Abstract
Misiones, Argentina, holds one of the largest remnants of the Atlantic Forest, with almost 1.4 million hectares of native forest, representing a critical landscape for sustainable biodiversity conservation. However, connectivity across this ecoregion is increasingly threatened by habitat conversion, landscape fragmentation, and poaching pressures that extend beyond protected area boundaries, undermining long-term sustainability of wildlife populations. Using conservation detection dogs, we located, collected, and genetically confirmed 198 scats belonging to four game species: 20 lowland tapir (Tapirus terrestris), 72 white-lipped peccary (Tayassu pecari), 55 collared peccary (Pecari tajacu), and 51 Azara’s agouti (Dasyprocta azarae). Analyses examining species-specific habitat associations emphasized the importance of extending inference beyond point locations to encompass species’ home ranges, with native forest consistently identified as a key component of habitat use. The high prevalence of scats in mosaics of human-modified habitats outside protected areas, especially along their borders, underscores the importance of managing these areas as part of a broader sustainable landscape matrix. While native forest fragments outside of protected areas may serve as important refugia supporting species persistence, their contribution to sustainable management depends on reducing poaching pressure across these landscapes. There is an urgent need to expand antipoaching efforts beyond protected areas and across the Atlantic Forest in the Green Corridor of Misiones while preventing ongoing deforestation and the expansion of monoculture plantations. Achieving sustainable wildlife management in this region will require integrated strategies that promote sustainable land use, conservation planning, and rural development.
1. Introduction
Tropical and subtropical forests contain a disproportionately large share of the world’s biodiversity, yet they are increasingly threatened by habitat loss, fragmentation, and human pressures that undermine the long-term sustainability of ecosystems and biodiversity [1,2,3]. Within this broader context, the Atlantic Forest of South America stands out as a biodiversity hotspot, notable for its high levels of endemism and its long history of extensive deforestation [4,5]. While the province of Misiones, Argentina, represents only 1% of the national territory, it harbors more than half of the country’s known biodiversity, a fact directly linked to its maintaining one of the largest remaining tracts of Atlantic Forest, with approximately 1.4 million hectares, making it a critical region for sustainable conservation planning [6,7,8,9,10,11,12].
The Atlantic Forest ecoregion, with plant communities that include bamboo gallery forests and stands dominated by palm heart (Euterpe edulis), araucaria (Araucaria angustifolia), guatambú (Balfourodendron riedelianum), and palo rosa (Aspidosperma polyneuron), reaches its southernmost distribution in Misiones [4,8,13]. Despite its global conservation importance and high endemism, fragmentation threatens this ecoregion, which harbors an estimated 1–8% of the world’s known species, raising concerns about the sustainability of ecological processes and species persistence [4,5,8,14,15,16,17,18,19]. Half of the remaining forest occurs within protected areas (e.g., national parks, provincial parks, private reserves) of varying size and connectivity, with each embedded in a heterogeneous matrix of human-modified habitats that include monoculture plantations of non-native species (Pinus spp. and Eucalyptus spp.), small-scale agriculture (e.g., tea, yerba mate, tobacco, soy, tung), subsistence farming, pastures for grazing, bare soil, and urban areas, highlighting the need for sustainable land-use strategies across multifunctional landscapes [16,20,21,22,23,24,25].
Beyond habitat loss and degradation, many native vertebrates in Misiones are also threatened by road mortality, infectious diseases transmitted by domestic animals, and high levels of hunting pressure, all of which compromise the sustainability of wildlife populations [16,26,27,28,29,30,31,32,33]. Although wildlife hunting is prohibited in the province, poaching has been shown to severely and negatively affect various mammal populations (e.g., large felids, ungulates, rodents), with declines in population abundance that may lead to local extinction of small, isolated groups, undermining sustainable wildlife management efforts [29,34,35,36]. Among the most affected taxa are four game species: lowland tapir (hereafter tapir; Tapirus terrestris), white-lipped peccary (Tayassu pecari), collared peccary (Pecari tajacu), and Azara’s agouti (hereafter agouti; Dasyprocta azarae), with the white-lipped peccary and agouti considered especially sensitive to hunting pressure [33,37,38,39,40,41]. In Argentina, the white-lipped pecari is classified as Endangered, while the collared peccary and tapir are listed as Vulnerable and the agouti as Near Threatened [27,37,38,42]. These species were selected for their ecological importance, contrasting ecological niches, and differing responses to anthropogenic pressures, making them valuable indicators of ecosystem sustainability and integrity [32,43,44,45].
Functionally, they occupy complementary ecological roles. The tapir, as the largest terrestrial herbivore in the region, is a key long-distance seed disperser [45]. Peccaries act both as seed predators and ecosystem engineers, with their rooting and trampling influencing vegetation structure and regeneration [43,46]. In contrast, the agouti is a scatter-hoarder that plays a critical role in seed dispersal and recruitment at smaller spatial scales [47,48]. Together, these species shape forest composition, structure, and regeneration dynamics, thereby supporting the sustainability of forest ecosystems and their regenerative capacity [44,49,50]. In addition, these species are key in trophic interactions, with each considered important prey to coexisting carnivores [39,51,52,53,54,55,56,57].
Despite these important roles, all four species are subject to intense hunting pressure and habitat alteration, although their vulnerability varies [58,59]. The white-lipped peccary, which depends on large, continuous forest areas and moves in large groups, is particularly sensitive to fragmentation and overhunting, making it a critical species for evaluating landscape-level sustainability. In contrast, the collared peccary and agouti exhibit greater ecological flexibility [33,58]. The tapir, a more solitary species with specific habitat requirements, is especially vulnerable due to its low reproductive rate and large spatial requirements, highlighting challenges for sustainable population persistence [45,60].
In this study, we used conservation detection dogs to investigate the ecology of four game species within a sustainability-oriented monitoring framework. This noninvasive approach offers a powerful alternative to live-capture methods, which are often logistically demanding, invasive, and constrained by low capture probabilities for elusive species [61,62]. In general, some species present challenges for camera-trap monitoring due to the absence of individually distinctive markings, potentially resulting in overestimates of population density, as well as variability in detection across habitats that must be accounted for in management plans [63,64]. Detection dogs help overcome these limitations by enabling the systematic collection of scats across large spatial extents and substantially increasing detection rates for cryptic and low-density species [65,66,67].
This approach minimizes disturbance by eliminating the need for invasive techniques (e.g., physical capture) and avoids biases associated with methods that rely on attracting animals to specific locations (e.g., camera traps, hair snares), aligning with principles of sustainable and ethical wildlife research [20,62,68,69,70,71,72]. Crucially, the recovery of high-quality mitochondrial DNA (mtDNA) from intestinal epithelial cells shed in the mucous during defecation allows for obtaining reliable genetic information of the species origin of each scat, even under conditions of environmental degradation [73,74,75,76,77,78,79]. Leveraging this approach, we evaluated habitat associations and spatial patterns of these species across Misiones, examining their relationships with natural features (e.g., protected areas, water sources) and anthropogenic pressures (e.g., roads, urban areas) as well as the potential influence of poaching on their distribution, with direct implications for sustainable landscape management and conservation planning.
2. Materials and Methods
2.1. Sampling Design
In 2018 and 2022, scats were collected over four months (May–August), which coincided with the season of cooler temperatures [66], with the first survey centered in the northern–central zone of Misiones and the second in the central–southern zone (Figure 1). While sampling typically occurred from sunrise to early afternoon, there was some variation depending on various factors (e.g., temperature, cloud cover, canopy or vegetation cover), with avoidance of late afternoons to allow the dogs sufficient rest and heavy rains that would affect sample quality [66,80,81,82]. Survey effort was standardized across routes by maintaining a consistent walking pace while allowing the dogs to actively search for scats along and adjacent to transects. Environmental conditions known to affect scent detection (e.g., temperature, humidity, precipitation) were considered during survey planning to maximize detection probability and sample quality, as these factors can affect odor production, dispersion, and degradation [82,83,84,85]. A different, but experienced, conservation detection dog, both handled by KED, was used in each survey (2018 and 2022), with both dogs trained using scats from captive and wild animals, to have a positive alert to five game species [tapir, white-lipped peccary, collared peccary, paca (Cuniculus paca), and agouti) and five carnivores [jaguar (Panthera onca), puma (Puma concolor), ocelot (Leopardus pardalis), southern tiger cat (Leopardus guttulus), and bush dog (Speothos venaticus)] [6,86,87]. The latter data are not discussed here.
Figure 1.
Map of Misiones, Argentina, with the detection dog survey routes of 2018 in the northern–central zone (purple) and 2022 in the central–southern zone (yellow) shown relative to protected areas, major roads, and land use.
Daily surveys with the conservation detection dog were divided into unique routes along existing roads (e.g., dirt, logging) and trails (e.g., animal, poaching), with the aim of maximizing coverage of habitat heterogeneity and total area [21]. A systematic, habitat-stratified transect design was not used because detection dogs are more effective when searching along existing trails and routes (e.g., animals trails, roads, poaching paths) than along constructed transects [66]. Furthermore, access across Misiones is limited by landowner permissions and terrain constraints, and strict transect protocols can reduce detection efficiency by restricting natural search behavior and failing to account for environmental effects on scent dispersion or spatially clustered scat distributions [66]. The detection dog’s effective search width was estimated at 15 m on each side of the trail based on handler observations during surveys, resulting in a total search width of approximately 30 m. Each route was georeferenced with a GPS, acknowledging that this was the human track, as the dogs typically moved off the trails, exploring the surrounding area, with an average of 4–6 times this distance [66,84,88]. In 2018, there were 63 unique routes that covered a linear distance of 396.0 km, with the majority (81.6%; 323.3 km) located outside of protected areas (e.g., privately owned, managed by a forestry company) and less than a quarter (18.4%; 72.7 km) inside protected areas (Figure 1). Similar efforts were made in 2022, with 52 unique routes covering a linear distance of 359.7 km; the majority (70.4%; 253.1 km) were located outside protected areas, and less than a third (29.6%; 106.6 km) were inside protected areas (Figure 1).
During operational searches, unlike controlled trials, it is difficult to estimate detection probability or assess dog performance because the total number of targets in an area is unknown, and individual scats cannot always be distinguished in the field [89]. However, these limitations can be minimized—supporting data and study replicability—through rigorous dog-handler training [90], as implemented in this study. Although detection probabilities may vary among species due to differences in scat size, deposition rates, and environmental conditions affecting scent persistence, conservation detection dogs have been shown to provide high detection rates across multiple species and habitat types [62,66]. Sampling effort was explicitly incorporated into subsequent analyses to account for variation in detectability and minimize potential bias, with percentages calculated relative to the total sampling effort within each zone and overall (Appendix A). Sampling effort was estimated by converting transects into regularly spaced points (30 m), resulting in minor discrepancies (<1%) relative to GPS-recorded track lengths due to rounding, segmentation of continuous tracks, and rasterization.
2.2. Sample Collection
A visual assessment of the scats located by the detection dog provided a potential species identification and classification of scat quality as fresh (≤24 h), moderately old (between 24 h and 3 days), or old (>3 days) [20], with only those scats classified as fresh or moderately old collected. Each scat was georeferenced with GPS. These data were recorded in a field notebook, along with a unique identifier, date, time, general location, georeferenced position, surrounding habitat (e.g., native forest, monoculture plantation, rural, urban), sample content (e.g., seeds, fruits, herbs, mold), and any other observations, with all data later keyed in for reference in genetic and spatial analyses.
Each scat was swabbed with a cotton-tipped applicator soaked in 1× phosphate-buffered saline solution to capture the intestinal mucus located on the scat’s surface [91,92,93,94]. All samples were collected using sterile gloves and individual swabs to prevent cross-contamination. The tip of each applicator was placed in a 1.7 mL polypropylene tube, labeled, and sealed. Each sample was swabbed in triplicate (two for DNA extraction and one as reference storage), with each taken from different areas of the scat’s exterior. The scat sample was collected and stored in a labeled 18 oz Nasco Whirl-Pak® bag (Nasco, Fort Atkinson, WI, USA) as a backup for DNA extraction and other analyses (e.g., parasites, viruses, diet). To minimize DNA degradation, samples were protected from direct UV exposure in the field and kept in insulated conditions until the end of each survey day, when both swabs and scats were transferred to a −20 °C freezer until arrival at the laboratory. Given the expected low abundance of tapirs in the central–southern zone of Misiones [27,95], we georeferenced observed tapir tracks on survey routes in 2022. This approach allowed us to maximize the capture of tapir presence, since their tracks are readily distinguishable from coexisting ungulates [96,97,98,99,100].
