A Fluorescence Enhancement Sensor Based on Silver Nanoclusters Protected by Rich-G-DNA for ATP Detection
Abstract
1. Introduction
2. Results and Discussion
2.1. Assay of Excitation and Emission Spectra, Stability, and Quantum Yield of DNA-Ag NCs
2.2. TEM Images and XPS Measurements of ATP-DNA2-Ag NCs
2.3. Optimization of the Assay Conditions
2.3.1. Effect of DNA Templates on the Optical Properties of DNA-Ag NCs
2.3.2. Determination of Reaction Time
2.3.3. Effect of pH on the Optical Properties of ATP-DNA2-Ag NCs
2.4. Measurement of ATP in PBS
2.5. Interference Study
2.6. Investigation of ATP in Diluted Fetal Bovine Serum
3. Experimental Section
3.1. Reagents and Instruments
3.2. Preparation of DNA-Ag NCs
3.3. Sensing Experiments in PBS
3.4. Application of the Sensor
3.5. Detection of Absolute Photoluminescence Quantum Yield
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Peng, L.M.; Bian, Y.C.; Shen, X.Q.; Yao, H.C.; Chen, H.J.; Li, Z.J. Efficient silver nanocluster photocatalyst for simultaneous methyl orange/4-chlorophenol oxidation and Cr(VI) reduction. Chin. Chem. Lett. 2020, 31, 2871–2875. [Google Scholar] [CrossRef] [Scilit]
- Naaz, S.; Poddar, S.; Bayen, S.P.; Mondal, M.K.; Roy, D.; Mondal, S.K.; Chowdhury, P.; Saha, S.K. Tenfold enhancement of fluorescence quantum yield of water soluble silver nanoclusters for nano-molar level glucose sensing and precise determination of blood glucose level. Sens. Actuators B-Chem. 2018, 255, 332–340. [Google Scholar] [CrossRef] [Scilit]
- Naaz, S.; Chowdhury, P. Sunlight and ultrasound-assisted synthesis of photoluminescent silver nanoclusters: A unique ‘Knock out’ sensor for thiophilic metal ions. Sens. Actuators B-Chem. 2017, 241, 840–848. [Google Scholar] [CrossRef] [Scilit]
- Chowdhury, P.; Hazra, A.; Kr, M.; Mondal, B.; Roy, D.; Roy, S.P.; Pal Bayen, S. Facile synthesis of polyacrylate directed silver nanoparticles for pH sensing through naked eye. J. Macromol. Sci. A 2019, 56, 773–780. [Google Scholar] [CrossRef] [Scilit]
- Lyu, D.; Li, J.; Wang, X.; Guo, W.; Wang, E. Ag Nanocluster/DNA Hybrids: Functional Modules for the Detection of Nitroaromatic and RDX Explosives Cationic Polyelectrolyte Modified Fluorescent DNA-Silver Nanoclusters for Rapid Bioimaging with Enhanced Emission and Higher Stability. Anal. Chem. 2019, 91, 2050–2057. [Google Scholar] [CrossRef] [Scilit]
- Enkin, N.; Sharon, E.; Golub, E.; Willner, I. Ag Nanocluster/DNA Hybrids: Functional Modules for the Detection of Nitroaromatic and RDX Explosives. Nano Lett. 2014, 14, 4918–4922. [Google Scholar] [CrossRef] [Scilit]
- Park, K.S.; Park, H.G. Technological applications arising from the interactions of DNA bases with metal ions. Curr. Opin. Biotechnol. 2014, 28, 21–24. [Google Scholar] [CrossRef] [Scilit]
- Durgadas, C.V.; Sharma, C.P.; Sreenivasan, K. Fluorescent gold clusters as nanosensors for copper ions in live cells. Analyst 2011, 136, 933–940. [Google Scholar] [CrossRef] [Scilit]
