Molecular Characterization of Clostridium perfringens Strains Isolated in Italy
Abstract
1. Introduction
2. Results
2.1. Multiplex PCR of C. perfringens
2.2. Analysis of Toxinotypes and Prevalence of Minor Toxin Genes
2.3. Association of Toxinotypes and Minor Toxin Genes in Different Animal Species
3. Discussion
3.1. Prevalence of Major Toxin Genes in Different Animal Species
3.2. Prevalence of Minor Toxin Genes in Different Animal Species
4. Conclusions
5. Materials and Methods
5.1. Clostridium Perfringens Strain Collection
5.2. Molecular Characterization
5.3. Statistical Analysis
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Appendix A. Classification of Toxinotypes
| Toxins: | Typing (Major) | Non-Typing (Minor) | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CPA-α | CPB-β | ETX-ε | ITX-ι | CPE * | NetB | CPB2-β2 | PFO-θ | NetF | ||
| coding gene: | cpa-plc | cpb | etx | iap | cpe * | netB | cons/aty-cpb2 | pfo | netF | |
| Toxinotype | A | + | (±) | (±) | (±) | |||||
| B | + | + | + | (±) | (±) | (±) | ||||
| C | + | + | (±) | (±) | (±) | (±) | ||||
| D | + | + | (±) | (±) | (±) | (±) | ||||
| E | + | + | (±) | (±) | (±) | (±) | ||||
| F | + | + | (±) | (±) | (±) | |||||
| G | + | + | (±) | (±) | (±) | |||||
Appendix B.

Appendix C.

References
- Uzal, F.A.; Freedman, J.C.; Shrestha, A.; Theoret, J.R.; Garcia, J.; Awad, M.M.; Adams, V.; Moore, R.J.; Rood, J.I.; Mcclane, B.A. Towards an understanding of the role of Clostridium perfringens toxins in human and animal disease. Future Microbiol. 2014, 9, 361–377. [Google Scholar] [CrossRef] [Scilit]
- Heida, F.H.; Van Zoonen, A.G.J.F.; Hulscher, J.B.F.; Te Kiefte, B.J.C.; Wessels, R.; Kooi, E.M.W.; Bos, A.F.; Harmsen, H.J.M.; De Goffau, M.C. A necrotizing enterocolitis-associated gut microbiota is present in the meconium: Results of a prospective study. Clin. Infect. Dis. 2016, 62, 863–870. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Revitt-Mills, S.A.; Rood, J.I.; Adams, V. Clostridium perfringens extracellular toxins and enzymes: 20 and counting. Microbiol. Aust. 2015, 36, 9–12. [Google Scholar] [CrossRef] [Scilit]
- Rood, J.I.; Adams, V.; Lacey, J.; Lyras, D.; McClane, B.A.; Melville, S.B.; Moore, R.J.; Popoff, M.R.; Sarker, M.R.; Songer, J.G.; et al. Expansion of the Clostridium perfringens toxin-based typing scheme. Anaerobe 2018, 53, 5–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kiu, R.; Caim, S.; Alexander, S.; Pachori, P.; Hall, L.J. Probing genomic aspects of the multi-host pathogen Clostridium perfringens reveals significant pangenome diversity, and a diverse array of virulence factors. Front. Microbiol. 2017, 8. [Google Scholar] [CrossRef] [Scilit]
- Petit, L.; Gibert, M.; Popoff, M.R. Clostridium perfringens: Toxinotype and genotype. Trends Microbiol. 1999, 7, 104–110. [Google Scholar] [CrossRef] [Scilit]
- Dolan, G.P.; Foster, K.; Lawler, J.; Amar, C.; Swift, C.; Aird, H.; Gorton, R. An epidemiological review of gastrointestinal outbreaks associated with Clostridium perfringens, North East of England, 2012–2014. Epidemiol. Infect. 2016, 144, 1386–1393. [Google Scholar] [CrossRef] [Scilit]