2.3. Evidence of Poaching
During both surveys (2018 and 2022), all evidence of poaching that was noted during fieldwork was georeferenced, with notes recorded about whether the evidence was direct (presence of hunters, established campsites, elevated hunting platforms or stands, and artificial salt lures) and/or indirect (spent cartridges, corn piles, gunshots, machete-cut trails). Spatial analyses in ArcGIS Pro 3.4.0 (ESRI) examined how poaching locations were associated with habitat type and land management (e.g., protected area, privately owned, forestry company/managed). In addition, whether poaching evidence was in protected areas, within 5 km of a border, or outside of protected areas was determined.
2.4. Genetic Analysis
Initially, DNA extraction was performed from a single swab per scat using a modified protocol (adapted from [101]; Appendix B) incorporating an anionic detergent (TEC-SDS buffer: Tris-EDTA-NaCl-SDS), phenol (saturated in Tris/HCl; pH 7.8), and chloroform:isoamyl alcohol (24:1; saturated in H2O; pH 7.0). An extraction blank (no DNA added) was included every 20 samples as a check for cross-contamination during processing. For those samples that had low yield, a second DNA extraction was carried out from the second swab using an optimized protocol with a Qiagen DNeasy® 96 Blood & Tissue Kit (QIAGEN, Hilden, Germany) [102] (Appendix C). The quality of each DNA extraction was verified by horizontal agarose gel (1% w/v) electrophoresis with GelRed Nucleic Acid Gel Stain (Biotium Inc., Fremont, CA, USA). While samples extracted using the manual protocol were diluted 1:50 (v/v) in ultrapure water for subsequent DNA amplification, no dilutions were required for samples extracted using the commercial kit.
To identify species for each sample suspected to be tapir, white-lipped peccary, and collared peccary, a 110 bp region of the mitochondrial cytochrome b (cytb) gene (5′–AAACTGCAGCCCCTCAGAATGATATTTGTCCTCA–3′; 5′–TATTCTTTATCTGCCTATACATRCACG–3′; ref. [103] was amplified, with a modified version of the protocols and reagents published by Farrel et al. [103] and Miotto et al. [104], shown to be effective with these species [39,105]. Amplifications were performed on a Veriti 96-Well Thermal Cycler (Thermo Fisher Scientific, Waltham, MA, USA) in 25 μL volumes containing 2 μL DNA, 1× PCR Green GoTaq Flexi Buffer (Promega Corporation, Madison, WI, USA), 5 mM MgCl2, 200 μM each dNTP, 0.3 μM each primer, 150 μg/mL BSA (Thermo Fisher Scientific, Waltham, MA, USA), and 0.5 U GoTaq G2 Hot Start Polymerase (Promega Corporation, Madison, WI, USA). To minimize the potential for contamination, all PCR (Polymerase Chain Reaction) setups were carried out in a UV (ultraviolet) PCR Chamber (Ivema C9; Ivema Desarrollos, Valentín Alsina, Buenos Aires, Argentina). A negative control (no DNA added) was included in all PCR runs to test for contamination. The PCR profile consisted of 10 min denaturation at 95 °C, followed by 40 cycles at 95 °C for 30 s, 49 °C for 45 s, and 72 °C for 45 s, with a final extension of 30 min at 72 °C.
To identify species in samples suspected to be agouti, a 421 bp region of the cytb gene (5′–TACCATGAGGACAAATATCATTCTG–3′; 5′–CCTCCTAGTTTGTTAGGGATTGATCG–3′; ref. [106]) was amplified. DNA amplifications were performed on a Veriti 96-Well Thermal Cycler in 25 μL volumes containing 2 μL DNA, 1× PCR Green GoTaq Flexi Buffer, 1.5 mM MgCl2, 100 μM each dNTP, 5 pmol each primer, 150 μg/mL BSA, and 0.5 U GoTaq G2 Hot Start Polymerase. The same PCR setup and negative control were used. The cycling profile consisted of 10 min denaturation at 95 °C, followed by 35 cycles at 95 °C for 45 s, 51 °C for 1 min, and 72 °C for 2 min, with a final extension of 8 min at 72 °C.
Successful PCR amplification was verified by horizontal electrophoresis in 2% (w/v) agarose gels using GelRed Nucleic Acid Gel Stain (Biotium). Amplicons were subsequently purified with a commercial purification kit (GE Healthcare Life Sciences, Chicago, IL, USA) and shipped for bidirectional Sanger sequencing on an ABI 3730xl DNA Analyzer (Macrogen Inc., Seoul, Republic of Korea). Chromas Lite (v2.6.5) was used to edit (e.g., remove primers) the resulting electropherograms, with BioEdit (v7.2.6) used to generate consensus sequences that were compared with the GenBank database using the BLASTn (v2.17.0) algorithm [107].
2.5. Habitat Association Analysis
First, with two land-use grids (30 m × 30 m resolution; MapBiomas Trinational Atlantic Forest Project, Collection 2) for Misiones, one from 2018 and another from 2022, ArcGIS Pro (v3.4.0) was used to extract the corresponding habitat type associated with the georeferenced location of each scat confirmed to be one of the target species [108]. Five land-use categories were then quantified by the proportion of samples found in each habitat type: native forest, monoculture plantations, temporary crops, perennial crops, and non-vegetated areas (urban areas and other areas with no vegetation). To account for differences in habitat availability and sampling effort, we modeled the number of detections per habitat category and protection level using generalized linear mixed models (GLMMs) with a negative binomial error distribution to address overdispersion [109,110]. Sampling effort (total distance surveyed within each habitat category and protection level) was included as an offset term (log-transformed kilometers surveyed), allowing detection rates to be standardized per unit effort [111]. Land use and protection level were included as fixed effects, and transect identity was included as a random intercept to account for spatial dependence among observations [109]. Models were fitted using the glmmTMB package [112] in R (v.4.4.2). Model selection was based on the Akaike Information Criterion (AIC) [113], and model assumptions were assessed using simulation-based residual diagnostics implemented in DHARMa [114]. This framework allows habitat use to be evaluated relative to availability rather than relying solely on observed proportions, providing a more robust assessment of habitat selection [115,116].
Second, for each georeferenced location confirmed to be one of the target species, with this being both scat and tracks for tapir, independent buffer zones were created in ArcGIS Pro (v3.4.0), with the center set to the georeferenced sample location and the buffer zone radius set by a species-specific home range size [20]. The home ranges were based on published literature, with 8.31 km2 for the tapir [117], 18.92 km2 for the white-lipped peccary [32], 2.16 km2 for the collared peccary [118], and 1.895 ha for the agouti [51,119]. While it is recognized that several factors can affect species’ directional movements across the landscape, with circular patterns not always reflecting reality, applying the average home range of the species can provide useful insight into potential habitat associations [20,120]. Specifically, this approach allows habitat associations with each confirmed presence to go beyond a point location and instead be seen relative to the extent of potential habitat a species could be using during its natural movements, allowing for assessment of which habitats the species most frequently associates with compared to those it may potentially avoid [20,121,122]. Using ArcGIS Pro (v3.4.0), the proportion of seven land-use categories (native forest, monoculture plantations, temporary crops, perennial crops, pastures, non-vegetated, and urban areas) was tabulated and summarized within the independent buffer zones for each sample by species.
2.6. Proximity Analysis
The georeferenced locations of each confirmed presence were used to calculate distances to poaching evidence and to protected areas (e.g., provincial parks, private reserves) in ArcGIS Pro (v3.4.0). In addition, distances between these scats and other spatial data [water sources (rivers and streams), roads (dirt and paved), and urban areas] were calculated. To evaluate the influence of landscape features on species detections, we modeled the number of detections per transect, species, and year as a function of mean distance to protected areas, water, roads, and urban areas, allowing for formal testing of relationships between occurrence and spatial predictors [110,123]. Survey effort was standardized as total kilometers surveyed and included as an offset term (log km). Given overdispersed count data with many zeros, we fitted generalized linear models with a negative binomial distribution [111], including species and year as fixed effects and standardized continuous predictors. Models were fitted using glmmTMB [102], comparing a null model (species + year + effort) to a full model including all distance variables. A complementary binomial model (detection presence/absence) was also fitted. Model performance was evaluated using AIC, likelihood ratio tests, and DHARMa residual diagnostics [114]. Poaching was excluded because records were collected along the same transects and were therefore not independent of sampling effort.
3. Results
3.1. Confirmed Species Presence
A total of 259 scats, located by the conservation detection dogs, were visually identified as potentially belonging to one of the targeted game species, with fewer scats in 2018 (n = 63) than in 2022 (n = 196). It was possible to genetically confirm species identity for 198 scats (76.4%), all with BLASTn coverage and identity values at 98–100%, for a total of 20 tapir (11 in 2018 and 9 in 2022), 72 white-lipped peccary (30 in 2018 and 42 in 2022), 55 collared peccary (8 in 2018 and 47 in 2022), and 51 agouti (2022). For the remaining 61 samples, the majority were potentially contaminated by urine (e.g., amplified DNA of coexisting carnivores; [20]) or had poor-quality DNA (e.g., unable to amplify, DNA of dietary items or bacteria; [124]), with some potentially belonging to other coexisting herbivores, but intraspecies contamination (e.g., urine) made this confirmation difficult. In addition, 12 sites with unequivocal tapir tracks were recorded, georeferenced, and included as additional presence records for spatial analyses of this species.
3.2. Evidence of Poaching
Of the 69 sites where poaching was detected, most (66.7%; n = 46) involved indirect evidence, while the remainder consisted of direct evidence (33.3%; n = 23). Although overall levels of poaching evidence were similar between years, the central–southern zone (2022) showed approximately twice as many records within protected areas as the northern–central zone (2018; Table 1). Within each zone, most records outside protected areas occurred on forestry-managed land in the northern–central zone (61.5%; n = 16) and on privately owned properties in the central–southern zone (92.3%, n = 24). When combining records within protected areas and those within 5 km of their boundaries, approximately one-third of records in 2018 and over half in 2022—and overall across both years—were associated with protected areas or their immediate surroundings (Table 1). An analysis of habitat at georeferenced locations indicates that most poaching sites occurred in native forest, with fewer records in monoculture plantations (Table 1). The corresponding sampling effort by protection status and land-use categories is reported in Appendix A.
Table 1.
Summary of 69 locations; poaching evidence was recorded in Misiones, Argentina, in 2018 (n = 31) and 2022 (n = 38), with values reported as the number of sites (#) and percentages (%) for each year (2018 and 2022) and overall (total). In addition to areas inside and outside protected areas (PAs), “associated with PAs” refers to a combined category comprising sites located within protected areas or within ≤5 km of their boundaries. The land-use category corresponds to the habitat at the georeferenced location of each poaching record. The corresponding sampling effort by protection status and land-use categories is reported in Appendix A.
3.3. Habitat Association Analysis
The first habitat association analysis showed that most records (83.8%; n = 176) were located in native forest. Both peccary species and agouti had >81.9% of records in native forest, whereas tapir was an exception, with 62.5% of records in native forest and nearly one-third (31.3%) in monoculture plantations (Table 2). The tapir had the highest proportion of confirmed presence located in modified or altered habitats. Across all species, however, only 13.8% of samples (n = 29) were recorded in monoculture plantations, with the remainder found in agricultural lands (1.4%; n = 3) or non-vegetated areas (<1%; n = 2) (Table 2). The corresponding sampling effort by protection status and land-use categories is reported in Appendix A.
Table 2.
Percentage (%) of each land use, with the corresponding number of georeferenced locations (parentheses) confirmed for each target species—tapir (n = 32; scats and tracks), white-lipped peccary (WLP; n = 72), collared peccary (CP; n = 55), and agouti (n = 51)—as well as for all four game species combined (n = 210). The corresponding sampling effort by protection status and land-use categories is reported in Appendix A.
After accounting for sampling effort and spatial structure, detection rates differed among surveyed zones, with significantly higher rates in the central–southern zone than in the northern–central zone (β = 1.72 ± 0.40 SE, p < 0.001). Because survey areas differed between sampling periods, the zone effect was interpreted as a spatial rather than a temporal pattern. Land-use effects were generally weak, although there was a marginal trend toward lower detection rates in perennial crops relative to native forest (β = −2.02 ± 1.08 SE, p = 0.062). Detection rates did not differ between protected and non-protected areas (p = 0.99). Model diagnostics indicated a good fit, with no evidence of overdispersion (p = 0.28) or zero inflation (p = 0.98). Overall, these results provide a quantitative assessment of habitat associations while accounting for variation in sampling effort across land-use categories.
The habitat analysis based on home range size showed that all four species had more than 79.8% of their ranges in native forests, with a value of 82.3% across the four species (Table 3). The agouti, the smallest of the four species, had the highest proportion (92.0%), and the collared peccary had the lowest (79.8%), with similar values between the white-lipped peccary (83.0%) and tapir (80.1%) (Table 3). Of the remaining land-use categories, monoculture plantations accounted for the largest proportion (13.1%), followed by perennial crops (1.8%) and temporary crops (1.6%), with all others being ≤1.0% (Table 3).
