A Multidisciplinary Evaluation of Three-Dimensional Polycaprolactone Bioactive Glass Scaffolds for Bone Tissue Engineering Purposes
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation
2.1.1. Preparation of Glass Powders
2.1.2. Preparation of the Poly(ε-Caprolactone)/Bioactive Glass Composite
2.1.3. 3D Scaffold Fabrication
2.2. Fourier Transform Infrared Spectroscopy (FTIR) Analysis
2.3. Scanning Electron Microscopy (SEM) Analysis
2.4. MSC Seeding and Osteogenic Differentiation
2.5. mRNAs Expression by Real-Time PCR
2.6. Statistical Analysis of Gene Expression
2.7. Microtomography (MicroCT) Analysis
2.8. Atomic Force Microscopy (AFM) Analysis
3. Results
3.1. FTIR Analysis
3.2. SEM Measurements
3.3. Gene Expression
3.4. MicroCT Analysis
3.5. Atomic force Microscopy
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| AFM | Atomic Force Microscopy |
| ALP | Alkaline Phosphatase |
| ATR | Attenuated Total Reflection |
| BG | Bioactive glass |
| BM-MSCs | Bone marrow mesenchymal stem cells |
| BSP | Bone Sialoprotein |
| ECM | Extracellular Matrix |
| EDX | Energy-dispersive X-ray analysis |
| FTIR | Fourier-Transform Infrared Spectrophotometry |
| GAPDH | Glyceraldehyde-3-phosphate dehydrogenase |
| GPU | Graphics Processing Unit |
| k | Cantilever Stiffness |
| MicroCT | Micro-Computed Tomography |
| MSCs | Mesenchymal Stem Cells |
| OC | Osteocalcin |
| OP | Osteopontin |
| OSX | Transcription factor Osterix |
| R | Curvature radius of the AFM spherical tip |
| ROI | Region of interest |
| RUNX | RUNX family transcription factor 2 |
| SEM | Scanning electron microscopy |
| PCL | Polycaprolactone |
| 2D | Two-dimensional |
| 3D | Three-dimensional |
References
- Florencio-Silva, R.; Sasso, G.R.D.S.; Sasso-Cerri, E.; Simões, M.J.; Cerri, P.S. Biology of Bone Tissue: Structure, Function, and Factors That Influence Bone Cells. Biomed. Res. Int. 2015, 2015, 421746. [Google Scholar] [CrossRef] [Scilit]
- Dwivedi, R.; Kumar, S.; Pandey, R.; Mahajan, A.; Nandana, D.; Katti, D.S.; Mehrotra, D. Polycaprolactone as Biomaterial for Bone Scaffolds: Review of Literature. J. Oral Biol. Craniofacial Res. 2020, 10, 381–388. [Google Scholar] [CrossRef] [Scilit]
- Judex, S.; Carlson, K.J. Is Bone’s Response to Mechanical Signals Dominated by Gravitational Loading? Med. Sci. Sports Exerc. 2009, 41, 2037–2043. [Google Scholar] [CrossRef] [Scilit]
- Lee, S.S.; Du, X.; Kim, I.; Ferguson, S.J. Scaffolds for Bone-Tissue Engineering. Matter 2022, 5, 2722–2759. [Google Scholar] [CrossRef] [Scilit]
- Gharibshahian, M.; Salehi, M.; Beheshtizadeh, N.; Kamalabadi-Farahani, M.; Atashi, A.; Nourbakhsh, M.S.; Alizadeh, M. Recent Advances on 3D-Printed PCL-Based Composite Scaffolds for Bone Tissue Engineering. Front. Bioeng. Biotechnol. 2023, 11, 1168504. [Google Scholar] [CrossRef] [Scilit]