- Xie, J.P.; Zheng, Y.G.; Ying, J.Y. Highly selective and ultrasensitive detection of Hg2+ based on fluorescence quenching of Au nanoclusters by Hg2+–Au+ interactions. Chem. Commun. 2010, 46, 961–963. [Google Scholar] [CrossRef] [Scilit]
- Lin, Y.H.; Tseng, W.L. Ultrasensitive Sensing of Hg2+ and CH3Hg+ Based on the Fluorescence Quenching of Lysozyme Type VI-Stabilized Gold Nanoclusters. Anal. Chem. 2010, 82, 9194–9200. [Google Scholar] [CrossRef] [Scilit]
- Paau, M.C.; Lo, C.K.; Yang, X.P.; Choi, M.M.F. Synthesis of 1.4 nm α-Cyclodextrin-Protected Gold Nanoparticles for Luminescence Sensing of Mercury(II) with Picomolar Detection Limit. J. Phys. Chem. C 2010, 114, 15995–16003. [Google Scholar] [CrossRef] [Scilit]
- Shang, L.; Dong, S.J. Sensitive detection of cysteine based on fluorescent silver clusters. Biosens. Bioelectron. 2009, 24, 1569–1573. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wen, F.; Dong, Y.H.; Feng, L.; Wang, S.; Zhang, S.C.; Zhang, X.R. Horseradish Peroxidase Functionalized Fluorescent Gold Nanoclusters for Hydrogen Peroxide Sensing. Anal. Chem. 2011, 83, 1193–1196. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, J.L.; Ma, J.H.; Zhang, Y.C.; Zhang, Z.L.; He, G.W. A fluorometric method for determination of the activity of T4 polynucleotide kinase by using a DNA-templated silver nanocluster probe. Microchim. Acta 2019, 186, 48–54. [Google Scholar] [CrossRef] [Scilit]
- Zhu, S.Y.; Zhao, X.E.; Zhang, W.; Liu, Z.Y.; Qi, W.J.; Anjuma, S.; Xu, G.B. Fluorescence detection of glutathione reductase activity based on deoxyribonucleic acid-templated silver nanoclusters. Anal. Chim. Acta 2013, 786, 111–115. [Google Scholar] [CrossRef] [Scilit]
- Guo, L.Y.; Chen, D.L.; Yang, M.H. DNA-templated silver nanoclusters for fluorometric determination of the activity and inhibition of alkaline phosphatise. Microchim. Acta 2017, 184, 2165–2170. [Google Scholar] [CrossRef] [Scilit]
- Yuan, Y.; Ma, Y.Y.; Luo, L.; Wang, Q.; Huang, J.; Liu, J.B.; Yang, X.H.; Wang, K.M. Ratiometric determination of human papillomavirus-16 DNA by using fluorescent DNA-templated silver nanoclusters and hairpin-blocked DNAzyme-assisted cascade amplification. Microchim. Acta 2019, 186, 613–618. [Google Scholar] [CrossRef] [Scilit]
- Ge, L.; Sun, X.M.; Hong, Q.; Li, F. Ratiometric NanoCluster Beacon: A Label-Free and Sensitive Fluorescent DNA Detection Platform. ACS Appl. Mater. Interfaces 2017, 9, 13102–13110. [Google Scholar] [CrossRef] [Scilit]
- Ge, L.; Sun, X.M.; Hong, Q.; Li, F. Ratiometric Catalyzed-Assembly of NanoCluster Beacons: A Nonenzymatic Approach for Amplifiled DNA Detection. ACS Appl. Mater. Interfaces 2017, 9, 32089–32096. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, J.; Zhong, X.; Zhang, H.; Le, X.C.; Zhu, J.J. Binding-Induced Fluorescence Turn-On Assay Using Aptamer-Functionalized Silver Nanocluster DNA Probes. Anal. Chem. 2012, 84, 5170–5174. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.J.; Song, X.R.; Wang, Y.W.; Zheng, A.X.; Chen, G.N.; Yang, H.H. Label-free and fluorescence turn-on aptasensor for protein detection via target-induced silver nanoclusters formation. Anal. Chim. Acta 2012, 749, 70–74. