high-dose TMZ or DTIC treatments, which robustly activated the p53 damage response pathway (Supplementary Figure S4). These findings indicate that CSA-dependent cell cycle regulation operates largely independently of bulk p53 stabilization. Instead, G1 retention is consistent with the disruption of CSA-mediated stress adaptation mechanisms, including transcription-associated stress responses and proteostasis control, which can engage p53-independent checkpoints.
Although not directly examined in this study, the DNA damage accumulation, replication stress, and checkpoint arrest observed upon CSA depletion are compatible with the activation of canonical DNA damage response pathways, potentially involving ATM/ATR–CHK1/CHK2 signaling. However, the specific DDR components affected remain to be determined.
The chemo-sensitizing effect of ERCC8 silencing was also evident in intrinsically resistant melanoma cell lines such as UACC-257 and RPMI7951, which have been shown in previous studies to exhibit the upregulation of DNA repair pathways, including components of transcription-coupled nucleotide excision repair (TC-NER) and base excision repair (BER), contributing to their intrinsic chemoresistance [32,33]. In these cell lines, ASO co-treatment reduced DTIC and TMZ IC50 values by several orders of magnitude and dramatically improved the selectivity index (SI). In contrast, sensitive lines showed more modest effects, indicating that CSA-mediated resistance mechanisms are particularly relevant in resistant melanoma subtypes. Given the known role of CSA in TC-NER, transcriptional stress tolerance, and proteostasis, its inhibition likely impairs multiple adaptive pathways required for survival following alkylation-induced DNA damage. Beyond its canonical role in transcription-coupled DNA damage response, CSA has recently been implicated in the maintenance of nuclear envelope integrity, a non-canonical function that may influence genome stability [34]. Since nuclear envelope components such as lamin A/C and lamin B1 actively contribute to DNA repair, CSA depletion may enhance chemosensitivity by simultaneously impairing transcription-coupled damage tolerance and nuclear envelope-dependent repair processes [35,36]. Moreover, CSA has also been implicated in modulating oxidative stress responses and proteostasis [37,38], which may further contribute to cellular resilience in drug-resistant melanoma. Its silencing might thus compromise additional survival pathways beyond DNA repair, amplifying the cytotoxic impact of alkylating agents in resistant cells. Taken together, these mechanistic insights align with the phenotypic data and support a model in which CSA acts as a key resistance factor, whose inhibition can restore chemo-sensitivity in aggressive melanoma sub-types.

4. Conclusions

In conclusion, our data identify CSA/ERCC8 as a key mediator of resistance to alkylating agents in melanoma. CSA silencing significantly enhances both the efficacy and selectivity of DTIC and TMZ, particularly in resistant and metastatic melanoma cells. Although the present study is limited to in vitro models, the translational relevance of CSA targeting is supported by the growing clinical use of antisense oligonucleotides in oncology. Chemically modified ASOs can be efficiently delivered in vivo using lipid nanoparticles or conjugation-based strategies, achieving favorable pharmacokinetics and tumor biodistribution. In parallel, alternative pharmacological strategies aimed at inhibiting CSA function may be developed to complement or substitute nucleic acid-based approaches. Together, these findings support the further investigation of CSA as a promising therapeutic target to overcome chemoresistance and improve the clinical utility of alkylating chemotherapy in melanoma.

5. Materials & Methods

5.1. Cell Lines

One normal (FB789) and two melanoma cancer WM115 (primary) and WM266-4 (metastatic) cell lines were used. FB789 is a primary epithelial fibroblast and was grown in DMEM/F10 (Thermo Fisher, Waltham, MA, USA) medium. WM115 human melanoma cells originated from a primary cutaneous tumor, whereas the WM266-4 melanoma cell line was derived from a lymph node metastasis of the same patients [39]. Both cell lines feature the oncogenic mutation at codon 600 in the BRAF gene where a residual valine is replaced with an aspartatic acid (V600D). WM115 and WM266-4 were grown in Mimimal Essential Medium (MEM) (Thermo Fisher, Waltham, MA, USA) supplemented with 1% Na-Piruvate and 1% of non-essential amino acids (NEA) (Thermo Fisher, Waltham, MA, USA). All culture mediums were supplemented with 10% fetal bovine serum, 2 mM glutamine, and 40 µg/mL of gentamicin (Sigma-Aldrich: St. Louis, MO, USA). FB789, WM115 and WM266-4 were kindly provided by Dr. Elena Dell’Ambra.