Table 3.
Summary of percentages (%) of each land-use type within species-specific buffer zones, approximating home range size for each species—tapir (n = 32; scats and tracks), white-lipped peccary (WLP; n = 72), collared peccary (CP; n = 55), and agouti (n = 51)—as well as for all species combined (ALL).
3.4. Proximity Analysis
Of the 210 presence records (198 scats and 12 tracks), more than half occurred within protected areas or within 5 km of their boundaries, with the remainder within 15.9 km (Table 4). An even greater proportion occurred within 5 km of poaching evidence, with the remainder within 19 km (Table 4). All detections were within 5.2 km of a water source (Table 4). Approximately three-quarters of records were within 4.9 km of a road, with the rest between 5.1 and 7.6 km (Table 4). Most records occurred 3.5–32.2 km from the nearest town, with fewer than 3% within 2.7–3.5 km (Table 4). The model, including landscape–distance predictors, improved fit relative to the null model (AIC = 582.1 vs. 586.4; χ2 = 12.25, df = 4, p = 0.0156). Detection counts increased significantly with distance to protected areas (β = 0.397 ± 0.173, p = 0.022), whereas distances to water and roads were not significant predictors. Distance to urban areas showed a negative, marginal effect (β = −0.310 ± 0.178, p = 0.082). Detection rates were higher in 2022 than in 2018 (β = 0.898 ± 0.369, p = 0.015). The presence/absence model showed consistent temporal effects (β = 1.142 ± 0.354, p = 0.001) and indicated lower detection probability with increasing distance from roads (β = −0.428 ± 0.172, p = 0.013) and urban areas (β = −0.465 ± 0.182, p = 0.011). Residual diagnostics indicated no evidence of overdispersion, zero inflation, or lack of fit.
Table 4.
Summary of distances for the 210 georeferenced presence locations (198 scats and 12 tracks) relative to protected areas, water sources, urban areas, roads, and poaching evidence. For each species—tapir (n = 32; scats and tracks), white-lipped peccary (WLP; n = 72), collared peccary (CP; n = 55), and agouti (n = 51)—as well as all species combined (ALL), values are as the number of sites (n), with the corresponding percentage (%) of each distance (parentheses).
4. Discussion
This study reinforces the effectiveness of conservation detection dogs for locating noninvasive samples across multiple species and heterogeneous environments while providing reliable genetic confirmation for downstream spatial analyses within a sustainable wildlife monitoring framework. We successfully identified four target species (tapir, white-lipped peccary, collared peccary, and agouti), detected variation in detection rates between two spatially distinct regions, and found strong associations among species occurrence, protected area status, and poaching activity. This study also provides the first systematic scientific data on the occurrence and distribution of game species in the southern–central zone of Misiones, Argentina, a region historically underrepresented in ecological research.
In Misiones, native forest remains a key habitat despite extensive loss and fragmentation of the Atlantic Forest; however, many detections occur in human-modified landscapes, particularly near protected area boundaries, underscoring the need for broader-scale analyses beyond point locations and supporting a sustainable landscape perspective. These patterns suggest that forest fragments outside protected areas may function as refugia only if poaching pressure is reduced, highlighting the importance of expanding antipoaching efforts beyond protected areas and strengthening sustainable land-use planning to limit deforestation and the expansion of monoculture.
4.1. Spatial Variation in Species Detection
Despite comparable survey effort in both years and the exclusion of samples from an additional target species surveyed in 2022 (agouti), which accounted for approximately one-quarter of detections, more scats were located in 2022 than in 2018. Because different regions were surveyed in each year (northern–central in 2018 and central–southern in 2022), this difference should be interpreted as a spatial rather than a temporal effect and is unlikely to reflect methodological differences, including the detection dog used. This pattern is notable given the greater habitat fragmentation and lower proportion of legally protected area in the central–southern zone [16,23,87,108], raising important considerations for regional sustainability and conservation prioritization. Even excluding UNESCO’s Reserva de Biosfera Yabotí (approximately 230,000 ha), with Parque Provincial Esmeralda (approximately 30,000 ha) at its core, the northern–central zone still contains approximately 7.5 times as much protected area as the central–southern zone. These results underscore the importance of not overlooking the central–southern zone in conservation and management planning by the Ministerio de Ecología y Recursos Naturales Renovables (MEyRNR), as it remains a key area for maintaining sustainable biodiversity and ecosystem function.
Despite known challenges associated with herbivore scat (e.g., high concentrations of bile salts, polysaccharides, proteins, glycolipids, urea, polyphenols) [91,125,126,127,128], most samples were successfully identified genetically, confirming the presence of four target species: tapir, white-lipped peccary, collared peccary, and agouti. Although the number of tapir scat detections was similar between the two surveys, both were substantially lower than reported by Delgado et al. [39] (n = 28). However, differences in survey design —particularly the proportion of sampling conducted within protected areas—limit direct comparison. The lower number of detections in this study likely reflects the fact that most tapir scats reported by Delgado et al. [39] were located within protected areas, whereas sampling here was conducted primarily outside them.
4.2. Habitat Associations
Our results suggest that tapirs use monoculture plantations more frequently than the other species studied; however, this pattern should be interpreted cautiously given the limited sample size (n = 20). This finding highlights the species’ ecological flexibility in Misiones, where it tolerates a range of habitats [28,129,130,131,132] but remains closely associated with habitats linked to protected areas, emphasizing the importance of maintaining sustainable habitat mosaics [6,27,133,134,135,136,137]. White-lipped peccaries were detected across both regions, indicating persistence in the landscape. Although the decline in detections relative to earlier studies could reflect natural population fluctuations or movement dynamics, it is more plausibly explained by disease impacts and, in particular, poaching, given documented increases in hunting pressure in the region [6,39,40]. Collared peccary detections were low in earlier surveys but higher in the central–southern zone in 2022, suggesting potential spatial variation in distribution and/or habitat use.
The shift in tapir habitat associations from point-based analyses to home-range scale highlights the importance of considering spatial context beyond the location of scat deposition. Across all four species, native forest predominated within estimated home ranges, consistent with studies showing that mammals in this region depend on structurally complex forest environments that provide forage, thermal regulation, and protection from poaching [38,137,138,139,140]. For example, agoutis are highly sensitive to habitat degradation and rely on continuous canopy cover for movement and access to resources [16,38,53,141,142,143]. Similarly, tapirs and peccaries exhibit higher occupancy and activity in structurally complex forests characterized by dense understory and stable food availability [130,132,138,140,144,145], consistent with ecological niche modeling predictions for Misiones [6]. This reinforces the central role of native forest in supporting long-term ecological sustainability and resilience. In contrast, the limited use of plantations and croplands aligns with findings from the Atlantic Forest in Brazil, where commercial plantations and agricultural mosaics generally support lower mammal richness and reduced activity of forest specialists [6,87,129,130,146,147,148], underscoring trade-offs between production and biodiversity sustainability.
4.3. Poaching Patterns
Poaching in Misiones is concentrated in native forest habitats and is strongly associated with protected areas rather than with more heavily modified landscapes, directly threatening the sustainability of wildlife populations. The predominance of indirect evidence suggests sustained hunting pressure, while direct evidence confirms that poaching remains active across the landscape. The high frequency of records within native forests and within or near (≤5 km) protected areas indicates that poaching pressure extends beyond reserve boundaries into adjacent forest patches.
More than half of the genetically confirmed scats were located within or along the borders of protected areas, despite most survey effort occurring outside them, underscoring the role of these areas as critical refugia [134,149,150,151]. At the same time, the occurrence of many records outside protected areas highlights the importance of managing human-modified landscapes to support sustainable species persistence and connectivity [152,153,154,155]. Across the Atlantic Forest of Argentina and Brazil, many medium- to large-sized mammals are increasingly occupying unprotected or altered habitats due to extensive habitat loss and fragmentation [152,156,157], indicating that protected areas alone are insufficient to meet their spatial requirements [158,159,160]. Nevertheless, degraded landscapes outside protected areas can still contribute to connectivity when they retain native forest fragments and are appropriately managed under sustainable land-use practices [161,162,163].
The proportion of illegal activity within protected areas was higher in the central–southern zone than in the northern–central zone, despite the latter containing a substantially greater extent of protected area. When surrounding buffer zones (<5 km) are included, the apparent impact of poaching on protected areas increases further [164]. Overall, nearly half of all poaching records occurred either within them or in their immediate surroundings, and most species detections were located within 5 km of poaching evidence, indicating a concerning spatial overlap [39,105,165]. This pattern suggests that poaching pressure is concentrated along protected area boundaries and in adjacent buffer zones, likely facilitated by greater human accessibility and animal movement across reserve edges. This pattern also underscores the need to expand antipoaching efforts beyond protected area boundaries. In particular, the Grupo de Operaciones en Selva (GOS), under the MEyRNR, would benefit from extending patrols into these peripheral areas, where enforcement is currently limited. Strengthening enforcement—especially in the central–southern zone, where evidence of prey was strongest—to maintain biodiversity and prevent further wildlife declines, along with managing buffer zones and high-access areas, is essential to achieving sustainable wildlife management outcomes across the region.
4.4. Limitations and Methodological Considerations
While our approach provides a robust framework, several limitations warrant consideration. Occurrence records—regardless of the methods used—may underrepresent certain species due to detectability biases associated with low and uneven population densities across heterogeneous landscapes. In Misiones, Argentina, these biases are exacerbated when using camera traps in remote or human-dominated areas, where frequent theft or damage reduces their effectiveness and limits their suitability for long-term monitoring. In contrast, detection dogs are not constrained by these limitations, allowing for unbiased sampling across habitat types, including areas outside protected zones and irrespective of human presence, thereby providing a scalable and sustainable approach to monitoring elusive species. However, detection success can still be influenced by environmental conditions and sample quality. Although sample sizes varied among species—particularly for tapir—the dataset provides valuable baseline information for typically elusive species. Because sampling was conducted in different regions in each year, the result should be interpreted as reflecting spatial rather than temporal variation in species occurrence.
4.5. Conservation Implications
Risk to species outside protected areas is amplified by the combined effects of poaching and road access [129,133,135,166]. Our results show substantial spatial overlap between high numbers of genetically confirmed records of game species and poaching evidence located outside and along the borders of protected areas. These findings underscore the need to protect all remaining Atlantic Forest in Misiones, under the Green Corridor framework (Corredor Verde; Provincial Law XVI No 60), regardless of land tenure, as part of a broader strategy for sustainable landscape conservation [6,87,167,168]. Achieving this will require extending antipoaching efforts, including GOS patrols, beyond protected area boundaries. Without such expansion, continued overhunting in unprotected areas is likely to increase pressure on protected areas, reducing their effectiveness and undermining long-term conservation sustainability [29,36,169,170,171,172,173].
Responsibility for addressing these challenges should extend beyond the MEyRNR to include additional stakeholders, particularly in the northern–central zone, where extensive monoculture plantations and forest reserves occur [16,24]. Forestry companies managing large areas of native and production forests, especially those with Forest Stewardship Council certification, could play a more active role by maintaining adequately resourced monitoring and enforcement capacity in support of sustainable forest management and conservation outcomes [174]. Practical actions include partnering with the MEyRNR to support additional GOS patrols, implementing long-term biodiversity monitoring programs, and establishing formal systems for reporting illegal activities on their properties, thereby strengthening sustainable governance of forest landscapes. Although some of these measures have been implemented previously, their decline has coincided with increasing poaching pressure in the region. Overall, the observed distribution of species and poaching records indicates that without expanded, coordinated antipoaching efforts supported by sufficient personnel and resources, current conservation strategies will be insufficient to achieve long-term sustainability of wildlife populations and ecosystem integrity.
Author Contributions
Conceptualization, D.S., K.E.D., M.A.R. and C.F.A.; methodology, D.S., K.E.D., O.M.E. and C.F.A.; formal analysis, D.S., K.E.D. and C.F.A.; investigation, D.S., K.E.D., O.M.E., M.A.R. and C.F.A., resources, D.S., K.E.D., M.A.R. and C.F.A.; writing—original draft preparation, D.S.; writing—review and editing, D.S., K.E.D., O.M.E., M.A.R. and C.F.A.; visualization, D.S.; supervision, K.E.D., M.A.R. and C.F.A.; funding acquisition, D.S., K.E.D., M.A.R. and C.F.A. All authors have read and agreed to the published version of the manuscript.