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, P.; Wang, Y.; Chang, Y.; Xiong, Z.H.; Huang, C.Z. Highly selective detection of bacterial alarmone ppGpp with an off–on fluorescent probe of copper-mediated silver nanoclusters. Biosens. Bioelectron. 2013, 49, 433–437. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, P.Z.; Cheng, Y.; Chen, Q.; Qu, L.L.; Miao, X.M.; Feng, Q.M. Label-free aptamer-based chemiluminescence detection of adenosine construction of a paper-based electrochemical biosensing platform for rapid and accurate detection of adenosine triphosphate (ATP). Sens. Actuators B Chem. 2018, 256, 931–937. [Google Scholar] [CrossRef] [Scilit]
- Perez-ruiz, T.; Martine-Lozano, C.; Tomas, V.; Martin, J. Functional Significance of Mitochondrial Bound Hexokinase in Tumor Cell Metabolism Determination of ATP via the photochemical generation of hydrogen peroxide using flow injection luminol chemiluminescence detection. Anal. Bioanal. Chem. 2003, 377, 189–194. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yan, X.; Cao, Z.; Kai, M.; Lu, J. Label-free aptamer-based chemiluminescence detection of adenosine. Talanta 2009, 79, 383–387. [Google Scholar] [CrossRef] [Scilit]
- Tatsumi, T.; Shiraishi, J.; Keira, N.; Akashi, K.; Mano, A.; Yamanaka, S.; Matoba, S.; Fushiki, S.; Fliss, H.; Nakagawa, M. Intracellular ATP is required for mitochondrial apoptotic pathways in isolated hypoxic rat cardiac myocytes. Cardiovasc. Res. 2003, 59, 428–440. [Google Scholar] [CrossRef] [Scilit]
- Arora, K.K.; Pedersen, P.L. Functional Significance of Mitochondrial Bound Hexokinase in Tumor Cell Metabolism. J. Biol. Chem. 1988, 263, 17422–17428. [Google Scholar] [CrossRef] [Scilit]
- Chaudry, I.H.; Clemens, M.G.; Ohkawa, M.; Schleck, S.; Baue, A.E. Altered hepatocellular active transport. An early change in peritonitis. Adv. Shock Res. 1982, 8, 177–186. [Google Scholar]
- Weille, J.D.; Lazdunski, M. ATP-sensitive K+ channels that are blocked by hypoglycemia-inducing sulfonylureas in insulin-secreting cells are activated by galanin, a hyperglycemia-inducing hormone. Proc. Natl. Acad. Sci. USA 1988, 85, 1312–1316. [Google Scholar] [CrossRef] [Scilit]
- Janssens, D.; Michiels, C.; Delaive, E.; Eliaers, F.; Drieu, K. Protection of Hypoxia-Induced Atp Decrease in Endothelial Cells by Ginkgo Biloba Extract And Bilobalide. J. Remacle 1995, 50, 991–999. [Google Scholar]
- Li, F.; Du, Z.; Yang, L.; Tang, B. Selective and sensitive turn-on detection of adenosine triphosphate and thrombin based on bifunctional fluorescent oligonucleotide probe. Biosens. Bioelectron. 2013, 41, 907–910. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, Z.Q.; Qiu, Z.L.; Lu, M.H.; Shu, J.; Tang, D.P. Hybridization chain reaction-based colorimetric aptasensor of adenosine 5′-triphosphate on unmodified gold nanoparticles and two label-free hairpin probes. Biosens. Bioelectron. 2016, 89, 1006–1012. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.; Yang, J.M.; Xie, J.Q.; Jiang, B.Y.; Yuan, R.; Xiang, Y. Cascaded signal amplification via target-triggered formation of aptazyme for sensitive electrochemical detection of ATP. Biosens. Bioelectron. 