- Abdelaziz, A.G.; Nageh, H.; Abdo, S.M.; Abdalla, M.S.; Amer, A.A.; Abdal-hay, A.; Barhoum, A. A Review of 3D Polymeric Scaffolds for Bone Tissue Engineering: Principles, Fabrication Techniques, Immunomodulatory Roles, and Challenges. Bioengineering 2023, 10, 204. [Google Scholar] [CrossRef] [Scilit]
- Amini, A.R.; Laurencin, C.T.; Nukavarapu, S.P. Bone Tissue Engineering: Recent Advances and Challenges. Crit. Rev. Biomed. Eng. 2012, 40, 363–408. [Google Scholar] [CrossRef] [Scilit]
- Koons, G.L.; Diba, M.; Mikos, A.G. Materials Design for Bone-Tissue Engineering. Nat. Rev. Mater. 2020, 5, 584–603. [Google Scholar] [CrossRef] [Scilit]
- Filippi, M.; Born, G.; Chaaban, M.; Scherberich, A. Natural Polymeric Scaffolds in Bone Regeneration. Front. Bioeng. Biotechnol. 2020, 8, 474. [Google Scholar] [CrossRef] [Scilit]
- Ghassemi, T.; Shahroodi, A.; Ebrahimzadeh, M.H.; Mousavian, A.; Movaffagh, J.; Moradi, A. Current Concepts in Scaffolding for Bone Tissue Engineering. Arch. Bone. Jt. Surg. 2018, 6, 90. [Google Scholar]
- Yang, X.; Wang, Y.; Zhou, Y.; Chen, J.; Wan, Q. The Application of Polycaprolactone in Three Dimensional Printing Scaffolds for Bone Tissue Engineering. Polymers 2021, 13, 2754. [Google Scholar] [CrossRef] [Scilit]
- Wang, C.; Meng, C.; Zhang, Z.; Zhu, Q. 3D Printing of Polycaprolactone/Bioactive Glass Composite Scaffolds for in Situ Bone Repair. Ceram. Int. 2022, 48, 7491–7499. [Google Scholar] [CrossRef] [Scilit]
- Siddiqui, N.; Asawa, S.; Birru, B.; Baadhe, R.; Rao, S. PCL-Based Composite Scaffold Matrices for Tissue Engineering Applications. Mol. Biotechnol. 2018, 60, 506–532. [Google Scholar] [CrossRef] [Scilit]
- Kang, D.; Lee, Y.B.; Yang, G.H.; Choi, F.; Nam, Y.; Lee, J.; Lee, K.; Kim, K.S.; Yeo, M.; Yoon, G.; et al. FeS2-incorporated 3D PCL scaffold improves new bone formation and neovascularization in a rat calvarial defect model. Int. J. Bioprint. 2022, 9, 636. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, Y.; Seles, M.A.; Rajan, M. Role of Bioglass Derivatives in Tissue Regeneration and Repair: A Review. Rev. Adv. Mater. Sci. 2023, 62, 20220318. [Google Scholar] [CrossRef]
- Dziadek, M.; Dziadek, K.; Checinska, K.; Zagrajczuk, B.; Golda-Cepa, M.; Brzychczy-Wloch, M.; Menaszek, E.; Kopec, A.; Cholewa-Kowalska, K. PCL and PCL/Bioactive Glass Biomaterials as Carriers for Biologically Active Polyphenolic Compounds: Comprehensive Physicochemical and Biological Evaluation. Bioact. Mater. 2021, 6, 1811–1826. [Google Scholar] [CrossRef] [Scilit]
- Witkowska-Zimny, M.; Walenko, K.; Wrobel, E.; Mrowka, P.; Mikulska, A.; Przybylski, J. Effect of Substrate Stiffness on the Osteogenic Differentiation of Bone Marrow Stem Cells and Bone-Derived Cells. Cell Biol. Int. 2013, 37, 608–616. [Google Scholar] [CrossRef] [Scilit]
- Tamjid, E.; Bagheri, R.; Vossoughi, M.; Simchi, A. Effect of Particle Size on the in Vitro Bioactivity, Hydrophilicity and Mechanical Properties of Bioactive Glass-Reinforced Polycaprolactone Composites. Mater. Sci. Eng. C 2011, 31, 1526–1533. [Google Scholar] [CrossRef] [Scilit]