Funding
The field and lab expenses of this study were supported by multiple grants to Proyecto Zorro Pitoco: Chester Zoo, Conservation, Food and Health Foundation, Eppley Foundation for Research, Fresno Chaffee Zoo Wildlife Conservation Fund, Jaguar Conservation Fund (Woodland Park Zoo), Kickstarter, Kolmârden Foundation, Little Rock Zoo Foundation, National Geographic Society (C193-11 and C235-13), Palm Beach Zoo Conservation & Science Program, Paris Zoo, Phoenix Zoo Conservation & Science Program, Zoo Atlanta (Georgia AAZK, Reeder Conservation & Science Program, & Quarters for Conservation), Riverbanks Zoo and Garden, Sequoia Park Zoo, the New England Conservation Committee, and Zoo de la Barben (Ecofaune Association). In addition, financial support was provided by funds granted to D.S.: a Graduate Student Research Fellowship Award 2021 from the Society for Conservation Biology and a Grants-in-Aid of Research (G2022315-1765) from Sigma Xi. The Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET) provided Internal Doctoral Fellowships to D.S. (RESOL-2020-129-APN-DIR#CONICET) and O.M.E (RESOL-2020-1515-APN-DIR#CONICET).
Institutional Review Board Statement
Ethical review and approval were waived for this study because the Institutional Animal Care and Use Committee (IACUC) at the Saint Louis Zoo does not require permits for the use of conservation detection dogs, and all collected samples were obtained noninvasively.
Informed Consent Statement
Not applicable.
Data Availability Statement
Georeferenced species data is considered restricted by the MEyRNR due to their endangered and/or threatened status. Data requests can be made to the MEyRNR: https://ecologia.misiones.gob.ar/ (accessed on 17 January 2026).
Acknowledgments
We would like to acknowledge the MEyRNR of Misiones for providing permits, housing, and assistance for all fieldwork involved in this study, with both the MEyRNR and IMiBio providing permits. Also, acknowledgements are given to the numerous Argentinean undergraduate students who assisted in the field, as well as provincial park guards, NGOs, local conservationists, and private land/reserve owners who helped with various aspects of this project. Acknowledgements are given to PackLeader Conservation Detection Dogs that provided guidance for the training and handling of the dogs and of course, to ‘Train’ and ‘DJ’, who made it all possible with their amazing noses and work ethic.
Conflicts of Interest
The authors declare no conflicts of interest.
Appendix A
Summary of sampling effort (km), with corresponding percentages (% in parentheses), across land-use categories and protection levels for the 2018 (northern–central) and 2022 (central–southern) surveys, as well as combined totals.
| Land Use | Protection Level | 2018 | 2022 | Total |
| Native forest | Unprotected | 174.4 (43.7) | 165.9 (45.8) | 340.3 (44.7) |
| Protected | 59.5 (14.9) | 103.1 (28.5) | 162.6 (21.4) | |
| Forest plantations | Unprotected | 109.8 (27.5) | 70.5 (19.5) | 180.3 (23.7) |
| Protected | 11.8 (3.0) | 0.1 (<0.1) | 11.9 (1.6) | |
| Perennial crops | Unprotected | 31.3 (7.9) | 9.5 (2.6) | 40.8 (5.4) |
| Protected | 1.6 (0.4) | 0.9 (0.3) | 2.5 (0.3) | |
| Annual crops | Unprotected | 0.7 (0.2) | 3.4 (0.9) | 4.1 (0.5) |
| Protected | 0.1 (<0.1) | 2.3 (0.6) | 2.4 (0.3) | |
| Pastures | Unprotected | 5.4 (1.4) | 2.7 (0.8) | 8.1 (1.1) |
| Protected | 0.1 (<0.1)) | 0.2 (0.1) | 0.3 (<0.1) | |
| Non-vegetated | Unprotected | 4.0 (1.0) | 2.7 (0.7) | 6.7 (0.9) |
| Protected | 0.1 (0.1) | 0.6 (0.2) | 0.7 (0.1) |
Appendix B
Manual DNA extraction protocol, modified from Sambrook et al. [101].
- (1)
- Remove the 1.7 mL tube with the scat swab collected in the field from the freezer and let it thaw at room temperature for 5–10 min.
- (2)
- Add 500 μL of 2% TEC-SDS buffer and 5 μL of Proteinase K (25 mg/mL).
- (3)
- Gently agitate with a vortex mixer followed by a quick/pulse spin.
- (4)
- Incubate in a humid bath (60 °C) overnight (24 h), with additional agitation with a vortex mixer followed by a quick/pulse spin, at 30 min and 1 h into the incubation period.
- (5)
- Drain and remove the swab, trying to retain the maximum amount of liquid in the tube.
- (6)
- Add 500 μL of phenol solution and mix by inversion several times.
- (7)
- Centrifuge (15,842× g) for 5 min and transfer the resulting aqueous (upper) phase to a new 1.7 mL tube.
- (8)
- Add 500 μL of chloroform:isoamyl alcohol (24:1) to the new tube and mix vigorously by inversion for 2–3 min.
- (9)
- Centrifuge (15,842× g) for 7 min and transfer the aqueous (upper) phase to another 1.7 mL tube. Important: record the recovered volume (necessary for subsequent dilution).
- (10)
- Add 1/10 (v/v) of 3 M NaCl and mix by inversion, then agitate with a vortex mixer several times.
- (11)
- Add 2/3 (v/v) of absolute ethanol and mix gently by inversion, followed by a quick/pulse spin.
- (12)
- Place the tube in a −20 °C freezer for 30 min to promote DNA precipitation.
- (13)
- Remove the tube from the freezer and centrifuge (15,842× g) for 10 min.
- (14)
- Discard the aqueous phase in a single motion, pouring it from the side opposite the DNA pellet.
- (15)
- Let the DNA pellet dry at room temperature for 24 h.
- (16)
- Once dry, rehydrate the DNA in 30 μL of ultrapure water (pH 7.0) and elute at room temperature for 12–24 h.
- (17)
- Store the extracted DNA in a −20 °C freezer.
Appendix C
DNA Extraction Protocol with Qiagen DNeasy® 96 Blood & Tissue Kit™ [102].
- (1)
- Remove the 1.7 mL tube with the scat swab collected in the field from the freezer and let it thaw at room temperature for 5–10 min.
- (2)
- Add 300 μL of Qiagen ATL buffer and 33 μL of Proteinase K (25 mg/mL).
- (3)
- Incubate in a humid bath (70 °C) for 1 h, mixing with a vortex mixer followed by quick/pulse spin every 20 min.
- (4)
- Add an additional 33 μL of Proteinase K (25 mg/mL) and incubate in a humid bath (65 °C) overnight (10–12 h).
- (5)
- Drain and remove the swab, trying to retain the maximum amount of liquid in the tube.
- (6)
- Add 366 μL of Qiagen AL buffer and shake gently with the help of a vortex mixer and incubate in a humid bath (70 °C) for 1 h.
- (7)
- Add 366 μL of absolute ethanol (96%) and gently mix by inversion.
- (8)
- Label a Genesee Scientific UPrep Spin Column and place it in a new 1.7 mL collection tube. Pour the full volume of the tube from step 7 and centrifuge (2817× g) for 10 min.
- (9)
- Add 500 μL of Qiagen AW1 and centrifuge (2817× g) for 5 min.
- (10)
- Remove the column from the collection tube, discard the decanted liquid at the bottom of the collection tube and place the column back into the collection tube.
- (11)
- Add 500 μL of Qiagen AW2 and centrifuge (2817× g) for 15 min. Repeat step 10.
- (12)
- Remove the column from the collection tube, discard the decanted liquid at the bottom of the collection tube and place the column in a new 1.7 mL tube.
- (13)
- Place the Qiagen AE container in a humid bath (37 °C) for 5–7 min (for increasing efficiency and DNA yield during the elution step).
- (14)
- Add 100 μL of Qiagen AE to the center of the column filter and elute at room temperature for 30 min. Centrifuge (15,842× g) for 1 min.
- (15)
- Repeat the elution with a second aliquot of 100 μL of Qiagen AE and elute at room temperature for 30 min. Centrifuge (15,842× g) for 1 min.
- (16)
- Remove and discard the column and store the tube with extracted DNA in a −20 °C freezer.
References
- Dirzo, R.; Young, H.S.; Galetti, M.; Ceballos, G.; Isaac, N.J.B.; Collen, B. Defaunation in the Anthropocene. Science 2014, 345, 401–406. [Google Scholar] [CrossRef] [Scilit]
- Gibson, L.; Lee, T.M.; Koh, L.P.; Brook, B.W.; Gardner, T.A.; Barlow, J.; Peres, C.A.; Bradshaw, C.J.A.; Laurance, W.F.; Lovejoy, T.E.; et al. Primary Forests Are Irreplaceable for Sustaining Tropical Biodiversity. Nature 2011, 478, 378–381. [Google Scholar] [CrossRef] [Scilit]
- Haddad, N.M.; Brudvig, L.A.; Clobert, J.; Davies, K.F.; Gonzalez, A.; Holt, R.D.; Lovejoy, T.E.; Sexton, J.O.; Austin, M.P.; Collins, C.D.; et al. Habitat Fragmentation and Its Lasting Impact on Earth’s Ecosystems. Sci. Adv. 2015, 1, e1500052. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Myers, N.; Mittermeier, R.A.; Mittermeier, C.G.; da Fonseca, G.A.B.; Kent, J. Biodiversity Hotspots for Conservation Priorities. Nature 2000, 403, 853–858. [Google Scholar] [CrossRef] [Scilit]
- Ribeiro, M.C.; Metzger, J.P.; Martensen, A.C.; Ponzoni, F.J.; Hirota, M.M. The Brazilian Atlantic Forest: How Much Is Left, and How Is the Remaining Forest Distributed? Implications for Conservation. Biol. Conserv. 2009, 142, 1141–1153. [Google Scholar] [CrossRef] [Scilit]
- DeMatteo, K.E.; Sotorres, D.; Escalante, O.M.; Ibañez Alegre, D.M.; Delgado, P.M.; Rinas, M.A.; Argüelles, C.F. Integrating Species Distribution Models to Identify Overlapping Predator–Prey Conservation Priorities in Misiones, Argentina. Diversity 2025, 17, 748. [Google Scholar] [CrossRef] [Scilit]
- Di Bitetti, M.S.; Placci, G.; Dietz, L.A. Una Visión de Biodiversidad Para La Ecorregión Del Bosque Atlántico Del Alto Paraná: Diseño de Un Paisaje Para La Conservación de La Biodiversidad y Prioridades Para Las Acciones de Conservación; World Wildlife Fund: Washington, DC, USA, 2003; 154p. [Google Scholar]
- Galindo-Leal, C.; de Gusmão Câmara, I. (Eds.) The Atlantic Forest of South America: Biodiversity Status, Threats and Outlook; Island Press: Washington, DC, USA, 2003; Volume 1. [Google Scholar]
- IMiBio (Instituto Misionero de Biodiversidad). Available online: https://imibio.misiones.gob.ar/es (accessed on 17 January 2026).
- Izquierdo, A.E.; Grau, H.R.; Aide, T.M. Implications of Rural–Urban Migration for Conservation of the Atlantic Forest and Urban Growth in Misiones, Argentina (1970–2030). AMBIO 2011, 40, 298–309. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Placci, G.; Di Bitetti, M.S. Situación Ambiental En La Ecorregión Del Bosque Atlántico Del Alto Paraná (Selva Paranaense). In La Situación Ambiental Argentina; Brown, A., Martinez Ortiz, U., Acerbi, M., Corcuera, J., Eds.; Fundación Vida Silvestre Argentina: Buenos Aires, Argentina, 2006; pp. 193–210. [Google Scholar]
- SIB Sistema de Información de Biodiversidad (SIB-Argentina). Catálogo Taxonómico. Administración de Parques Nacionales. Available online: https://sib.gob.ar/ (accessed on 17 January 2026).