5.2. Oligonucleotides Transfection

The oligonucleotide transfection was performed as previously described [27] with minor modification. The final concentration of oligonucleotides used for transfection was 100 nM. The cells were incubated at 37 °C and 5% CO2 until the analysis was carried out at 48 h after transfection without the need to change the transfection medium. ASO and SO sequences were GCTTGTGACTTTTTCCCATT and AATGGGAAAAAGTCACAAGC, respectively.

5.3. DTIC and TMZ Treatment in Presence or Not of CSA Antisense Oligonucleotide

Cell lines were seeded the day before drug treatment in an appropriate concentration. DTIC was used in a range of 0.3 to 105 µM in all cell lines. TMZ treatments were between 3.5 and 4630.5 µM. At the end of 24 h treatment, the IC50 value was calculated using the GraphPad V.8 program (San Diego, CA, USA). In combined ASO treatment, DTIC and TMZ were added after the medium change at 48 h for an additional 24 h.

5.4. Protein Expression Analysis by Western Blot

Protein extracts from FB789, WM115, and WM266-4 were extracted in RIPA buffer. These were fractionated by SDS-PAGE and transferred to a nitrocellulose membrane (Biorad Laboratories, Hercules, CA, USA). Primary antibodies used were CSA (Cell signalling Techology, Danvers, MA, USA) and β-actin (Santa Cruz Biotecnology, Santa Cruz, CA, USA), while secondary antibodies were HRP conjugated.

5.5. RNA Extraction and qRT-PCR

A total of 1.5 × 105 cells were seeded in 60 mm-dishes. After 24 h, the total RNA was extracted and purified according to the manufacturer’s instructions (Total RNA Purification Kit, Geneaid). RNA was quantified using a fluorimetric assay (Qubit, Thermofisher). cDNA synthesis was performed using the PrimeScript cDNA Synthesis Kit (Taqara, BioEurope). Comparative qRT-PCR was carried out with GoTaq qPCR SYBR Green Master Mix (Promega, Madison, WI, USA) and amplified with an Mx3005P Real-Time PCR system (Agilent, Santa Clara, CA, USA). Results were normalized to β-actin. Primer sequences are available on request.

5.6. Cell Viability MTT Assay

FB789, WM115 and WM266-4 cells were seeded in 96-well microplates (2000 cells/well in 100 μL medium) and incubated overnight to allow cell adherence. At the end of the treatments with the ASO and chemotherapeutic agents, the cells were treated with MTT (10 μL of the 12 mM stock solution) and incubated at 37 °C for 4 h. DMSO lysis solution (100 μL) was added to dissolve the formed formazan crystals. The absorbance was then measured with a microplate reader at 570 nm and 630 nm. The IC50 value was calculated by GraphPad software version 8 [40].

5.7. Proliferation Tripan Blue Exclusion (TBE) Assay

Briefly, 1 × 105 cell lines were seeded in 6-well dishes. The cell proliferation assay was performed using 0.05% Trypan Blue solution to distinguish live and dead cells within a Burker chamber. Around 500 cells for three replicate counts were determined at each time point (24 h and 48 h after transfection).

5.8. Apoptosis Assay

A combination of fluorescent dyes was mixed. Fluorescein diacetate (FDA; 15 µg/mL), propidium iodide (PI, 5 µg/mL), and Hoechst (HO, 2 µg/mL) was used to differentiate apoptotic cells from viable cells. FDA and HO are vital dyes that stain the cytoplasm and nucleus of the viable cells, respectively, while the necrotic and the late stage of apoptotic cells are readily identified by PI staining. Approximately 500 randomly chosen cells, from three independent experiments, were microscopically analyzed to determine the apoptosis levels.