- Ghoneim, N.H.; Hamza, D.A. Epidemiological studies on Clostridium perfringens food poisoning in retail foods. Rev. Sci. Tech. Off. Int. Epiz. 2017, 36, 1–17. [Google Scholar] [CrossRef] [Scilit]
- Heikinheimo, A.; Korkeala, H.; Houf, K.; Schalch, D.B.; Könönen, E. Diagnostics and Molecular Epidemiology of Cpe-Positive Clostridium Perfringens Type A; Helda: Helsinki, Finland, 2008; Volume 3, ISBN 978-952-10-4602-5. [Google Scholar]
- Uzal, F.A.; Navarro, M.A.; Li, J.; Freedman, J.C.; Shrestha, A.; McClane, B.A. Comparative pathogenesis of enteric clostridial infections in humans and animals. Anaerobe 2018, 53, 11–20. [Google Scholar] [CrossRef] [Scilit]
- Oda, M.; Terao, Y.; Sakurai, J.; Nagahama, M. Membrane-binding mechanism of Clostridium perfringens alpha-toxin. Toxins 2015, 7, 5268–5275. [Google Scholar] [CrossRef] [Scilit]
- Goossens, E.; Verherstraeten, S.; Valgaeren, B.R.; Pardon, B.; Timbermont, L.; Schauvliege, S.; Rodrigo-Mocholí, D.; Haesebrouck, F.; Ducatelle, R.; Deprez, P.R.; et al. The C-terminal domain of Clostridium perfringens alpha toxin as a vaccine candidate against bovine necrohemorrhagic enteritis. Vet. Res. 2016, 47, 1–9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Uzal, F.A. Diagnosis of Clostridium perfringens intestinal infections in sheep and goats. Anaerobe 2008, 10, 135–143. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Navarro, M.A.; McClane, B.A.; Uzal, F.A. Mechanisms of action and cell death associated with Clostridium perfringens toxins. Toxins 2018, 10, 212. [Google Scholar] [CrossRef] [Scilit]
- Alves, G.G.; Machado de Ávila, R.A.; Chávez-Olórtegui, C.D.; Lobato, F.C.F. Clostridium perfringens epsilon toxin: The third most potent bacterial toxin known. Anaerobe 2014, 30, 102–107. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dwivedi, P.; Kaushik, S.; Tomar, R.S. Review Article Towards an Understanding on Toxins and Infectious Diseases of Clostridium perfringens Vis-a-Vis Prospective Recombinant Vaccines. Int. J. Curr. Microbiol. App. Sci. 2015, 4, 356–371. [Google Scholar]
- Songer, J.G.; Miskimmins, D.W. Clostridium perfringens type E enteritis in calves: Two cases and a brief review of the literature. Anaerobe 2004, 10, 239–242. [Google Scholar] [CrossRef] [Scilit]
- Freedman, J.C.; Shrestha, A.; McClane, B.A. Clostridium perfringens enterotoxin: Action, genetics, and translational applications. Toxins 2016, 8, 73. [Google Scholar] [CrossRef] [Scilit]
- Keyburn, A.L.; Bannam, T.L.; Moore, R.J.; Rood, J.I. NetB, a Pore-Forming Toxin from Necrotic Enteritis Strains of Clostridium perfringens. Toxins 2010, 2, 1913–1927. [Google Scholar] [CrossRef] [Scilit]
- Rood, J.I.; Keyburn, A.L.; Moore, R.J. NetB and necrotic enteritis: The hole movable story. Avian Pathol. 2016, 45, 295–301. [Google Scholar] [CrossRef] [Scilit]
- Gibert, M.; Jolivet, R.C.; Popoff, M.R. Beta2 toxin, a novel toxin produced by Clostridium perfringens No Title. Gene 1997, 203, 65–73. [Google Scholar] [CrossRef] [Scilit]