- Cartes, J.L. Brief History of Conservation in the Interior Atlantic Forest. In The Atlantic Forest of South America: Biodiversity Status, Threats and Outlook; Galindo-Leal, C., Gusmão Câmara, I., Eds.; Island Press: Washington DC, USA, 2003; Volume 1, pp. 269–287. [Google Scholar]
- Brooks, T.M.; Mittermeier, R.A.; Mittermeier, C.G.; Fonseca, G.A.B.; Rylands, A.B.; Konstant, W.R.; Hilton-Taylor, C. Habitat Loss and Extinction in the Hotspots of Biodiversity. Conserv. Biol. 2002, 16, 909–923. [Google Scholar] [CrossRef] [Scilit]
- Ceballos, G.; Ehrlich, P.R. Global Mammal Distributions, Biodiversity Hotspots, and Conservation. Proc. Natl. Acad. Sci. USA 2006, 103, 19374–19379. [Google Scholar] [CrossRef] [Scilit]
- Iezzi, M.E.; Cruz, P.; Varela, D.; Angelo, C.; Bitetti, M.S. Tree Monocultures in a Biodiversity Hotspot: Impact of Pine Plantations on Mammal and Bird Assemblages in the Atlantic Forest. For. Ecol. Manag. 2018, 424, 216–227. [Google Scholar] [CrossRef] [Scilit]
- Marques, M.; Grelle, C. The Atlantic Forest: History, Biodiversity, Threats and Opportunities of the Megadiverse Forest of South America; Springer Nature: Cham, Switzerland, 2021; 517p. [Google Scholar]
- Orme, C.D.L.; Davies, R.G.; Burgess, M.; Eigenbrod, F.; Pickup, N.; Olson, V.A.; Owens, I.P.F. Global Hotspots of Species Richness Are Not Congruent with Endemism or Threat. Nature 2005, 436, 1016–1019. [Google Scholar] [CrossRef] [Scilit]
- da Silva, J.; Casteleti, C. Status of the biodiversity of the Atlantic Forest of Brazil. In The Atlantic Forest of South America: Biodiversity Status, Threats, and Outlook; Galindo-Leal, C., Câmara, I., Eds.; Island Press: Washington, DC, USA, 2003; Volume 1, pp. 43–59. [Google Scholar]
- DeMatteo, K.E.; Rinas, M.A.; Argüelles, C.F.; Holman, B.E.; Di Bitetti, M.S.; Davenport, B.; Parker, P.G.; Eggert, L.S. Using Detection Dogs and Genetic Analyses of Scat to Expand Knowledge and Assist Felid Conservation in Misiones, Argentina. Integr. Zool. 2014, 9, 623–639. [Google Scholar] [CrossRef] [Scilit]
- DeMatteo, K.E.; Rinas, M.A.; Argüelles, C.F.; Zurano, J.P.; Selleski, N.; Bitetti, M.S.; Eggert, L.S. Noninvasive techniques provide novel insights for elusive bush dog (Speothos venaticus). Wildl. Soc. Bull. 2014, 38, 862–873. [Google Scholar] [CrossRef] [Scilit]
- Fundación Vida Silvestre Argentina; World Wildlife Fund. El Estado Del Bosque Atlántico: Tres Países, 148 Millones de Personas, Uno de Los Bosques Más Ricos Del Planeta; Fundación Vida Silvestre Argentina: Puerto Iguazú, Argentina; World Wildlife Fund: Puerto Iguazú, Argentina, 2017. [Google Scholar]
- Izquierdo, A.E.; De Angelo, C.; Aide, M.T. Thirty Years of Human Demography and Land-Use Change in the Atlantic Forest of Misiones, Argentina: An Evaluation of the Forest Transition Model. Ecol. Soc. 2008, 13, 3. [Google Scholar] [CrossRef] [Scilit]
- ME Desarrollo Foresto Industrial. Tablero de Plantaciones Forestales. Available online: https://www.magyp.gob.ar/sitio/areas/desarrollo-foresto-industrial/inventarios/tablero.php (accessed on 8 February 2026).
- Metzger, J.P. Tree Functional Group Richness and Landscape Structure in a Brazilian Tropical Fragmented Landscape. Ecol. Appl. 2000, 10, 1147–1161. [Google Scholar] [CrossRef]
- Altrichter, M.; Almeida, R. Exploitation of White-Lipped Peccaries Tayassu pecari (Artiodactyla: Tayassuidae) on the Osa Peninsula, Costa Rica. Oryx 2002, 36, 126–132. [Google Scholar] [CrossRef] [Scilit]
- de Bustos, S.; Varela, D.; Lizárraga, L.; Cirignoli, S.; Quiroga, V.A.; Chalukián, S.; Giombini, M.; Juliá, J.P.; Quse, V.; Giraudo, A.R.; et al. Tapirus terrestris. In Categorización 2019 de los mamíferos de Argentina según su riesgo de extinción. Lista Roja de los mamíferos de Argentina; Subsecretaría de Ambiente de la Nación: Ciudad Autónoma de Buenos Aires, Argentina; Sociedad Argentina para el Estudio de los Mamíferos: Mendoza, Argentina, 2019. [Google Scholar]
- Chalukian, S.; Bustos, S.; Bitetti, M.; Angelo, C.; Paviolo, A. Orden Perissodactyla. In Libro Rojo de los Mamíferos Amenazados de la Argentina. Sociedad Argentina para el Estudio de los Mamíferos; Ojeda, R.A., Chillo, V., Díaz Isenrath, G.B., Eds.; Sociedad Argentina para el Estudio de los Mamíferos: Mendoza, Argentina, 2012; p. 116. [Google Scholar]
- Cullen, L.J.; Bodmer, R.E.; Valladares Pádua, C. Effects of Hunting in Habitat Fragments of the Atlantic Forests, Brazil. Biol. Conserv. 2000, 95, 49–56. [Google Scholar] [CrossRef] [Scilit]
- de Freitas, T.P.T.; Keuroghlian, A.; Eaton, D.P.; de Freitas, E.B.; Figueiredo, A.; Nakazato, L.; de Oliveira, J.M.; Miranda, F.; Paes, R.C.S.; Monteiro, L.A.R.C.; et al. Prevalence of Leptospira Interrogans Antibodies in Free-Ranging Tayassu pecari of the Southern Pantanal, Brazil, an Ecosystem Where Wildlife and Cattle Interact. Trop. Anim. Health Prod. 2010, 42, 1695–1703. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Galetti, M.; Giacomini, H.C.; Bueno, R.S.; Bernardo, C.S.; Marques, R.M.; Bovendorp, R.S.; Begotti, R.A. Priority Areas for the Conservation of Atlantic Forest Large Mammals. Biol. Conserv. 2009, 142, 1229–1241. [Google Scholar] [CrossRef] [Scilit]
- Keuroghlian, A.; Eaton, D.P.; Longland, W.S. Area Use by White-Lipped and Collared Peccaries (Tayassu pecari and Tayassu tajacu) in a Tropical Forest Fragment. Biol. Conserv. 2004, 120, 411–425. [Google Scholar] [CrossRef] [Scilit]
- Reyna-Hurtado, R.; Tanner, G.W. Ungulate Relative Abundance in Hunted and Non-Hunted Sites in Calakmul Forest (Southern Mexico). Biodivers. Conserv. 2007, 16, 743–756. [Google Scholar] [CrossRef] [Scilit]
- Conrad, J.M.; Lopes, A.A. Poaching and the Dynamics of a Protected Species. Resour. Energy Econ. 2017, 48, 55–67. [Google Scholar] [CrossRef] [Scilit]
- Ferreguetti, A.C.; Rocha, C.F.D.; Bergallo, H.G. Poaching in non–volant mammals in the Neotropical region: The importance of a metric to assess its impacts. Anim. Biodivers. Conserv. 2019, 42, 203–211. [Google Scholar] [CrossRef] [Scilit]
- Moore, J.F.; Uzabaho, E.; Musana, A.; Uwingeli, P.; Hines, J.E.; Nichols, J.D. What Is the Effect of Poaching Activity on Wildlife Species? Ecol. Appl. 2021, 31, e02397. [Google Scholar] [CrossRef] [Scilit]
- de Bustos, S.; Varela, D.; Lizárraga, L.; Camino, M.; Quiroga, V.A. Tayassu pecari. In Categorización 2019 de los Mamíferos de Argentina Según su Riesgo de Extinción: Lista Roja de los Mamíferos de Argentina; Subsecretaría de Ambiente de la Nación: Ciudad Autónoma de Buenos Aires, Argentina; Sociedad Argentina para el Estudio de los Mamíferos: Mendoza, Argentina, 2019. [Google Scholar]
- Cirignoli, S.; Varela, D. Dasyprocta azarae. In Categorización 2019 de los Mamíferos de Argentina Según su Riesgo de Extinción. Lista Roja de los Mamíferos de Argentina; Subsecretaría de Ambiente de la Nación: Ciudad Autónoma de Buenos Aires, Argentina; Sociedad Argentina para el Estudio de los Mamíferos: Mendoza, Argentina, 2019. [Google Scholar]
- Delgado, P.M.; Argüelles, C.F.; DeMatteo, K.E. Using Noninvasive Techniques to Monitor Game Species Targeted by Poaching in Misiones, Argentina. Neotrop. Biodivers. 2021, 7, 78–85. [Google Scholar] [CrossRef] [Scilit]
- Paviolo, A.; Angelo, C.D.; Blanco, Y.E.; Agostini, I.; Pizzio, E.; Melzew, R.; Ferrari, C.; Palacio, L.; Bitetti, M.S. Efecto de la caza furtiva y el nivel de protección en la abundancia de los grandes mamíferos del Bosque Atlántico de Misiones. In Contribuciones para la conservación y manejo en el Parque Nacional Iguazú; Carpinetti, B., Garciarena, M., Eds.; Administración de Parques Nacionales: Buenos Aires, Argentina, 2009; pp. 237–254. [Google Scholar]
- Taber, A.; Chalukian, S.C.; Altrichter, M.; Minkowski, K.; Lizárraga, L.; Sanderson, E.; Rumiz, D.; Ventincinque, E.; Moraes, E.A.; Angelo, C.; et al. El Destino de Los Arquitectos de Los Bosques Neotropicales: Evaluación de La Distribución y El Estado de Conservación de Los Pecaríes Labiados y Los Tapires de Tierras Bajas; IUCN/SSC Tapir Specialist Group: Gland, Switzerland, 2008; pp. 1–181. [Google Scholar]
- Camino, M.; Cirignoli, S.; Varela, D.; Barri, F.; Aprile, G.; Periago, M.E.; de Bustos, S.; Quiroga, V.A.; Torres, R.M.; Di Martino, S. Pecari tajacu. In Categorización 2019 de los Mamíferos de Argentina Según su Riesgo de Extinción. Lista Roja de los Mamíferos de Argentina; Subsecretaría de Ambiente de la Nación: Ciudad Autónoma de Buenos Aires, Argentina; Sociedad Argentina para el Estudio de los Mamíferos: Mendoza, Argentina, 2019. [Google Scholar]
- Beck, H. Seed Predation and Dispersal by Peccaries throughout the Neotropics and Its Consequences: A Review and Synthesis. In Seed Fate: Predation, Dispersal and Seedling Establishment, 1st ed.; Forget, P.M., Lambert, J.E., Hulme, P.E., Vander Wall, S.B., Eds.; CABI Books: Wallingford, UK, 2005; pp. 77–115. [Google Scholar]
- Bello, C.; Galetti, M.; Pizo, M.A.; Magnago, L.F.S.; Rocha, M.F.; Lima, R.A.F.; Peres, C.A.; Ovaskainen, O.; Jordano, P. Defaunation Affects Carbon Storage in Tropical Forests. Sci. Adv. 2015, 1, e1501105. [Google Scholar] [CrossRef] [Scilit]
- O’Farrill, G.; Galetti, M.; Campos-Arceiz, A. Frugivory and Seed Dispersal by Tapirs: An Insight on Their Ecological Role. Integr. Zool. 2013, 8, 4–17. [Google Scholar] [CrossRef] [Scilit]
- Keuroghlian, A.; Eaton, D.P. Fruit Availability and Peccary Frugivory in an Isolated Atlantic Forest Fragment: Effects on Peccary Ranging Behavior and Habitat Use. Biotropica 2008, 40, 62–70. [Google Scholar] [CrossRef] [Scilit]
- Jansen, P.A.; Hirsch, B.T.; Emsens, W.-J.; Zamora-Gutierrez, V.; Wikelski, M.; Kays, R. Thieving Rodents as Substitute Dispersers of Megafaunal Seeds. Proc. Natl. Acad. Sci. USA 2012, 109, 12610–12615. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pires, A.S.; Galetti, M. The Agouti Dasyprocta leporina (Rodentia: Dasyproctidae) as Seed Disperser of the Palm Astrocaryum Aculeatissimum. Mastozoología Neotrop. 2012, 19, 147–153. [Google Scholar]
- Dirzo, R.; Miranda, A. Altered Patterns of Herbivory and Diversity in the Forest Understory: A Case Study of the Possible Consequences of Contemporary Defaunation. In Plant-Animal Interactions: Evolutionary Ecology in Tropical and Temperate Regions; Price, P., Lewinsohn, T.M., Fernandes, G., Benson, W., Eds.; John Wiley & Sons: New York, NY, USA, 1991; pp. 273–287. [Google Scholar]
- Stoner, C.; Caro, T.I.M.; Mduma, S.; Mlingwa, C.; Sabuni, G.; Borner, M. Assessment of Effectiveness of Protection Strategies in Tanzania Based on a Decade of Survey Data for Large Herbivores. Conserv. Biol. 2007, 21, 635–646. [Google Scholar] [CrossRef] [Scilit]
- Aliaga-Rossel, E.; Kays, R.W.; Fragoso, J.M. Home-Range Use by the Central American Agouti (Dasyprocta punctata) on Barro Colorado Island, Panama. J. Trop. Ecol. 2008, 24, 367–374. [Google Scholar] [CrossRef] [Scilit]
- Entringer, H.; Del Duque, H.J.; Chiarello, A.G.; Srbek-Araujo, A.C. Temporal Variation of the Diet of a Top Terrestrial Predator: The Jaguar as a Case Study. Mamm. Res. 2022, 67, 417–431. [Google Scholar] [CrossRef] [Scilit]