- Daskalakis, E.; Huang, B.; Vyas, C.; Acar, A.A.; Fallah, A.; Cooper, G.; Weightman, A.; Koc, B.; Blunn, G.; Bartolo, P. Novel 3D Bioglass Scaffolds for Bone Tissue Regeneration. Polymers 2022, 14, 445. [Google Scholar] [CrossRef] [Scilit]
- Petretta, M.; Gambardella, A.; Boi, M.; Berni, M.; Cavallo, C.; Marchiori, G.; Maltarello, M.C.; Bellucci, D.; Fini, M.; Baldini, N.; et al. Composite Scaffolds for Bone Tissue Regeneration Based on Pcl and Mg-Containing Bioactive Glasses. Biology 2021, 10, 398. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Sing, S.L. A review of advances in additive manufacturing and the integration of high-performance polymers, alloys, and their composites. Mater. Sci. Addit. Manuf. 2023, 2, 1587. [Google Scholar] [CrossRef] [Scilit]
- Wubneh, A.; Tsekoura, E.K.; Ayranci, C.; Uludağ, H. Current state of fabrication technologies and materials for bone tissue engineering. Acta Biomater. 2018, 80, 1–30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, J.; Xiong, S.; Liu, M.; Yang, H.; Wei, P.; Yi, F.; Ouyang, M.; Xi, H.; Long, Z.; Liu, Y.; et al. Study on the Influence of Scaffold Morphology and Structure on Osteogenic Performance. Front. Bioeng. Biotechnol. 2023, 11, 1127162. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alshammari, A.; Alabdah, F.; Wang, W.; Cooper, G. Virtual Design of 3D-Printed Bone Tissue Engineered Scaffold Shape Using Mechanobiological Modeling: Relationship of Scaffold Pore Architecture to Bone Tissue Formation. Polymers 2023, 15, 3918. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chu, S.F.; Huang, M.T.; Ou, K.L.; Sugiatno, E.; Cheng, H.Y.; Huang, Y.H.; Chiu, W.T.; Liou, T.H. Enhanced Biocompatible and Hemocompatible Nano/Micro Porous Surface as a Biological Scaffold for Functionalizational and Biointegrated Implants. J. Alloys Compd. 2016, 684, 726–732. [Google Scholar] [CrossRef] [Scilit]
- Richert, L.; Vetrone, F.; Yi, J.H.; Zalzal, S.F.; Wuest, J.D.; Rosei, F.; Nanci, A. Surface Nanopatterning to Control Cell Growth. Adv. Mater. 2008, 20, 1488–1492. [Google Scholar] [CrossRef] [Scilit]
- Andrukhov, O.; Huber, R.; Shi, B.; Berner, S.; Rausch-Fan, X.; Moritz, A.; Spencer, N.D.; Schedle, A. Proliferation, Behavior, and Differentiation of Osteoblasts on Surfaces of Different Microroughness. Dent. Mater. 2016, 32, 1374–1384. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, C.S.; Kim, J.H.; Kim, B.; Park, Y.S.; Kim, H.K.; Tran, H.T.; Kim, S.H.; Jeon, H.; Kim, S.; Sim, J.H.; et al. A Specific Groove Pattern Can Effectively Induce Osteoblast Differentiation. Adv. Funct. Mater. 2017, 27, 1703569. [Google Scholar] [CrossRef] [Scilit]
- Bontempi, M.; Marchiori, G.; Petretta, M.; Capozza, R.; Grigolo, B.; Giavaresi, G.; Gambardella, A. Nanomechanical Mapping of Three Dimensionally Printed Poly-ε-Caprolactone Single Microfibers at the Cell Scale for Bone Tissue Engineering Applications. Biomimetics 2023, 8, 617. [Google Scholar] [CrossRef] [Scilit]