5.9. Wound Healing Assay

Cells were seeded in 60-mm Petri dishes to reach confluence. One day after seeding, an artificial wound was created with the end of a yellow tip.
Images were collected 48 h after ASO or SO transfection using Axio Camera 208 color and the width of the wound was analyzed by ImageJ software, version 2.14.

5.10. Cell Cycle Analysis

For cell cycle analysis, aliquots of 1 × 106 cells were seeded in a complete medium in 10 cm Petri dishes. One hour before fixation in 70% ethanol, 10 μM bromodeoxyuridine (BrdUrd) was added to medium culturing. Each sample were exposed to acid denaturation (3 N HCl) and then were incubated for 1 h in a blocking solution (10% normal goat serum/PBS). After that, samples were serially incubated with a primary antibody to BrdUrd (1:100 in blocking solution) and then a secondary FITC-conjugated antibody (1:50 in blocking solution). Samples were re-suspended in 20 μg/mL propidium iodide (PI) prior to analysis.

5.11. Neutral Comet Assay

The neutral comet assay was performed as described earlier under visible fluorescent light with minor modification [41].
After ASO and drug treatments, cells were collected and processed for the assay. Briefly, 20 μL of the cell suspension (5 × 105 cells) was mixed with 80 μL of 0.7% low melting-point agarose (LMPA) in PBS at 37 °C and immediately pipetted onto a frosted glass microscope slide pre-coated with a layer of 1% normal melting-point agarose (NMPA), similarly prepared in PBS. Two slides for each sample were then incubated in lysis solution (2.5 M NaCl, 10 mM Tris–HCl, 100 mM EDTA, pH 10, with 1% Triton, and 10% DMSO freshly added) for 1 day at 4 °C. After lysis, slides were washed three times with electrophoresis buffer (300 mM sodium acetate, 100 mM Tris-HCl pH:8.3) and then placed on a horizontal electrophoresis unit containing fresh electrophoresis buffer. Electrophoresis was conducted for 60 min at 18 V and variable mA at 4 °C. Subsequently, the slides were gently washed three times in PBS for 5 min and fixed in fresh 100% methanol for 3 min. Slides were stained with 50 μL DAPI (20 μg/mL) and covered with a coverslip. Stained nucleoids were examined with confocal microscopy and analyzed with ImageJ software. To evaluate the amount of DNA damage, program-generated tail-moment (TM) values and percentages of DNA damage were used. For each experimental point, 100 cells were scored from two slides for a total of 200 cells.

5.12. Statistical Analysis

Statistical analysis was performed by using GraphPad software version 8. To test the statistically significant difference between FB789 and the melanoma cell lines (WM115 and WM266-4) following ERCC8 silencing with ASO in the presence or absence of the chemotherapeutic agents, the student t-test and two-way ANOVA (non-repeated measures) followed by Tukey’s multiple comparisons test were performed. All statistical tests were conducted by setting the significance level at three different values * p < 0.05, ** p < 0.01, and *** p < 0.001.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/cancers18040647/s1, Figure S1: qRT-PCR analysis of ERCC8 mRNA expression 48 h after transfection with antisense oligonucleotide (ASO) or control treatments; Figure S2: Effect of CSA silencing on sensitivity to DTIC (top) and TMZ (bottom) in melanoma cell lines FB789, WM115, and WM266-4; Figure S3: Relative ERCC8 (CSA) mRNA expression in melanoma cell lines (FB789, UACC-62, UACC-257, RPMI7951, WM1366) under control conditions (Medium), scrambled oligo (SO), or ASO CSA treatment, Figure S4: p53 and phospho-p53 (Ser15) protein levels in WM115 (A,B) and WM266-4 (C,D) cells under control (Medium), ASO CSA, DTIC or TMZ (low/high dose), and combined treatments. Representative immunoblots (A,C) and β-ACTIN–normalized quantification (B,D) show increased p53 activation following drug exposure, enhanced by CSA silencing; Table S1: ERCC8: mRNA expression.