- Paviolo, A.; Cruz, P.; Iezzi, M.E.; Pardo, J.M.; Varela, D.; Angelo, C.; Bitetti, M.S. Barriers, Corridors or Suitable Habitat? Effect of Monoculture Tree Plantations on the Habitat Use and Prey Availability for Jaguars and Pumas in the Atlantic Forest. For. Ecol. Manag. 2018, 430, 576–586. [Google Scholar] [CrossRef] [Scilit]
- Polisar, J.; Scognamillo, D.; Maxit, I.E.; Sunquist, M. Patterns of Vertebrate Abundance in a Tropical Mosaic Landscape. Stud. Neotrop. Fauna Environ. 2008, 43, 85–98. [Google Scholar] [CrossRef] [Scilit]
- Taber, A.B.; Novaro, A.J.; Neris, N.; Colman, F.H. The Food Habits of Sympatric Jaguar and Puma in the Paraguayan Chaco. Biotropica 1997, 29, 204–213. [Google Scholar] [CrossRef] [Scilit]
- Weckel, M.; Giuliano, W.; Silver, S. Jaguar (Panthera onca) Feeding Ecology: Distribution of Predator and Prey through Time and Space. J. Zool. 2006, 270, 25–30. [Google Scholar] [CrossRef] [Scilit]
- Whitworth, A.; Beirne, C.; Basto, A.; Flatt, E.; Tobler, M.; Powell, G.; Forsyth, A. Disappearance of an Ecosystem Engineer, the White-Lipped Peccary (Tayassu pecari), Leads to Density Compensation and Ecological Release. Oecologia 2022, 199, 937–949. [Google Scholar] [CrossRef] [Scilit]
- Altrichter, M.; Taber, A.; Beck, H.; Reyna-Hurtado, R.; Lizarraga, L.; Keuroghlian, A.; Sanderson, E. A Report of Range-Wide Declines for a Key Neotropical Ecosystem Architect, the White-Lipped Peccary. Oryx 2012, 46, 87–98. [Google Scholar] [CrossRef] [Scilit]
- Thornton, D.; Reyna, R.; Perera-Romero, L.; Radachowsky, J.; Hidalgo-Mihart, M.G.; Garcia, R.; McNab, R.; Mcloughlin, L.; Foster, R.; Harmsen, B.; et al. Precipitous Decline of White-Lipped Peccary Populations in Mesoamerica. Biol. Conserv. 2020, 242, 108410. [Google Scholar] [CrossRef] [Scilit]
- Cordeiro, J.L.P.; Fragoso, J.M.V.; Crawshaw, D.; Oliveira, L.F.B. Lowland Tapir Distribution and Habitat Loss in South America. PeerJ 2016, 4, e2456. [Google Scholar] [CrossRef] [Scilit]
- Kays, R.; Arbogast, B.S.; Baker-Whatton, M.; Beirne, C.; Boone, H.M.; Bowler, M.; Burneo, S.F.; Cove, M.V.; Ding, P.; Espinosa, S.; et al. An Empirical Evaluation of Camera Trap Study Design: How Many, How Long and When? Methods Ecol. Evol. 2020, 11, 700–713. [Google Scholar] [CrossRef] [Scilit]
- Long, R.A.; Donovan, T.M.; Mackay, P.; Zielinski, W.J.; Buzas, J.S. Effectiveness of Scat Detection Dogs for Detecting Forest Carnivores. J. Wild. Manag. 2007, 71, 2007–2017. [Google Scholar] [CrossRef] [Scilit]
- Burton, A.C.; Neilson, E.; Moreira, D.; Ladle, A.; Steenweg, R.; Fisher, J.T.; Bayne, E.; Boutin, S. Wildlife Camera Trapping: A Review and Recommendations for Linking Surveys to Ecological Processes. J. Appl. Ecol. 2015, 52, 675–685. [Google Scholar] [CrossRef] [Scilit]
- O’Connell, A.F.; Nichols, J.D.; Karanth, K.U. Camera Traps in Animal Ecology: Methods and Analyses; Springer Nature: Tokyo, Japan, 2011. [Google Scholar]
- Beebe, S.C.; Howell, T.J.; Bennett, P.C. Using Scent Detection Dogs in Conservation Settings: A Review of Scientific Literature Regarding Their Selection. Front. Vet. Sci. 2016, 3, 96. [Google Scholar] [CrossRef] [Scilit]
- DeMatteo, K.E.; Rinas, M.A.; Sede, M.M.; Davenport, B.; Argüelles, C.F.; Lovett, K.; Parker, P.G. Detection dogs: An effective technique for bush dog (Speothos venaticus) surveys. J. Wildl. Manag. 2009, 3, 1436–1440. [Google Scholar] [CrossRef] [Scilit]
- Long, R.A.; Donovan, T.M.; Mackay, P.; Zielinski, W.J.; Buzas, J.S. Comparing Scat Detection Dogs, Cameras, and Hair Snares for Surveying Carnivores. J. Wildl. Manag. 2007, 71, 2018–2025. [Google Scholar] [CrossRef] [Scilit]
- Beja-Pereira, A.; Oliveira, R.; Alves, P.C.; Schwartz, M.K.; Luikart, G. Advancing Ecological Understandings through Technological Transformations in Noninvasive Genetics. Mol. Ecol. Resour. 2009, 9, 1279–1301. [Google Scholar] [CrossRef] [Scilit]
- Byrne, M.S.; Peralta, D.M.; Ibañez, E.A.; Nardelli, M.; Túnez, J.I. Non-Invasive Sampling Techniques Applied to Conservation Genetic Studies in Mammals. In Molecular Ecology and Conservation Genetics of Neotropical Mammals; Nardelli, M., Túnez, J.I., Eds.; Springer International Publishing: Cham, Switzerland, 2021; pp. 63–83. [Google Scholar]
- Höss, M.; Kohn, M.; Pääbo, S.; Knauer, F.; Schröder, W. Excrement Analysis by PCR. Nature 1992, 359, 199. [Google Scholar] [CrossRef] [Scilit]
- Taberlet, P.; Bouvet, J. Génétique de l’Ours brun des Pyrénées (Ursus arctos): Premiers résultats. C. R. Acad. Sci. 1992, 314, 15–21. [Google Scholar]
- Waits, L.P.; Paetkau, D. Noninvasive Genetic Sampling Tools for Wildlife Biologists: A Review of Applications and Recommendations for Accurate Data Collection. J. Wildl. Manag. 2005, 69, 1419–1433. [Google Scholar] [CrossRef] [Scilit]
- Bach, B.H.; Quigley, A.B.; Gaynor, K.M.; McInturff, A.; Charles, K.L.; Dorcy, J.; Brashares, J.S. Identifying Individual Ungulates from Fecal DNA: A Comparison of Field Collection Methods to Maximize Efficiency, Ease, and Success. Mamm. Biol. 2022, 102, 863–874. [Google Scholar] [CrossRef] [Scilit]
- de Oliveira, M.E.; Gonçalves, F.; Galetti, P.M., Jr. Scat DNA Applications for Low-Density Carnivore Survey: Techniques, Efficiency and Future Directions. Mamm. Rev. 2025, 56, e70007. [Google Scholar] [CrossRef] [Scilit]
- Ogden, R.; Dawnay, N.; McEwing, R. Wildlife DNA Forensics—Bridging the Gap between Conservation Genetics and Law Enforcement. Endanger. Species Res. 2009, 9, 179–195. [Google Scholar] [CrossRef] [Scilit]
- Rutledge, L.Y.; Holloway, J.J.; Patterson, B.R.; White, B.N. An Improved Field Method to Obtain DNA for Individual Identification from Wolf Scat. J. Wildl. Manag. 2009, 73, 1430–1435. [Google Scholar] [CrossRef] [Scilit]
- Stenglein, J.L.; Barba, M.; Ausband, D.E.; Waits, L.P. Impacts of Sampling Location within a Faeces on DNA Quality in Two Carnivore Species. Mol. Ecol. Resour. 2010, 10, 109–114. [Google Scholar] [CrossRef] [Scilit]
- Taberlet, P.; Coissac, E.; Hajibabaei, M.; Rieseberg, L.H. Environmental DNA. Mol. Ecol. 2012, 21, 1789–1793. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vynne, C.; Baker, M.R.; Breuer, Z.K.; Wasser, S.K. Factors Influencing Degradation of DNA and Hormones in Maned Wolf Scat. Anim. Conserv. 2011, 15, 184–194. [Google Scholar] [CrossRef] [Scilit]
- Brinkman, T.; Schwartz, M.; Person, D.; Pilgrim, K.; Hundertmark, K. Effects of Time and Rainfall on PCR Success Using DNA Extracted from Deer Fecal Pellets. Conserv. Genet. 2010, 11, 1547–1552. [Google Scholar] [CrossRef] [Scilit]
- Glen, A.S.; Veltman, C.J. Search Strategies for Conservation Detection Dogs. Wildl. Biol. 2018, 2018, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Reed, S.E.; Bidlack, A.L.; Hurt, A.; Getz, W.M. Detection Distance and Environmental Factors in Conservation Detection Dog Surveys. J. Wildl. Manag. 2011, 75, 243–251. [Google Scholar] [CrossRef] [Scilit]
- Kokocińska-Kusiak, A.; Woszczyło, M.; Zybala, M.; Maciocha, J.; Barłowska, K.; Dzięcioł, M. Canine Olfaction: Physiology, Behavior, and Possibilities for Practical Applications. Animals 2021, 11, 2463. [Google Scholar] [CrossRef] [Scilit]
- Osterkamp, T. Detector Dogs and Scent Movement: How Weather, Terrain, and Vegetation Influence Search Strategies; CRC Press: Boca Raton, FL, USA, 2020. [Google Scholar]
- Wohlfahrt, G.; Schmitt, M.; Zeller, L.; Hörand, A.; Spittel-Schnell, K.; Wulms, T.; Schnell, R.; Bültge, M. Air Temperature and Humidity Effects on the Performance of Conservation Detection Dogs. Appl. Anim. Behav. Sci. 2023, 262, 105909. [Google Scholar] [CrossRef] [Scilit]
- DeMatteo, K.E.; Rinas, M.A.; Zurano, J.P.; Selleski, N.; Schneider, R.G.; Argüelles, C.F. Using Niche-Modelling and Species-Specific Cost Analyses to Determine a Multispecies Corridor in a Fragmented Landscape. PLoS ONE 2017, 12, e0183648. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- DeMatteo, K.E.; Escalante, O.M.; Ibañez Alegre, D.M.; Rinas, M.A.; Sotorres, D.; Argüelles, C.F. A Multispecies Corridor in a Fragmented Landscape: Evaluating Effectiveness and Identifying High-Priority Target Areas. PLoS ONE 2023, 18, e0283258. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nussear, K.; Esque, T.; Heaton, J.; Cablk, M.; Drake, K.; Valentin, C.; Yee, J.; Medica, P. Are Wildlife Detector Dogs or People Better at Finding Desert Tortoises (Gopherus agassizii)? Herpetol. Conserv. Biol. 2008, 3, 103–115. [Google Scholar]
- Lazarowski, L.; Rogers, B.; Waggoner, L.P.; Katz, J.S. When the Nose Knows: Ontogenetic Changes in Detection Dogs’ (Canis Familiaris) Responsiveness to Social and Olfactory Cues. Anim. Behav. 2019, 153, 61–68. [Google Scholar] [CrossRef] [Scilit]
- DeMatteo, K.E.; Davenport, B.; Wilson, L.E. Back to the Basics with Conservation Detection Dogs: Fundamentals for Success. Wild. Biol. 2019, 2019, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Ball, M.C.; Pither, R.; Manseau, M.; Clark, J.; Petersen, S.D.; Kingston, S.; Morrill, M.; Wilson, P. Characterization of Target Nuclear DNA from Faeces Reduces Technical Issues Associated with the Assumptions of Low-Quality and Quantity Template. Conserv. Genet. 2007, 8, 577–586. [Google Scholar] [CrossRef] [Scilit]
- Manning, J.A.; Edwards, T.; Clemons, J.; Leavitt, D.J.; Goldberg, C.S.; Culver, M. Scat as a Source of DNA for Population Monitoring. Ecol. Evol. 2022, 12, e9415. [Google Scholar] [CrossRef] [Scilit]
- Marrero, P.; Fregel, R.; Cabrera, V.M.; Nogales, M. Extraction of High-Quality Host DNA from Feces and Regurgitated Seeds: A Useful Tool for Vertebrate Ecological Studies. Biol. Res. 2009, 42, 147–151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miles, K.A.; Holtz, M.N.; Lounsberry, Z.T.; Sacks, B.N. A Paired Comparison of Scat-collecting versus Scat-swabbing Methods for Noninvasive Recovery of Mesocarnivore DNA from an Arid Environment. Wildl. Soc. Bull. 2015, 39, 797–803. [Google Scholar] [CrossRef] [Scilit]
- Cirignoli, S.; Galliari, C.A.; Pardiñas, U.F.J.; Podestá, D.H.; Abramson, R. Mamíferos de la Reserva Valle del Cuña Pirú, Misiones, Argentina. Mastozool. Neotrop. 2011, 18, 25–43. [Google Scholar]
- De Angelo, C. Guía de Huellas de Mamíferos y Grandes Reptiles de Misiones, Norte Grande y Otras Áreas del Subtrópico de Argentina, 3rd ed.; CeIBA, Centro de Investigaciones del Bosque Atlántico Misiones; Ediciones del Subtrópico, Fundación ProYungas: Puerto Iguazú, Argentina, 2017. [Google Scholar]
- Norris, D. Model Thresholds Are More Important than Presence Location Type: Understanding the Distribution of Lowland Tapir (Tapirus terrestris) in a Continuous Atlantic Forest of Southeast Brazil. Trop. Conserv. Sci. 2014, 7, 529–547. [Google Scholar] [CrossRef] [Scilit]
- Norris, D.; Peres, C.A.; Michalski, F.; Hinchsliffe, K. Terrestrial Mammal Responses to Edges in Amazonian Forest Patches: A Study Based on Track Stations. Mammalia 2008, 72, 15. [Google Scholar] [CrossRef] [Scilit]
- Rumboll, M. Guía de Huellas, Rastros y Señales de los Mamíferos de los Parques Nacionales, 1st ed.; Administración de Parques Nacionales: Buenos Aires, Argentina, 2011.