2018, 102, 296–300. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Motoyoshiya, J.; Wada, J.Y.; Itoh, K.; Wakabayashi, K.; Maruyama, T.; Ono, K.; Fukasawa, K.; Fujimoto, T.; Akaiwa, Y.; Nonaka, E. Fluorescence and chemiluminescence behavior of distyrylbenzene bearing two arms of dipicolylaminomethyl groups: Interactions with zinc ion and ATP. Spectrochim. Acta Part A 2018, 195, 223–229. [Google Scholar] [CrossRef] [Scilit]
- Sottofattori, E.; Anzaldi, M.; Ottonello, L. HPLC determination of adenosine in human synovial fluid. J. Pharm. Biomed. Anal. 2001, 24, 1143–1146. [Google Scholar] [CrossRef] [Scilit]
- Webster, D.R.; Boston, G.D.; Paton, D.M. Measurement of Adenosine Metabolites and Metabolism in Isolated Tissue Preparations. J. Pharmacol. Methods 1985, 13, 339–350. [Google Scholar] [CrossRef] [Scilit]
- Yin, B.-C.; Ma, J.-L.; Le, H.-N.; Wang, S.; Xu, Z.; Ye, B.-C. A new mode to light up adjacent DNA-scaffolded silver probe pair and its application for specific DNA detection. Chem. Commun. 2014, 50, 15991–15994. [Google Scholar] [CrossRef] [Scilit]
- Xu, J.; Wei, C. The aptamer DNA-templated fluorescence silver nanoclusters: ATP detection and preliminary mechanism investigation. Biosens. Bioelectron. 2017, 87, 422–427. [Google Scholar] [CrossRef] [Scilit]
- Zhang, B.; Yang, Z.; Li, Y.; Ma, L.; Li, F.; Lv, X.; Wen, G. A label-free aptasensor for the detection of ATP based on turn-on fluorescence DNA-templated silver nanoclusters. RSC Adv. 2022, 12, 30024–30029. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Meng, Z.; Liu, Y.; Zhang, B. Turn-on fluorescent nanoprobe for ATP detection based on DNA-templated silver nanoclusters. RSC Adv. 2024, 14, 5594–5599. [Google Scholar] [CrossRef] [Scilit]
- Zhang, B.; Wei, C. The sensitive detection of ATP and ADA based on turn-on fluorescent copper/silver nanoclusters. Anal. Bioanal. Chem. 2020, 412, 2529–2536. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gwinn, E.G.; O’Neill, P.; Guerrero, A.J.; Bouwmeester, D.; Fygenson, D.K. Sequence-Dependent Fluorescence of DNA-Hosted Silver Nanoclusters. Adv. Mater. 2008, 20, 279–283. [Google Scholar] [CrossRef] [Scilit]
- Loo, K.; Degtyareva, N.; Park, J.; Sengupta, B.; Reddish, M.; Rogers, C.C.; Bryant, A.; Petty, J.T. Ag+-Mediated Assembly of 5′-Guanosine Monophosphate. J. Phys. Chem. B 2010, 114, 4320–4326. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, X.-R.; Goswami, N.; Yang, H.-H.; Xie, J. Functionalization of metal nanoclusters for biomedical applications. Analyst 2016, 141, 3126–3140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Krishnadas, K.R.; Ghosh, A.; Baksi, A.I.; Natarajan, G.; Pradeep, T. Intercluster Reactions between Au25(SR)18 and Ag44(SR)30. J. Am. Chem. Soc. 2016, 138, 140–148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, Q.; Lin, Y.; Xu, M.; Gao, Z.; Yang, H.; Tang, D. Facile Synthesis of Enhanced Fluorescent Gold−Silver Bimetallic Nanocluster and Its Application for Highly Sensitive Detection of Inorganic Pyrophosphatase Activity. Anal. Chem. 2016, 88, 8886–8892. [Google Scholar] [CrossRef] [Scilit]