Author Contributions

Conceptualization, S.F. and L.P.-D.-S.; methodology, S.F., D.G. and E.V.; software, V.B.; validation, E.P., S.F. and L.P.-D.-S.; formal analysis, S.F.; investigation, E.V. and S.F.; data curation, S.F.; writing—original draft preparation, S.F. and L.P.-D.-S.; writing—review and editing, S.F. and L.P.-D.-S.; funding acquisition, L.P.-D.-S. All authors have read and agreed to the published version of the manuscript.

Funding

We acknowledge financial support under the National Recovery and Resilience Plan (NRRP), Mission 4, Component 2, Investment 1.1, Call for tender No. 104 published on 2 February 2022 by the Italian Ministry of University and Research (MUR), funded by the European Union—NextGenerationEU–Project Title REBALANCE—CUP J53D23003180006—Grant Assignment Decree No. 970 adopted on 30 June 2023 by the Italian Ministry of Ministry of University and Research (MUR).

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding author(s).

Acknowledgments

We thank María S. Soengas (Melanoma Laboratory, Molecular Oncology Program, Spanish National Cancer Research Center (CNIO), Madrid, Spain) for kindly providing us with several melanoma cell lines. During the preparation of this work, the author(s) used ChatGPT 5.2 to check spelling and grammar, and occasionally to paraphrase portions of the text. After using this tool, the author(s) reviewed and edited the content as needed and take full responsibility for the final version of the manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

Abbreviations

ASOAntisense Oligonucleotide
ATF3Activating Transcription Factor 3
BrdU5-Bromo-2′-deoxyuridine
CSACockayne Syndrome Protein A
CSBCockayne Syndrome Protein B
CtCycle Threshold
DAPI4′,6-diamidino-2-phenylindole
DDRDNA Damage Response
DTICDacarbazine
DSBDouble-Strand Break
FB789Human Fibroblast Cell Line
FBSFetal Bovine Serum
FITCFluorescein Isothiocyanate
GAPDHGlyceraldehyde-3-Phosphate Dehydrogenase
HDHigh Dose
HOHoechst
IC50Half-Maximal Inhibitory Concentration
LDLow Dose
MFIMean Fluorescence Intensity
NERNucleotide Excision Repair
PBSPhosphate-Buffered Saline
PIPropidium Iodide
qPCRQuantitative Polymerase Chain Reaction
RNA Pol IIRNA Polymerase II
SDStandard Deviation
siRNASmall Interfering RNA
SISelectivity Index
SOSense Oligonucleotide
TC-NERTranscription-Coupled Nucleotide Excision Repair
TMZTemozolomide