- Salas, L.A.; Fuller, T.K. Diet of the Lowland Tapir (Tapirus terrestris L.) in the Tabaro River Valley, Southern Venezuela. Can. J. Zool. 1996, 74, 1444–1451. [Google Scholar] [CrossRef] [Scilit]
- Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory: Cold Spring Harbor, NY, USA, 1989. [Google Scholar]
- Vynne, C. Landscape Use by Wide-Ranging Mammals of the Brazilian Cerrado. Ph.D. Thesis, University of Washington, Seattle, WA, USA, 2010. [Google Scholar]
- Farrell, L.E.; Roman, J.; Sunquist, M.E. Dietary Separation of Sympatric Carnivores Identified by Molecular Analysis of Scats. Mol. Ecol. 2000, 9, 1583–1590. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miotto, R.A.; Rodrigues, F.P.; Ciocheti, G.; Galetti, P.M. Determination of the Minimum Population Size of Pumas (Puma concolor) Through Fecal DNA Analysis in Two Protected Cerrado Areas in the Brazilian Southeast. Biotropica 2007, 39, 647–654. [Google Scholar] [CrossRef] [Scilit]
- Sotorres, D. Identificación Forense y Análisis de Distribución de Especies Presa a Lo Largo Del Corredor Biológico Propuesto Para Misiones (Argentina); Universidad Nacional de Misiones: Posadas, Argentina, 2019. [Google Scholar]
- Verma, S.K.; Singh, L. Novel Universal Primers Establish Identity of an Enormous Number of Animal Species for Forensic Application. Mol. Ecol. Notes 2003, 3, 28–31. [Google Scholar] [CrossRef] [Scilit]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic Local Alignment Search Tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef] [PubMed]
- Izquierdo, A.E.; Clark, M.L. Spatial Analysis of Conservation Priorities Based on Ecosystem Services in the Atlantic Forest Region of Misiones, Argentina. Forests 2012, 3, 764–786. [Google Scholar] [CrossRef] [Scilit]
- Bolker, B.M.; Brooks, M.E.; Clark, C.J.; Geange, S.W.; Poulsen, J.R.; Stevens, M.H.H.; White, J.-S.S. Generalized Linear Mixed Models: A Practical Guide for Ecology and Evolution. Trends Ecol. Evol. 2009, 24, 127–135. [Google Scholar] [CrossRef] [Scilit]
- Zuur, A.F.; Ieno, E.N.; Walker, N.; Saveliev, A.A.; Smith, G.M. Mixed Effects Models and Extensions in Ecology with R; Statistics for Biology and Health; Springer: New York, NY, USA, 2009. [Google Scholar]
- O’Hara, R.B.; Kotze, D.J. Do Not Log-Transform Count Data. Methods Ecol. Evol. 2010, 1, 118–122. [Google Scholar] [CrossRef] [Scilit]
- Brooks, M.; Kristensen, K.; van Benthem, K.; Magnusson, A.; Berg, C.; Nielsen, A.; Skaug, H.; Mächler, M.; Bolker, B. glmmTMB Balances Speed and Flexibility Among Packages for Zero-Inflated Generalized Linear Mixed Modeling. R J. 2017, 9, 378–400. [Google Scholar] [CrossRef] [Scilit]
- Burnham, K.P.; Anderson, D.R. (Eds.) Model Selection and Multimodel Inference; Springer: New York, NY, USA, 2002. [Google Scholar]
- Hartig, F.; Lohse, L.; de Souza Leite, M. DHARMa: Residual Diagnostics for Hierarchical (Multi-Level/Mixed) Regression Models. 2024. Available online: https://CRAN.R-project.org/package=DHARMa (accessed on 12 March 2026).
- Johnson, D.H. The Comparison of Usage and Availability Measurements for Evaluating Resource Preference. Ecology 1980, 61, 65–71. [Google Scholar] [CrossRef] [Scilit]
- Manly, B.F.J.; McDonald, L.L.; Thomas, D.L.; McDonald, T.L.; Erickson, W.P. (Eds.) Studies with Resources Defined by Several Categories. In Resource Selection by Animals: Statistical Design and Analysis for Field Studies; Springer: Dordrecht, The Netherlands, 2002; pp. 46–82. [Google Scholar]
- Medici, E.P.; Mezzini, S.; Fleming, C.H.; Calabrese, J.M.; Noonan, M.J. Movement Ecology of Vulnerable Lowland Tapirs between Areas of Varying Human Disturbance. Mov. Ecol. 2022, 10, 14. [Google Scholar] [CrossRef] [Scilit]
- Judas, J.; Henry, O. Seasonal Variation of Home Range of Collared Peccary in Tropical Rain Forests of French Guiana. J. Wildl. Manag. 1999, 63, 546–552. [Google Scholar] [CrossRef] [Scilit]
- Ribeiro, J.F.; Vieira, E.M. Interactions between a Seed-Eating Neotropical Rodent, the Azara’s Agouti (Dasyprocta azarae), and the Brazilian ‘Pine’ Araucaria angustifolia. Austral Ecol. 2014, 39, 279–287. [Google Scholar] [CrossRef] [Scilit]
- De Angelo, C.; Paviolo, A.; Di Bitetti, M. Differential Impact of Landscape Transformation on Pumas (Puma concolor) and Jaguars (Panthera onca) in the Upper Paraná Atlantic Forest. Divers. Distrib. 2011, 17, 422–436. [Google Scholar] [CrossRef] [Scilit]
- Dehaudt, B. Seed Disperser Populations and Plant-Animal Interactions in Tropical Forests of the Anthropocene. Ph.D. Thesis, The University of Queensland, Brisbane, QLD, Australia, 2025. [Google Scholar]
- Matthiopoulos, J.; Fieberg, J.; Aarts, G. Species-Habitat Associations: Spatial Data, Predictive Models, and Ecological Insights, 2nd ed.; University of Minnesota Libraries Publishing: Minneapolis, MN, USA, 2023. [Google Scholar]
- Dormann, C.F.; McPherson, J.M.; Araújo, M.B.; Bivand, R.; Bolliger, J.; Carl, G.; Davies, R.G.; Hirzel, A.; Jetz, W.; Kissling, W.D.; et al. Methods to Account for Spatial Autocorrelation in the Analysis of Species Distributional Data: A Review. Ecography 2007, 30, 609–628. [Google Scholar] [CrossRef] [Scilit]
- DeMatteo, K.E.; Blake, L.W.; Young, J.K.; Davenport, B. How Behavior of Nontarget Species Affects Perceived Accuracy of Scat Detection Dog Surveys. Sci. Rep. 2018, 8, 13830. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alaeddini, R. Forensic Implications of PCR Inhibition—A Review. Forensic Sci. Int. Genet. 2012, 6, 297–305. [Google Scholar] [CrossRef] [Scilit]
- Bessetti, J. An Introduction to PCR Inhibitors. J. Microbiol. Methods 2007, 28, 159–167. [Google Scholar]
- Monteiro, L.; Bonnemaison, D.; Vekris, A.; Petry, K.G.; Bonnet, J.; Vidal, R.; Mégraud, F. Complex Polysaccharides as PCR Inhibitors in Feces: Helicobacter Pylori Model. J. Clin. Microbiol. 1997, 35, 995–998. [Google Scholar] [CrossRef] [Scilit]
- Ramón-Laca, A.; Soriano, L.; Gleeson, D.; Godoy, J.A. A Simple and Effective Method for Obtaining Mammal DNA from Faeces. Wildl. Biol. 2015, 21, 195–203. [Google Scholar] [CrossRef] [Scilit]
- Flesher, K.M.; Medici, E.P. The Distribution and Conservation Status of Tapirus terrestris in the South American Atlantic Forest. Neotrop. Biol. Conserv. 2022, 17, 1–19. [Google Scholar] [CrossRef] [Scilit]
- Medici, E.P. Assessing the Viability of Lowland Tapir Populations in a Fragmented Landscape. Ph.D. Thesis, University of Kent, Canterbury, UK, 2010. [Google Scholar]
- Taber, A.; Chalukian, S.C.; Altrichter, M.; Minkowski, K.; Lizárraga, L. Análisis de la Distribución y el Estado de Conservación del Tapir (Tapirus terrestris) y el Pecarí Labiado (Tayassu pecari) en Latinoamérica; Pigs, Peccaries and Hippos Specialist Group (IUCN, Gland, Switzerland); Tapir Specialist Group (IUCN/SSC Tapir Specialist Group, Gland, Switzerland); Wildlife Conservation Society: New York, NY, USA; Wildlife Trust: London, UK, 2008. [Google Scholar]
- Vidolin, G.P.; Batista, D.B.; Wandembruck, A. Landscape Valuation Based on the Ecological Requirements of ‘Tayassu pecari’ and ‘Tapirus terrestris’—A Forest with Araucaria, in Paraná State, Brazil. Ciênc. Florest. 2011, 21, 509–519. [Google Scholar] [CrossRef] [Scilit]
- Cruz, P.; Paviolo, A.; Bó, R.F.; Thompson, J.J.; Di Bitetti, M.S. Daily Activity Patterns and Habitat Use of the Lowland Tapir (Tapirus terrestris) in the Atlantic Forest. Mamm. Biol. 2014, 79, 376–383. [Google Scholar] [CrossRef] [Scilit]
- Hou, R.; Gogarten, J.F.; Golooba, M.; Kalbitzer, U.; Kirumira, D.; Omeja, P.A.; Opito, E.A.; Reyna-Hurtado, R.; Sarkar, D.; Tumwesigye, C.; et al. Parks Can Effectively Protect Ungulates and Elephants despite a Constant Poaching Threat. Glob. Ecol. Conserv. 2024, 54, e03075. [Google Scholar] [CrossRef] [Scilit]
- Medici, E.P.; Desbiez, A.L.J. Population Viability Analysis: Using a Modeling Tool to Assess the Viability of Tapir Populations in Fragmented Landscapes. Integr. Zool. 2012, 7, 356–372. [Google Scholar] [CrossRef] [Scilit]
- Rivera, L.O.; Martinuzzi, S.; Politi, N.; Bardavid, S.; de Bustos, S.; Chalukian, S.; Lizárraga, L.; Radeloff, V.; Pidgeon, A. National Parks Influence Habitat Use of Lowland Tapirs in Adjacent Private Lands in the Southern Yungas of Argentina. Oryx 2020, 55, 625–634. [Google Scholar] [CrossRef] [Scilit]
- Teixeira-Santos, J.; da Cunha Ribeiro, A.C.; Wiig, Ø.; Pinto, N.S.; Cantanhêde, L.G.; Sena, L.; Mendes-Oliveira, A.C. Environmental Factors Influencing the Abundance of Four Species of Threatened Mammals in Degraded Habitats in the Eastern Brazilian Amazon. PLoS ONE 2020, 15, e0229459. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Keuroghlian, A.; Eaton, D.P. Importance of Rare Habitats and Riparian Zones in a Tropical Forest Fragment: Preferential Use by Tayassu pecari, a Wide-Ranging Frugivore. J. Zool. 2008, 275, 283–293. [Google Scholar] [CrossRef] [Scilit]
- Romero, A.; O’Neill, B.J.; Timm, R.M.; Gerow, K.G.; McClearn, D. Group Dynamics, Behavior, and Current and Historical Abundance of Peccaries in Costa Rica’s Caribbean Lowlands. J. Mammal. 2013, 94, 771–791. [Google Scholar] [CrossRef] [Scilit]