- Vilei, E.M.; Schlatter, Y.; Perreten, V.; Straub, R.; Popoff, M.R.; Gibert, M.; Gröne, A.; Frey, J. Antibiotic-induced expression of a cryptic cpb2 gene in equine β2-toxigenic Clostridium perfringens. Mol. Microbiol. 2005, 57, 1570–1581. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fisher, D.J.; Miyamoto, K.; Harrison, B.; Akimoto, S.; Sarker, M.R.; McClane, B.A. Association of beta2 toxin production with Clostridium perfringens type A human gastrointestinal disease isolates carrying a plasmid enterotoxin gene. Mol. Microbiol. 2005, 56, 747–762. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Asten, A.J.A.M.; Nikolaou, G.N.; Gröne, A. The occurrence of cpb2-toxigenic Clostridium perfringens and the possible role of the beta2-toxin in enteric disease of domestic animals, wild animals and humans. Vet. J. 2010, 183, 135–140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zeng, J.; Song, F.; Yang, Y.; Ma, C.; Deng, G.; Li, Y.; Wang, Y.; Liu, X. The Generation and Characterization of Recombinant Protein and Antibodies of Clostridium perfringens Beta2 Toxin. J. Immunol. Res. 2016, 2016. [Google Scholar] [CrossRef] [Scilit]
- Serroni, A.; Magistrali, C.F.; Pezzotti, G.; Bano, L.; Pellegrini, M.; Severi, G.; Di Pancrazio, C.; Luciani, M.; Tittarelli, M.; Tofani, S.; et al. Expression of deleted, atoxic atypical recombinant beta2 toxin in a baculovirus system and production of polyclonal and monoclonal antibodies. Microb. Cell Fact. 2017, 16, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Gohari, I.M.; Parreira, V.R.; Nowell, V.J.; Nicholson, V.M.; Oliphant, K.; Prescott, J.F. A novel pore-forming toxin in type A Clostridium perfringens is associated with both fatal canine hemorrhagic gastroenteritis and fatal foal necrotizing enterocolitis. PLoS ONE 2015, 10, 1–27. [Google Scholar] [CrossRef] [Scilit]
- Yonogi, S.; Matsuda, S.; Kawai, T.; Yoda, T.; Harada, T.; Kumeda, Y.; Gotoh, K.; Hiyoshi, H.; Nakamura, S.; Kodama, T.; et al. BEC, a novel enterotoxin of Clostridium perfringens found in human clinical isolates from acute gastroenteritis outbreaks. Infect. Immun. 2014, 82, 2390–2399. [Google Scholar] [CrossRef] [Scilit]
- Kiu, R.; Hall, L.J. An update on the human and animal enteric pathogen Clostridium perfringens. Emerg. Microbes Infect. 2018, 7. [Google Scholar] [CrossRef] [Scilit]
- De La Rosa, C.; Hogue, D.E.; Thonney, M.L. Vaccination Schedules to Raise Antibody Concentrations Against ε-Toxin of Clostridium perfringens in Ewes and Their Triplet Lambs. J. Anim. Sci. 1997, 75, 2328–2334. [Google Scholar] [CrossRef] [Scilit]
- Italian Ministry of Health. DECRETO 17 Marzo 1994, n. 287. Regolamento Recante Norme sulla Produzione, l’Impiego ed il Controllo dei Medicinali Veterinari Immunologici Inattivati, aventi Caratteristiche di Vaccini Stabulogeni ed Autovaccini. Gazz. Uff. 1994, 111, 6–10. [Google Scholar]
- Uzal, F.A.; Vidal, J.E.; McClane, B.A.; Gurjar, A.A. Clostridium Perfringens Toxins Involved in Mammalian Veterinary Diseases. Open Toxinol. J. 2010, 3, 24–42. [Google Scholar] [CrossRef] [Scilit]