- Marchiori, G.; Berni, M.; Boi, M.; Petretta, M.; Grigolo, B.; Bellucci, D.; Cannillo, V.; Garavelli, C.; Bianchi, M. Design of a Novel Procedure for the Optimization of the Mechanical Performances of 3D Printed Scaffolds for Bone Tissue Engineering Combining CAD, Taguchi Method and FEA. Med. Eng. Phys. 2019, 69, 92–99. [Google Scholar] [CrossRef] [Scilit]
- Bellucci, D.; Cannillo, V. A Novel Bioactive Glass Containing Strontium and Magnesium with Ultra-High Crystallization Temperature. Mater. Lett. 2018, 213, 67–70. [Google Scholar] [CrossRef] [Scilit]
- Bellucci, D.; Veronesi, E.; Strusi, V.; Petrachi, T.; Murgia, A.; Mastrolia, I.; Dominici, M.; Cannillo, V. Human Mesenchymal Stem Cell Combined with a New Strontium-Enriched Bioactive Glass: An Ex-Vivo Model for Bone Regeneration. Materials 2019, 12, 3633. [Google Scholar] [CrossRef] [Scilit]
- Chen, Q.Z.; Thompson, I.D.; Boccaccini, A.R. 45S5 Bioglass®-Derived Glass-Ceramic Scaffolds for Bone Tissue Engineering. Biomaterials 2006, 27, 2414–2425. [Google Scholar] [CrossRef] [Scilit]
- Bontempi, M.; Capozza, R.; Visani, A.; Fini, M.; Giavaresi, G.; Gambardella, A. Near-Surface Nanomechanics of Medical-Grade PEEK Measured by Atomic Force Microscopy. Polymers 2023, 15, 718. [Google Scholar] [CrossRef] [Scilit]
- Elzubair, A.; Elias, C.N.; Suarez, J.C.M.; Lopes, H.P.; Vieira, M.V.B. The Physical Characterization of a Thermoplastic Polymer for Endodontic Obturation. J. Dent. 2006, 34, 784–789. [Google Scholar] [CrossRef] [Scilit]
- Mehdipour, M.; Afshar, A. A Study of the Electrophoretic Deposition of Bioactive Glass-Chitosan Composite Coating. Ceram. Int. 2012, 38, 471–476. [Google Scholar] [CrossRef] [Scilit]
- Jones, J.R.; Ehrenfried, L.M.; Hench, L.L. Optimising Bioactive Glass Scaffolds for Bone Tissue Engineering. Biomaterials 2006, 27, 964–973. [Google Scholar] [CrossRef] [Scilit]
- Barrioni, B.R.; Norris, E.; Jones, J.R.; Pereira, M.d.M. The Influence of Cobalt Incorporation and Cobalt Precursor Selection on the Structure and Bioactivity of Sol–gel-Derived Bioactive Glass. J. Sol-Gel Sci. Technol. 2018, 88, 309–321. [Google Scholar] [CrossRef] [Scilit]
- Jana, S.; Leung, M.; Chang, J.; Zhang, M. Effect of Nano- and Micro-Scale Topological Features on Alignment of Muscle Cells and Commitment of Myogenic Differentiation. Biofabrication 2014, 6, 035012. [Google Scholar] [CrossRef] [Scilit]
- Phillipson, K.; Hay, J.N.; Jenkins, M.J. Thermal Analysis FTIR Spectroscopy of Poly(ε-Caprolactone). Thermochim. Acta 2014, 595, 74–82. [Google Scholar] [CrossRef] [Scilit]
- Kim, Y.; Lim, J.Y.; Yang, G.H.; Seo, J.; Ryu, H.; Kim, G. 3D-printed PCL/bioglass (BGS-7) composite scaffolds with high toughness and cell-responses for bone tissue regeneration. J. Ind. Eng. Chem. 2019, 79, 171. [Google Scholar] [CrossRef] [Scilit]