References

  1. Wang, M.; Gao, X.; Zhang, L. Recent global patterns in skin cancer incidence, mortality, and prevalence: A review of GLOBOCAN 2022 data. Chin. Med. J. (Engl.) 2024, 138, 185–192. [Google Scholar] [CrossRef] [Scilit]
  2. Feller, L.; Khammissa, R.A.G.; Kramer, B.; Altini, M.; Lemmer, J. Basal cell carcinoma, squamous cell carcinoma and melanoma of the head and face. Head Face Med. 2016, 12, 11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Garbe, C.; Amaral, T.; Peris, K.; Hauschild, A.; Arenberger, P.; Basset-Seguin, N.; Bastholt, L.; Bataille, V.; Brochez, L.; Del Marmol, V.; et al. European consensus-based interdisciplinary guideline for melanoma. Part 1: Diagnostics—Update 2024. Eur. J. Cancer 2025, 215, 115152. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Karami Fath, M.; Azargoonjahromi, A.; Soofi, A.; Almasi, F.; Hosseinzadeh, S.; Khalili, S.; Sheikhi, K.; Ferdousmakan, S.; Owrangi, S.; Fahimi, M.; et al. Current understanding of epigenetics role in melanoma treatment and resistance. Cancer Cell Int. 2022, 22, 313. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Luke, J.J.; Flaherty, K.T.; Ribas, A.; Long, G.V. Targeted agents and immunotherapies: Optimizing outcomes in melanoma. Nat. Rev. Clin. Oncol. 2017, 14, 463–482. [Google Scholar] [CrossRef] [Scilit]
  6. Subbiah, V.; Puzanov, I.; Blay, J.Y.; Chau, I.; Lockhart, A.C.; Raje, N.S.; Wolf, J.; Baselga, J.; Meric-Bernstam, F.; Roszik, J.; et al. Pan-cancer efficacy of vemurafenib in BRAFV600-mutant non-melanoma cancers. Cancer Discov. 2020, 10, 657–663. [Google Scholar] [CrossRef] [Scilit]
  7. Abdulkarim, L.S.; Motley, R.J. First-line advanced cutaneous melanoma treatments: Where do we stand? JMIR Cancer 2021, 7, e29912. [Google Scholar] [CrossRef] [Scilit]
  8. Sullivan, R.J.; Flaherty, K.T. Resistance to BRAF-targeted therapy in melanoma. Eur. J. Cancer 2013, 49, 1297–1304. [Google Scholar] [CrossRef] [Scilit]
  9. Larkin, J.; Chiarion-Sileni, V.; Gonzalez, R.; Grob, J.J.; Rutkowski, P.; Lao, C.D.; Cowey, C.L.; Schadendorf, D.; Wagstaff, J.; Dummer, R.; et al. Five-year survival with combined nivolumab and ipilimumab in advanced melanoma. N. Engl. J. Med. 2019, 381, 1535–1546. [Google Scholar] [CrossRef] [Scilit]
  10. Hodi, F.S.; Chiarion-Sileni, V.; Gonzalez, R.; Grob, J.J.; Rutkowski, P.; Cowey, C.L.; Lao, C.D.; Schadendorf, D.; Wagstaff, J.; Dummer, R.; et al. Nivolumab plus ipilimumab or nivolumab alone vs ipilimumab alone in advanced melanoma (CheckMate 067): 4-year outcomes. Lancet Oncol. 2018, 19, 1480–1492. [Google Scholar] [CrossRef] [Scilit]
  11. Weber, J.S.; D’Angelo, S.P.; Minor, D.; Hodi, F.S.; Gutzmer, R.; Neyns, B.; Hoeller, C.; Khushalani, N.I.; Miller, W.H., Jr.; Lao, C.D.; et al. Nivolumab vs chemotherapy in advanced melanoma progressed after anti–CTLA-4 (CheckMate 037): A phase III trial. Lancet Oncol. 2015, 16, 375–384. [Google Scholar] [CrossRef] [Scilit]
  12. Gupta, A.; Gomes, F.; Lorigan, P. The role for chemotherapy in the modern management of melanoma. Melanoma Manag. 2017, 4, 125–136. [Google Scholar] [CrossRef] [Scilit]
  13. Middleton, M.R.; Grob, J.J.; Aaronson, N.; Fierlbeck, G.; Tilgen, W.; Seiter, S.; Gore, M.; Aamdal, S.; Cebon, J.; Coates, A.; et al. Phase III study of temozolomide vs dacarbazine in advanced melanoma. J. Clin. Oncol. 2000, 18, 158–166. [Google Scholar] [CrossRef] [Scilit]