- Hoelzer, K.; Bielke, L.; Blake, D.P.; Cox, E.; Cutting, S.M.; Devriendt, B.; Erlacher-Vindel, E.; Goossens, E.; Karaca, K.; Lemiere, S.; et al. Vaccines as alternatives to antibiotics for food producing animals. Part 1: Challenges and needs. Vet. Res. 2018, 49, 1–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Giovanardi, D.; Drigo, I.; De Vidi, B.; Agnoletti, F.; Viel, L.; Capello, K.; Berto, G.; Bano, L. Molecular characterization of Clostridium perfringens strains isolated from diseased turkeys in Italy. Avian Pathol. 2016, 45, 376–380. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Drigo, I.; Agnoletti, F.; Bacchin, C.; Bettini, F.; Cocchi, M.; Ferro, T.; Marcon, B.; Bano, L. Toxin genotyping of Clostridium perfringens field strains isolated from healthy and diseased chickens. Ital. J. Anim. Sci. 2008, 7, 397–400. [Google Scholar] [CrossRef] [Scilit]
- Badagliacca, P.; Di Provvido, A.; Scattolini, S.; Pompei, G.; Di Giannatale, E. Toxin genotyping of Clostridium perfringens strains using a polymerase chain reaction protocol. Vet. Ital. 2010, 46, 113–118. [Google Scholar]
- Greco, G.; Madio, A.; Buonavoglia, D.; Totaro, M.; Corrente, M.; Martella, V.; Buonavoglia, C. Clostridium perfringens toxin-types in lambs and kids affected with gastroenteric pathologies in Italy. Vet. J. 2005, 170, 346–350. [Google Scholar] [CrossRef] [Scilit]
- Cocchi, M.; Drigo, I.; Bacchin, C.; Bano, L.; Marcon, B.; Agnoletti, F. Toxin-genotyping of Clostridium perfringens strains isolated from rabbits with enteric disease. In Proceedings of the 9th World Rabbit Congress, Verona, Italy, 10–13 June 2008. [Google Scholar]
- Rosignoli, C.; Faccini, S.; Franzini, G.; Costa, A.; Nardi, M.; Nigrelli, A.D. Genotipizzazzione di ceppi di Clostridium perfringens mediante multiplex PCR. Presented at Convegno Nazionale sulla Ricerca in Sanità Pubblica Veterinaria, Rome, Italy, 2 October 2007. [Google Scholar]
- Rosignoli, C.; Faccini, S.; Franzini, G.; Costa, A.; Nardi, M.N. Rilevamento in ceppi di C. perfringens dei geni codificanti per le tossine letali maggiori, la tossina beta 2 e l’enterotossina madiante multiplex PCR. In Proceedings of the VI Congresso Nazionale Società Italiana Diagnostica di Laboratorio Veterinaria (SIDiLV), Abano Terme, Italy, 10–12 November 2004; pp. 205–206. [Google Scholar]
- Greco, G.; Bellacicco, A.; Lucente, M.S.; Bozzo, G.; Di Gioia, G.; Tinelli, S.; Buonavoglia, C. Caratterizzazione genomica mediante multiplex-pcr di ceppi di Clostridium perfringens isolati da vacche da latte affette da sindrome emorragica del digiuno. In Proceedings of the V Workshop Nazionale Enter-net Ital. Sist. di sorveglianza delle Infez. Enteriche, Rome, Italy, 1–2 December 2005. Poster 20. [Google Scholar]
- Fohler, S.; Klein, G.; Hoedemaker, M.; Scheu, T.; Seyboldt, C.; Campe, A.; Jensen, K.C.; Abdulmawjood, A. Diversity of Clostridium perfringens toxin-genotypes from dairy farms. BMC Microbiol. 2016, 16, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Ahsani, M.; Mohammadabadi, M.; Shamsaddini, M. Clostridium perfringens isolate typing by multiplex PCR. J. Venom. Anim. Toxins Incl. Trop. Dis. 2010, 16, 573–578. [Google Scholar] [CrossRef] [Scilit]