- Tobler, M.W.; Carrillo-Percastegui, S.E.; Powell, G. Habitat Use, Activity Patterns and Use of Mineral Licks by Five Species of Ungulate in South-Eastern Peru. J. Trop. Ecol. 2009, 25, 261–270. [Google Scholar] [CrossRef] [Scilit]
- Desbiez, A.L.J.; Bodmer, R.E.; Santos, S.A. Wildlife Habitat Selection and Sustainable Resources Management in a Neotropical Wetland. Int. J. Biodivers. Conserv. 2009, 1, 11–20. [Google Scholar]
- Regolin, A.L.; Oliveira-Santos, L.G.; Ribeiro, M.C.; Bailey, L.L. Habitat Quality, Not Habitat Amount, Drives Mammalian Habitat Use in the Brazilian Pantanal. Landsc. Ecol. 2021, 36, 2519–2533. [Google Scholar] [CrossRef] [Scilit]
- Teixeira Rodrigues, É. Padrão de Ocupação de Cutias (Dasyprocta azarae) em Paisagens Neotropicais. Bachelor’s Thesis, Universidade Estadual Paulista, São Paulo, Brazil, 2017. [Google Scholar]
- Falconi-Briones, F.A.; Naranjo, E.J.; Reyna-Hurtado, R.; Spínola, M.; Enríquez-Rocha, P.; Medellín, R.A. Habitat Use and Activity Patterns of Ungulates in a Tropical Rainforest of Southern México. Therya 2022, 13, 171–182. [Google Scholar] [CrossRef] [Scilit]
- Fragoso, J.M.V.; Antunes, A.P.; Silvius, K.M.; Constantino, P.A.L.; Zapata-Ríos, G.; Bizri, H.R.E.; Bodmer, R.E.; Camino, M.; de Thoisy, B.; Wallace, R.B.; et al. Large-Scale Population Disappearances and Cycling in the White-Lipped Peccary, a Tropical Forest Mammal. PLoS ONE 2022, 17, e0276297. [Google Scholar] [CrossRef] [Scilit]
- Barnas, A.F.; Ladle, A.; Burgar, J.M.; Burton, A.C.; Boyce, M.S.; Eliuk, L.; Fisher, J.T. How Landscape Traits Affect Boreal Mammal Responses to Anthropogenic Disturbance. Sci. Total Environ. 2024, 915, 169285. [Google Scholar] [CrossRef] [Scilit]
- Abreu Pestana, L.F.; Martello, F.; Fonseca, R.C.B. Richness and Composition of Terrestrial Mammals Vary in Eucalyptus Plantations Due to Stand Age. Austral Ecol. 2023, 48, 743–760. [Google Scholar] [CrossRef] [Scilit]
- Zhang, C.; Li, Y.; Hu, X.; Ma, X.; Jia, W.; Liu, K.; Nie, Y. Human-Induced Behavioural Changes of Global Threatened Terrestrial Mammals. Glob. Ecol. Biogeogr. 2023, 32, 1645–1659. [Google Scholar] [CrossRef] [Scilit]
- Gray, C.L.; Hill, S.L.L.; Newbold, T.; Hudson, L.N.; Börger, L.; Contu, S.; Hoskins, A.J.; Ferrier, S.; Purvis, A.; Scharlemann, J.P.W. Local Biodiversity Is Higher inside than Outside Terrestrial Protected Areas Worldwide. Nat. Commun. 2016, 7, 12306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Malakoutikhah, S.; Fakheran, S.; Hemami, M.-R.; Tarkesh, M.; Senn, J. Assessing Future Distribution, Suitability of Corridors and Efficiency of Protected Areas to Conserve Vulnerable Ungulates under Climate Change. Divers. Distrib. 2020, 26, 1383–1396. [Google Scholar] [CrossRef] [Scilit]
- Riquelme, C.; Estay, S.A.; López, R.; Pastore, H.; Soto-Gamboa, M.; Corti, P. Protected Areas’ Effectiveness under Climate Change: A Latitudinal Distribution Projection of an Endangered Mountain Ungulate along the Andes Range. PeerJ 2018, 6, e5222. [Google Scholar] [CrossRef] [Scilit]
- Neto, E.P.; Barquero, G.; Fragoso, J.M.V. Navigating Human-Dominated Landscapes: Spatial Strategies of a Herd Forming Ungulate in an Agricultural-to-Natural Matrix. bioRxiv 2025. [Google Scholar] [CrossRef] [Scilit]
- de Faria Oshima, J.E.; Jorge, M.L.S.P.; Sobral-Souza, T.; Börger, L.; Keuroghlian, A.; Peres, C.A.; Vancine, M.H.; Collen, B.; Ribeiro, M.C. Setting Priority Conservation Management Regions to Reverse Rapid Range Decline of a Key Neotropical Forest Ungulate. Glob. Ecol. Conserv. 2021, 31, e01796. [Google Scholar] [CrossRef] [Scilit]
- Ripple, W.J.; Abernethy, K.; Betts, M.G.; Chapron, G.; Dirzo, R.; Galetti, M.; Young, H. Bushmeat Hunting and Extinction Risk to the World’s Mammals. R. Soc. Open Sci. 2016, 3, 160498. [Google Scholar] [CrossRef] [Scilit]
- Sobral-Souza, T.; Vancine, M.H.; Ribeiro, M.C.; Lima-Ribeiro, M.S. Efficiency of Protected Areas in Amazon and Atlantic Forest Conservation: A Spatio-Temporal View. Acta Oecol. 2018, 87, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Ferreguetti, A.C.; Walfrido, M.T.; Bergallo, H.G. Differences in the Mammalian Habitat Use in a Mosaic of Vegetation Types of an Atlantic Rain-Forest Reserve, Brazil. Mastozool. Neotrop. 2017, 24, 355–364. [Google Scholar]
- Galetti, M.; Brocardo, C.R.; Begotti, R.A.; Hortenci, L.; Rocha-Mendes, F.; Bernardo, C.S.S.; Bueno, R.S.; Nobre, R.; Bovendorp, R.S.; Marques, R.M.; et al. Defaunation and Biomass Collapse of Mammals in the Largest Atlantic Forest Remnant. Anim. Conserv. 2016, 20, 270–281. [Google Scholar] [CrossRef] [Scilit]
- Iezzi, M.E.; Cruz, P.; Varela, D.; Bitetti, M.S.; Angelo, C. Fragment Configuration or Environmental Quality? Understanding What Really Matters for the Conservation of Native Mammals in the Atlantic Forest of Argentina. J. Nat. Conserv. 2019, 52, 125751. [Google Scholar] [CrossRef] [Scilit]
- Meyer, N.F.V.; Moreno, R.; Sanches, E.; Ortega, J.; Brown, E.; Jansen, P.A. Do Protected Areas in Panama Support Intact Assemblages of Ungulates? Therya 2016, 7, 65–76. [Google Scholar] [CrossRef] [Scilit]
- Pardini, R.; Souza, S.M.; Braga-Neto, R.; Metzger, J.P. The Role of Forest Structure, Fragment Size and Corridors in Maintaining Small Mammal Abundance and Diversity in an Atlantic Forest Landscape. Biol. Conserv. 2005, 124, 253–266. [Google Scholar] [CrossRef] [Scilit]
- Fort, J.L.; Suriyamongkol, T.; Nielsen, C.K.; Carver, A.D.; Moreno, R.; Meyer, N.F.V. Large Felid and Peccary Habitat Use in Isolated and Contiguous Forest in Panama: Implications for Conservation. Trop. Conserv. Sci. 2022, 15, 19400829221138009. [Google Scholar] [CrossRef] [Scilit]
- Meyer, N.; Esser, H.J.; Moreno, R.; Langevelde, F.; Liefting, Y.; Oller, D.R.; Vogels, C.; Carver, A.; Nielsen, C.; Jansen, P. An Assessment of the Terrestrial Mammal Communities in Forest of Central Panama Using Camera-Trap Surveys. J. Nat. Conserv. 2015, 26, 28–35. [Google Scholar] [CrossRef] [Scilit]
- Pina-Covarrubias, E.; Chavez, C.; Chapman, M.A.; Morales, M.; Elizalde-Arellano, C.; Doncaster, C. Ecology of Large Felids and Their Prey in Small Reserves of the Yucatan Peninsula of Mexico. J. Mammal. 2022, 104, 115–127. [Google Scholar] [CrossRef] [Scilit]
- Xavier Da Silva, M.; Paviolo, A.; Tambosi, L.R.; Pardini, R. Effectiveness of Protected Areas for Biodiversity Conservation: Mammal Occupancy Patterns in the Iguaçu National Park, Brazil. J. Nat. Conserv. 2018, 41, 51–62. [Google Scholar] [CrossRef] [Scilit]
- Sotorres, D. Uso Del Hábitat y Variabilidad Genética Del Tapir (Tapirus terrestris) En El Corredor Biológico Propuesto Para La Región Norte-Centro Del Corredor Verde de Misiones. Master’s Thesis, Universidad Nacional de Misiones, Eldorado, Argentina, 2022. [Google Scholar]
- Novaro, A.J.; Redford, K.H.; Bodmer, R.E. Effect of Hunting in Source-Sink Systems in the Neotropics. Conserv. Biol. 2000, 14, 713–721. [Google Scholar] [CrossRef] [Scilit]
- Avigliano, E.; Rosso, J.J.; Lijtmaer, D.; Ondarza, P.; Piacentini, L.; Izquierdo, M.; Cirigliano, A.; Romano, G.; Bustos, E.N.; Porta, A.; et al. Biodiversity and Threats in Non-Protected Areas: A Multidisciplinary and Multi-Taxa Approach Focused on the Atlantic Forest. Heliyon 2019, 5, e02292. [Google Scholar] [CrossRef] [Scilit]
- Polo Perdomo, L.S.; Baldassini, P.; Di Bella, C.M. Fragmentation Dynamics in the Atlantic Forest Green Corridor of Misiones, Argentina: Implications for Conservation Planning and Policy Effectiveness. J. Nat. Conserv. 2026, 91, 127212. [Google Scholar] [CrossRef] [Scilit]
- Ghoddousi, A.; Soofi, M.; Hamidi, A.K.; Ashayeri, S.; Egli, L.; Ghoddousi, S.; Speicher, J.; Khorozyan, I.; Kiabi, B.H.; Waltert, M. The Decline of Ungulate Populations in Iranian Protected Areas Calls for Urgent Action against Poaching. Oryx 2019, 53, 151–158. [Google Scholar] [CrossRef] [Scilit]
- Iezzi, M.E.; Bitetti, M.S.; Pardo, J.M.; Paviolo, A.; Cruz, P.; Angelo, C. Forest Fragments Prioritization Based on Their Connectivity Contribution for Multiple Atlantic Forest Mammals. Biol. Conserv. 2022, 266, 109433. [Google Scholar] [CrossRef] [Scilit]
- de Matos Dias, D.; Ferreguetti, Á.C.; Rodrigues, F.H.G. Using an Occupancy Approach to Identify Poaching Hotspots in Protected Areas in a Seasonally Dry Tropical Forest. Biol. Conserv. 2020, 251, 108796. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moore, J.F.; Mulindahabi, F.; Masozera, M.K.; Nichols, J.D.; Hines, J.E.; Turikunkiko, E.; Oli, M.K. Are Ranger Patrols Effective in Reducing Poaching-Related Threats within Protected Areas? J. Appl. Ecol. 2018, 55, 99–107. [Google Scholar] [CrossRef] [Scilit]
- le Roex, N.; Dreyer, C.; Ferreira, S.M. Poaching Creates Ecological Traps within an Iconic Protected Area. Anim. Conserv. 2020, 23, 250–259. [Google Scholar] [CrossRef] [Scilit]
- FSC. Forest Stewardship Council. Available online: https://fsc.org/en (accessed on 8 February 2026).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