  14. Grob, J.J.; Amonkar, M.M.; Martin-Algarra, S.; Demidov, L.V.; Goodman, V.; Grotzinger, K.; Haney, P.; Kämpgen, E.; Karaszewska, B.; Mauch, C.; et al. Patient perception of BRAF inhibitor benefit: Quality-of-life in the BREAK-3 study. Ann. Oncol. 2014, 25, 1428–1436. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Zhang, J.; Stevens, M.F.G.; Bradshaw, T.D. Temozolomide: Mechanisms of action, repair and resistance. Curr. Mol. Pharmacol. 2012, 5, 102–114. [Google Scholar] [CrossRef]
  16. Povirk, L.F.; Shukla, M.S. DNA repair mechanisms and response to alkylating agents. Front. Mol. Biosci. 2016, 3, 54. [Google Scholar]
  17. Hanawalt, P.C.; Spivak, G. Transcription-coupled DNA repair: Two decades of progress. Nat. Rev. Mol. Cell Biol. 2008, 9, 958–970. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Obrador, E.; Liu-Smith, F.; Dellinger, R.W.; Salvador, R.; Meyskens, F.L.; Estrela, J.M. Oxidative stress and antioxidants in the pathophysiology of malignant melanoma. Biol. Chem. 2019, 400, 589–612. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Meierjohann, S. Oxidative stress in melanocyte senescence and melanoma transformation. Eur. J. Cell Biol. 2014, 93, 36–41. [Google Scholar] [CrossRef] [Scilit]
  20. Centeno, P.P.; Pavet, V.; Marais, R. The journey from melanocytes to melanoma. Nat. Rev. Cancer 2023, 23, 372–390. [Google Scholar] [CrossRef] [Scilit]
  21. Gupta, R.; Janostiak, R.; Wajapeyee, N. Transcriptional regulators and alterations that drive melanoma initiation and progression. Oncogene 2020, 39, 7093–7105. [Google Scholar] [CrossRef] [Scilit]
  22. Osrodek, M.; Wozniak, M. Targeting genome stability in melanoma—A new approach to an old field. Int. J. Mol. Sci. 2021, 22, 3485. [Google Scholar] [CrossRef] [Scilit]
  23. Kauffmann, A.; Rosselli, F.; Lazar, V.; Winnepenninckx, V.; Mansuet-Lupo, A.; Dessen, P.; van den Oord, J.J.; Spatz, A.; Sarasin, A. High expression of DNA repair pathways is associated with metastasis in melanoma patients. Oncogene 2008, 27, 565–573. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Latini, P.; Frontini, M.; Caputo, M.; Gregan, J.; Cipak, L.; Filippi, S.; Kumar, V.; Vélez-Cruz, R.; Stefanini, M.; Proietti-De-Santis, L.; et al. CSA and CSB regulate p53 Mdm2-dependent ubiquitination. Cell Cycle 2011, 10, 3719–3730. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Epanchintsev, A.; Costanzo, F.; Rauschendorf, M.A.; Caputo, M.; Ye, T.; Donnio, L.M.; Proietti-de-Santis, L.; Coin, F.; Laugel, V.; Egly, J.M.; et al. CS proteins regulate transcription arrest via ATF3 degradation. Mol. Cell 2017, 68, 1054–1066.e6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Costanzo, F.; Paccosi, E.; Proietti-De-Santis, L.; Egly, J.M. CS proteins and ubiquitination: Orchestrating DNA repair, transcription and division. Trends Cell Biol. 2024, 34, 882–895. [Google Scholar] [CrossRef] [Scilit]
  27. Filippi, S.; Paccosi, E.; Balzerano, A.; Ferretti, M.; Poli, G.; Taborri, J.; Brancorsini, S.; Proietti-De-Santis, L. CSA antisense targeting enhances drug sensitivity in breast cancer. Cancers 2022, 14, 1687. [Google Scholar] [CrossRef] [Scilit]
  28. Weerapreeyakul, N.; Junhom, C.; Barusrux, S.; Thitimetharoch, T. Induction of apoptosis in human hepatocellular carcinoma cells by extracts of Lannea coromandelica (Houtt.) Merr. and Diospyros castanea (Craib) Fletcher. Chin. Med. 2016, 11, 19. [Google Scholar] [CrossRef] [Scilit]