- Jost, B.H.; Billington, S.J.; Trinh, H.T.; Bueschel, D.M.; Songer, J.G. Atypical cpb2 genes, encoding beta2-toxin in Clostridium perfringens isolates of nonporcine origin. Infect. Immun. 2005, 73, 652–656. [Google Scholar] [CrossRef] [Scilit]
- Garmory, H.S.; Chanter, N.; French, N.P.; Bueschel, D.; Songer, J.G.; Titball, R.W. Occurrence of Clostridium perfringens β2-toxin amongst animals, determined using genotyping and subtyping PCR assays. Epidemiol. Infect. 2000, 124, 61–67. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Redondo, L.M.; Farber, M.; Venzano, A.; Jost, B.H.; Parma, Y.R.; Fernandez-Miyakawa, M.E. Sudden death syndrome in adult cows associated with Clostridium perfringens type E. Anaerobe 2013, 20, 1–4. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, H.Y.; Byun, J.W.; Roh, I.S.; Bae, Y.C.; Lee, M.H.; Kim, B.; Songer, J.G.; Jung, B.Y. First isolation of Clostridium perfringens type E from a goat with diarrhea. Anaerobe 2013, 22, 141–143. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Keyburn, A.L.; Boyce, J.D.; Vaz, P.; Bannam, T.L.; Ford, M.E.; Parker, D.; Di Rubbo, A.; Rood, J.I.; Moore, R.J. NetB, a new toxin that is associated with avian necrotic enteritis caused by Clostridium perfringens. PLoS Pathog. 2008, 4, e26. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kasab-Bachi, H. Epidemiology of Clostridium perfringens and Clostridium difficile among Ontario broiler chicken flocks. Ph.D. Thesis, University of Guelph, Guelph, ON, Canada, 2017. [Google Scholar]
- Matsuda, A.; Aung, M.S.; Urushibara, N.; Kawaguchiya, M.; Sumi, A.; Nakamura, M.; Horino, Y.; Ito, M.; Habadera, S.; Kobayashi, N. Prevalence and genetic diversity of toxin genes in clinical isolates of Clostridium perfringens: Coexistence of alpha-toxin variant and binary enterotoxin genes (bec/cpile). Toxins 2019, 11, 326. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miyamoto, K.; Wen, Q.; McClane, B.A. Multiplex PCR Genotyping Assay That Distinguishes between Isolates of Clostridium perfringens Type A Carrying a Chromosomal Enterotoxin Gene (cpe) Locus, a Plasmid cpe Locus with an IS1470-Like Sequence, or a Plasmid cpe Locus with an IS1151 Sequence. J. Clin. Microbiol. 2004, 42, 1552–1558. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Forti, K.; Cagiola, M.; Pellegrini, M.; Anzalone, L.; Di Paolo, A.; Corneli, S.; Severi, G.; De Giuseppe, A. Generation of recombinant baculovirus expressing atoxic C-terminal CPA toxin of Clostridium perfringens and production of specific antibodies. BMC Biotechnol. 2020, 20, 1–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gibert, M.; Perelle, S.; Daube, G.; Popoff, M.R. Clostridium spiroforme Toxin Genes are Related to C. perfringens Iota Toxin Genes but have a Different Genomic Localization. Syst. Appl. Microbiol. 1997, 20, 337–347. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Miyamoto, K.; McClane, B.A. Comparison of virulence plasmids among Clostridium perfringens type E isolates. Infect. Immun. 2007, 75, 1811–1819. [Google Scholar] [CrossRef] [Scilit]
- Miyamoto, K.; Yumine, N.; Mimura, K.; Nagahama, M.; Li, J.; McClane, B.A.; Animoto, S. Identification of Novel Clostridium perfringens Type E Strains That Carry an Iota Toxin Plasmid with a Functional Enterotoxin Gene. PLoS ONE 2011. [Google Scholar] [CrossRef] [Scilit]