- Collinson, D.W.; Sheridan, R.J.; Palmeri, M.J.; Brinson, L.C. Best Practices and Recommendations for Accurate Nanomechanical Characterization of Heterogeneous Polymer Systems with Atomic Force Microscopy. Prog. Polym. Sci. 2021, 119, 101420. [Google Scholar] [CrossRef] [Scilit]
- Park, S.H.; Park, D.S.; Shin, J.W.; Kang, Y.G.; Kim, H.K.; Yoon, T.R.; Shin, J.-W. Scaffolds for bone tissue engineering fabricated from two different materials by the rapid prototyping technique: PCL versus PLGA. J. Mater. Sci. Mater. Med. 2012, 23, 2671–2678. [Google Scholar] [CrossRef] [Scilit] [PubMed]














| Parameter | PCL | PCL-BGMS10 |
|---|---|---|
| Pressure (Bar) | 5 | 5 |
| Speed (mm/s) | 4 | 4 |
| Printhead Temperature (°C) | 110 | 120 |
| Collector Temperature (°C) | 30 | 40 |
| Start Delay Time (ms) | 0 | 200 |
| RNA Template | Primer Sequences (5′-3′) | Annealing Temperature (°C) |
|---|---|---|
| GAPDH | 5′-TGG TAT CGT GGA AGG ACT CAT GAC 3′-ATG CCA GTG AGC TTC CCG TTC AGC | 60 |
| BSP | 5′-CAGTAGTGACTCATCCGAAG 3′-CATAGCCCAGTGTTGTAGCA | 60 |
| OC | 5′-GCAGCGAGGTAGTGAAGA 3′-TCCTGAAAGCCGATGTGG | 60 |
| OP | 5′-ATGATGGCCGAGGTGATAG 3′-GCTTTCCATGTGTGAGGTG | 60 |
| ALP | 5′- GGAAGACACTCTGACCGT 3′- GCCCATTGCCATACAGGA | 60 |
| RUNX | 5′- GGAATGCCTCTGCTGTTATG 3′- AGACGGTTATGGTCAAGGTG | 60 |
| OSX | 5′-TGCTTGAGGAGGAAGTTCACTATG 3′-AAAGGTCACTGCCCACAGA | 60 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Marchiori, G.; Bellucci, D.; Gambardella, A.; Petretta, M.; Berni, M.; Boi, M.; Grigolo, B.; Giavaresi, G.; Baldini, N.; Cannillo, V.; et al. A Multidisciplinary Evaluation of Three-Dimensional Polycaprolactone Bioactive Glass Scaffolds for Bone Tissue Engineering Purposes. Materials 2024, 17, 2413. https://doi.org/10.3390/ma17102413
Marchiori G, Bellucci D, Gambardella A, Petretta M, Berni M, Boi M, Grigolo B, Giavaresi G, Baldini N, Cannillo V, et al. A Multidisciplinary Evaluation of Three-Dimensional Polycaprolactone Bioactive Glass Scaffolds for Bone Tissue Engineering Purposes. Materials. 2024; 17(10):2413. https://doi.org/10.3390/ma17102413
Chicago/Turabian StyleMarchiori, Gregorio, Devis Bellucci, Alessandro Gambardella, Mauro Petretta, Matteo Berni, Marco Boi, Brunella Grigolo, Gianluca Giavaresi, Nicola Baldini, Valeria Cannillo, and et al. 2024. "A Multidisciplinary Evaluation of Three-Dimensional Polycaprolactone Bioactive Glass Scaffolds for Bone Tissue Engineering Purposes" Materials 17, no. 10: 2413. https://doi.org/10.3390/ma17102413
APA StyleMarchiori, G., Bellucci, D., Gambardella, A., Petretta, M., Berni, M., Boi, M., Grigolo, B., Giavaresi, G., Baldini, N., Cannillo, V., & Cavallo, C. (2024). A Multidisciplinary Evaluation of Three-Dimensional Polycaprolactone Bioactive Glass Scaffolds for Bone Tissue Engineering Purposes. Materials, 17(10), 2413. https://doi.org/10.3390/ma17102413