  29. Giannopoulou, A.F.; Velentzas, A.D.; Anagnostopoulos, A.K.; Agalou, A.; Papandreou, N.C.; Katarachia, S.A.; Koumoundourou, D.G.; Konstantakou, E.G.; Pantazopoulou, V.I.; Delis, A.; et al. From Proteomic Mapping to Invasion-Metastasis-Cascade Systemic Biomarkering and Targeted Drugging of Mutant BRAF-Dependent Human Cutaneous Melanomagenesis. Cancers 2021, 13, 2024. [Google Scholar] [CrossRef] [Scilit]
  30. Marteijn, J.A.; Lans, H.; Vermeulen, W.; Hoeijmakers, J.H.J. Understanding nucleotide excision repair in cancer and ageing. Nat. Rev. Mol. Cell Biol. 2014, 15, 465–481. [Google Scholar] [CrossRef] [Scilit]
  31. Pegg, A.E. Multifaceted roles of alkyltransferase and related proteins in DNA repair, resistance to chemotherapy, and research tools. Chem. Res. Toxicol. 2011, 24, 618–639. [Google Scholar] [CrossRef] [Scilit]
  32. Barckhausen, C.; Roos, W.P.; Naumann, S.C.; Kaina, B. Malignant melanoma cells acquire resistance to DNA interstrand cross-linking chemotherapeutics by p53-triggered upregulation of DDB2/XPC-mediated DNA repair. Oncogene 2014, 33, 1964–1974. [Google Scholar] [CrossRef] [Scilit]
  33. Lord, C.J.; Ashworth, A. DNA repair and cancer therapy: Targeting for personalized medicine. Genome Med. 2025, 17, 25. [Google Scholar]
  34. Yang, D.; Lai, A.; Davies, A.; Janssen, A.F.; Ellis, M.O.; Larrieu, D. A novel role for CSA in the regulation of nuclear envelope integrity: Uncovering a non-canonical function. Life Sci. Alliance 2024, 7, e202402745. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Wang, Y.; Chen, Q.; Wu, D.; Chen, Q.; Gong, G.; He, L.; Wu, X. Lamin-A interacting protein Hsp90 is required for DNA damage repair and chemoresistance of ovarian cancer cells. Cell Death Dis. 2021, 12, 786. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Li, Y.; Feng, Y.; Chen, D. Interfering nuclear protein Lamin B1 induces DNA damage and reduces vemurafenib resistance in melanoma cells in vitro. Cancers 2024, 16, 4060. [Google Scholar] [CrossRef] [Scilit]
  37. D’Errico, M.; Pascucci, B.; Iorio, E.; Van Houten, B.; Dogliotti, E. The role of CSA and CSB protein in the oxidative stress response. Mech Ageing Dev. 2013, 134, 261–269. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Koch, S.; García, C.U.; Webb, T. Multifunctional roles of CSA and CSB in DNA repair and beyond. Mech. Ageing Dev. 2020, 189, 111253. [Google Scholar]
  39. Herlyn, M.; Thurin, J.; Balaban, G.; Bennicelli, J.L.; Herlyn, D.; Elder, D.E.; Bondi, E.; Guerry, D.; Nowell, P.; Clark, W.H.; et al. Characteristics of cultured human melanocytes isolated from different stages of tumor progression. Cancer Res. 1985, 45, 5670–5676. [Google Scholar]
  40. Botta, L.; Cesarini, S.; Zippilli, C.; Filippi, S.; Bizzarri, B.M.; Baratto, M.C.; Pogni, R.; Saladino, R. Stereoselective Access to Antimelanoma Agents by Hybridization and Dimerization of Dihydroartemisinin and Artesunic acid. ChemMedChem. 2021, 16, 2270–2277. [Google Scholar] [CrossRef] [Scilit]
  41. Boutet-Robinet, E.; Trouche, D.; Canitrot, Y. Neutral comet assay. Bio-Protocol 2013, 3, e915. [Google Scholar] [CrossRef] [Scilit]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Article Metrics

Citations

Article Access Statistics

Journal Statistics
Multiple requests from the same IP address are counted as one view.
Chemotherapy-Forward Management of Advanced Prostate Cancer: Taxane Timing, Sequencing and the Real-World Place of Immunotherapy
Previous
The Role of New Agents and Supportive Care in a Multimodal Approach to Cancer Cachexia
Next