- Yoo, H.S.; Lee, S.U.; Park, Y.H. Molecular Typing and Epidemiological Survey of Prevalence of Clostridium perfringens Types by Multiplex PCR. J. Clin. Microbiol. 1997, 35, 228–232. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baums, C.G.; Schotte, U.; Amtsberg, G.; Goethe, R. Diagnostic multiplex PCR for toxin genotyping of Clostridium perfringens isolates. Vet. Microbiol. 2004, 100. [Google Scholar] [CrossRef] [Scilit]



| No. of Isolates (Intra-Class %) | ||||||
|---|---|---|---|---|---|---|
| Type | Further Toxin Genes | Geographical Origin | Total | Overall Total | ||
| Umbria Region | Other Regions | Unknown | ||||
| A | none | 237 (63.7) | 122 (55.7) | 24 (58.5) | 383 (60.6) | 588 (93.0) |
| cons-cpb2 | 72 (19.4) | 37 (16.9) | 11 (26.8) | 120 (19.0) | ||
| aty-cpb2 | 41 (11.0) | 40 (18.2) | 4(9.8) | 85 (13.4) | ||
| B | aty-cpb2 | - | 1 (0.5) | - | 1 (0.2) | 1 (0.2) |
| C | none | 4 (1.1) | 2 (0.9) | - | 6 (0.9) | 7 (1.1) |
| cons-cpb2 | 1 (0.3) | - | - | 1 (0.2) | ||
| D | none | 2 (0.5) | 3 (1.4) | - | 5 (0.8) | 19 (3.0) |
| cpe | 6 (1.6) | 1 (0.5) | 2 (4.9) | 9 (1.4) | ||
| cpe + aty-cpb2 | 2 (0.5) | 1 (0.5) | - | 3 (0.5) | ||
| aty-cpb2 | 1 (0.3) | 1 (0.5) | - | 2 (0.3) | ||
| E | cpe + aty-cpb2 | 1(0.3) | - | - | 1 (0.2) | 1 (0.2) |
| F * | none | 5 (1.3) | 8 (3.7) | - | 13 (2.0) | 16 (2.5) |
| cons-cpb2 | - | 1 (0.5) | - | 1 (0.2) | ||
| aty-cpb2 | - | 2 (0.9) | - | 2 (0.3) | ||
| Total | 372 (100) | 219 (100) | 41 (100) | 632 (100) | 632 (100) | |
| Type | Typing Genes Combination | Total No. of Isolates per Type | Combination of Non-Typing Genes Detected | ||||
|---|---|---|---|---|---|---|---|
| None | cons-cpb2 | cpe * | cpe * + aty-cpb2 | aty-cpb2 | |||
| A | cpa-plc | 588 | 383 | 120 | NAa | NA a | 85 |
| B | cpa-plc + cpb + etx | 1 | - | - | NAa | NA a | 1 |
| C | cpa-plc + cpb | 7 | 6 | 1 | - | - | - |
| D | cpa-plc + etx | 19 | 5 | - | 9 | 3 | 2 |
| E | cpa-plc + iap | 1 | - | - | - | 1 | - |
| F | cpa-plc + cpe * | 16 | 13 (2.06%) | 1 | NA* | NA* | 2 |
| Total | 632 | 407 | 122 | 9 | 4 | 90 | |
| % of 632 | 100% | 64.40% | 19.30% | 1.42% | 0.63% | 14.24% | |
| Isolate Source | Total (%) | No. of Positive Isolates per Combination of Non-Typing Toxin Genes / Total No. of Isolate per Toxinotype and Source of Isolation | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A + | A + | B + | C + | D + | D + | D + | E + | F + | F + | |||
| cons-cpb2 | aty-cpb2 | aty-cpb2 | cons-cpb2 | cpe | cpe + aty-cpb2 | aty-cpb2 | cpe + aty-cpb2 | cons-cpb2 | aty-cpb2 | |||
| BOVINE: | 236 | (37.3) | 37/226 | 30/226 | 1/7 | 1/3 | ||||||
| cattle | 233 | (36.9) | 36/223 | 30/223 | 1/7 | 1/3 | ||||||
| buffalo | 3 | (0.5) | 1/3 | 0/3 | ||||||||
| OVINE | 184 | (29.1) | 37/162 | 26/162 | 9/15 | 3/15 | 1/15 | 1/1 | 0/6 | 0/6 | ||
| CAPRINE: | 54 | (8.5) | 13/45 | 5/45 | 1/1 | 1/4 | 2/4 | |||||
| goat | 53 | (8.4) | 12/44 | 5/44 | 1/1 | 1/4 | 2/4 | |||||
| mouflon | 1 | (0.2) | 1/1 | 0/1 | ||||||||
| LEPORID: | 65 | (10.3) | 16/65 | 8/65 | ||||||||