- Platzman, I.; Brener, R.; Haick, H.; Tannenbaum, R. Oxidation of poly-crystalline copper thin films at ambient conditions. J. Phys. Chem. C 2008, 112, 1101–1108. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.F.; Lee, D.; Wu, D.; Swamy, K.M.K.; Yoon, J. A new kind of rhodamine-based fluorescence turn-on probe for monitoring ATP in mitochondria. Sens. Actuators B Chem. 2018, 265, 429–434. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.J.; Lin, B.X.; Yu, Y.; Cao, Y.J.; Guo, M.L. A multifunctional probe based on the use of labeled aptamer and magnetic nanoparticles for fluorometric determination of adenosine 5′-triphosphate. Microchim. Acta 2018, 185, 243–250. [Google Scholar] [CrossRef] [Scilit]
- Song, Q.-W.; Wang, R.-H.; Sun, F.-F.; Chen, H.-K.; Wang, Z.-M.-K.; Na, N. A nuclease-assisted label-free aptasensor for fluorescence turn-on detection of ATP based on the in situ formation of copper nanoparticles. Biosens. Bioelectron. 2017, 87, 760–763. [Google Scholar] [CrossRef] [Scilit]
- Zhu, Y.; Hu, X.-C.; Shi, S.; Gao, R.-R.; Huang, H.-L.; Zhu, Y.-Y. Ultrasensitive and universal fluorescent aptasensor for the detection of biomolecules (ATP, adenosine and thrombin) based on DNA/Ag nanoclusters fluorescence light-up system. Biosens. Bioelectron. 2016, 79, 205–212. [Google Scholar] [CrossRef] [Scilit] [PubMed]








| Oligonucleotids | Sequences (5′-3′) |
|---|---|
| ATP-DNA | CCCTTAATCCCCTTTTTAACCTGGGGGAGTATTGCGGAGGAAGGTTTTT |
| ATP-DNA1 | CCCTTAATCCCCTTTTTAACCTGGGGGAGTATTGCGGAGGAAGGTTTTTGGGTGGGG |
| ATP-DNA2 | CCCTTAATCCCCTTTTTAACCTGGGGGAGTATTGCGGAGGAAGGTTTTTGGGTGGGGTGGGG |
| ATP-DNA3 | CCCTTAATCCCCTTTTTAACCTGGGGGAGTATTGCGGAGGAAGGTTTTTGGGTGGGGTGGGGTGGGG |
| Samples | Spiked (mM) | Measured (mM) Means a ± SD b | Average Recovery (%) | RSD (%) |
|---|---|---|---|---|
| 1 | 15 | 15.2 ± 0.18 | 101.3 | 1.18 |
| 2 | 18 | 18.3 ± 0.19 | 101.7 | 1.04 |
| 3 | 21 | 20.9 ± 0.22 | 99.5 | 1.05 |
| 4 | 24 | 24.3 ± 0.23 | 101.3 | 0.95 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Y.; Ren, J.; Meng, Z.; Zhang, B. A Fluorescence Enhancement Sensor Based on Silver Nanoclusters Protected by Rich-G-DNA for ATP Detection. Molecules 2024, 29, 4490. https://doi.org/10.3390/molecules29184490
Li Y, Ren J, Meng Z, Zhang B. A Fluorescence Enhancement Sensor Based on Silver Nanoclusters Protected by Rich-G-DNA for ATP Detection. Molecules. 2024; 29(18):4490. https://doi.org/10.3390/molecules29184490
Chicago/Turabian StyleLi, Yuxia, Jingxuan Ren, Zeting Meng, and Baozhu Zhang. 2024. "A Fluorescence Enhancement Sensor Based on Silver Nanoclusters Protected by Rich-G-DNA for ATP Detection" Molecules 29, no. 18: 4490. https://doi.org/10.3390/molecules29184490
APA StyleLi, Y., Ren, J., Meng, Z., & Zhang, B. (2024). A Fluorescence Enhancement Sensor Based on Silver Nanoclusters Protected by Rich-G-DNA for ATP Detection. Molecules, 29(18), 4490. https://doi.org/10.3390/molecules29184490