| rabbit | 39 | (6.2) | 6/39 | 6/39 | ||||||||
| hare | 26 | (4.1) | 10/26 | 2/26 | ||||||||
| PORCINE: | 23 | (3.6) | 6/23 | 1/23 | ||||||||
| pig | 22 | (3.5) | 6/22 | 1/22 | ||||||||
| boar | 1 | (0.1) | 0/1 | 0/1 | ||||||||
| CANINE | 30 | (4.7) | 5/28 | 4/28 | 0/2 | 0/2 | ||||||
| FELINE | 8 | (1.3) | 0/8 | 2/8 | ||||||||
| CAMELID: | 9 | (1.4) | 4/9 | 2/9 | ||||||||
| alpaca | 8 | (1.3) | 3/8 | 2/8 | ||||||||
| camel | 1 | (0.1) | 1/1 | 0/1 | ||||||||
| EQUINE | 3 | (0.5) | 0/3 | 0/3 | ||||||||
| CERVINE | 3 | (0.5) | 1/3 | 0/3 | ||||||||
| AVIAN | 10 | (1.6) | 1/10 | 2/10 | ||||||||
| FOOD | 5 | (0.8) | 0/5 | 5/5 | ||||||||
| Unknown | 2 | (0.3) | 0/1 | 0/1 | 0/1 | 0/1 | ||||||
| Total | 632 | (100) | 120/588 | 85/588 | 1/1 | 1/7 | 9/19 | 3/19 | 2/19 | 1/1 | 1 | 2 |
| Toxinotypes Detected | Target Gene | PCR | Primer | Sequence (5′--->3′) | AL | [Ref.] |
|---|---|---|---|---|---|---|
| A, B, C, D, E, F, G | cpa | M | CPA-F | GTTGATAGCGCAGGACATGTTAAG | 402 | [56] |
| CPA-R | CATGTAGTCATCTGTTCCAGCATC | |||||
| B, C | cpb | M | CPB-F | ACTATACAGACAGATCATTCAACC | 236 | [56] |
| CPB-R | TTAGGAGCAGTTAGAACTACAGAC | |||||
| B, D | etx | M | CPETX-F | ACTGCAACTACTACTCATACTGTG | 541 | [56] |
| CPETX-R | CTGGTGCCTTAATAGAAAGACTCC | |||||
| E | iap | M | CPITX-F | GCGATGAAAAGCCTACACCACTAC | 317 | [56] |
| CPITX-R | GGTATATCCTCCACGCATATAGTC | |||||
| F (C, D, E) | cpe | M | CPE-F | GGGGAACCCTCAGTAGTTTCA | 506 | [57] |
| CPE-R | ACCAGCTGGATTTGAGTTTAATG | |||||
| (A, B, C, D, E, F, G) | cons-cpb2 | M | CPB2CON-F | CAAGCAATTGGGGGAGTTTA | 200 | [57] |
| CPB2CON-R | GCAGAATCAGGATTTTGACCA | |||||
| (A, B, C, D, E, F, G) | aty-cpb2 | S | CPB2ATY1-25F | AGGAATTCACAAAATGAATACAGTTAAAGCAAATG | 750 | [26] |
| CPB2ATY1-25R | GTGATGATGACCGGTATAACAATAACCCTC | |||||
| G | netB | S | JRP6656 | CTTCTAGTGATACCGCTTCAC | 738 | [4] |
| JRP6655 | CGTTATATTCACTTGTTGACGAAAG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Forti, K.; Ferroni, L.; Pellegrini, M.; Cruciani, D.; De Giuseppe, A.; Crotti, S.; Papa, P.; Maresca, C.; Severi, G.; Marenzoni, M.L.; et al. Molecular Characterization of Clostridium perfringens Strains Isolated in Italy. Toxins 2020, 12, 650. https://doi.org/10.3390/toxins12100650
Forti K, Ferroni L, Pellegrini M, Cruciani D, De Giuseppe A, Crotti S, Papa P, Maresca C, Severi G, Marenzoni ML, et al. Molecular Characterization of Clostridium perfringens Strains Isolated in Italy. Toxins. 2020; 12(10):650. https://doi.org/10.3390/toxins12100650
Chicago/Turabian StyleForti, Katia, Laura Ferroni, Martina Pellegrini, Deborah Cruciani, Antonio De Giuseppe, Silvia Crotti, Paola Papa, Carmen Maresca, Giulio Severi, Maria Luisa Marenzoni, and et al. 2020. "Molecular Characterization of Clostridium perfringens Strains Isolated in Italy" Toxins 12, no. 10: 650. https://doi.org/10.3390/toxins12100650
APA StyleForti, K., Ferroni, L., Pellegrini, M., Cruciani, D., De Giuseppe, A., Crotti, S., Papa, P., Maresca, C., Severi, G., Marenzoni, M. L., & Cagiola, M. (2020). Molecular Characterization of Clostridium perfringens Strains Isolated in Italy. Toxins, 12(10), 650. https://doi.org/10.3390/toxins12100650

