Next Article in Journal
Isolation of Candida Species Is Associated with Comorbidities, Prolonged Mechanical Ventilation, and Treatment Outcomes in Surgical ICU Patients, a Cross-Sectional Study
Previous Article in Journal
Label-Free Optical Transmission Tomography for Direct Mycological Examination and Monitoring of Intracellular Dynamics
Previous Article in Special Issue
The Mitochondrial Distribution and Morphology Family 33 Gene FgMDM33 Is Involved in Autophagy and Pathogenesis in Fusarium graminearum
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Characterization and Pathogenicity of Colletotrichum falcatum Causing Red Rot on Sugarcane in Southern Florida

by
Fernanda Rodrigues Silva
1,2,
Mário Lúcio V. de Resende
2,
Larissa Carvalho Ferreira
1,
Olamide Adesina
1,3 and
Katia V. Xavier
1,*
1
Department of Plant Pathology, University of Florida, Everglades Research and Education Center, Belle Glade, FL 33430-4702, USA
2
Departamento de Química/Fitopatologia, Universidade Federal de Lavras, Lavras 37200-900, Brazil
3
Department of Plant Pathology, Kansas State University, Manhattan, KS 66506-0110, USA
*
Author to whom correspondence should be addressed.
J. Fungi 2024, 10(11), 742; https://doi.org/10.3390/jof10110742
Submission received: 25 July 2024 / Revised: 16 October 2024 / Accepted: 20 October 2024 / Published: 27 October 2024
(This article belongs to the Special Issue Fungal Plant Pathogens)

Abstract

Red rot disease reduces sugarcane yield and impacts the sugar quality, posing an important threat to the sugarcane industry in Florida. Although Colletotrichum falcatum, the causal agent of red rot in Florida, was first reported in 1984 based on morphology, molecular and pathological data have remained limited, highlighting the critical need for comprehensive characterization. Thirteen isolates were obtained from three local sugarcane varieties in Belle Glade, Florida. Phylogenetic analyses of five genetic markers (ITS, ACT, TUB2, GAPDH, and CHS-1) confirmed all the strains as C. falcatum. In addition, the study documented the disease progression at the cellular level and assessed the pathogenicity of representative strains using the leaf sheath and whole-seedling inoculation methods. The varieties CP96-1252 and CP89-2143 showed greater host resistance. These findings represent the first report of C. falcatum causing red rot in southern Florida, offer valuable insights for/into red rot management, and provide a basis for future breeding programs to enhance sugarcane resistance to red rot disease.

1. Introduction

Sugarcane (Saccharum ssp.) is a global cash tropical grass crop cultivated across 26.3 million hectares, with a total production of approximately 1.9 billion tons [1]. In the 2022 and 2023 seasons, the United States (U.S.) ranked as the sixth largest sugarcane producer in the world [2]. Florida alone is responsible for more than 50% of the value of the sugar derived from sugarcane nationwide, generating approximately 712 million USD in 2020 [3]. Plant diseases significantly impact sugarcane production, especially in tropical and subtropical regions where warm temperatures and high humidity are conducive to disease development. Fungal pathogens can directly infect the interior of the sugarcane stalks, affecting yield, juice quality, and sugar content [4,5,6]. Among these, red rot stands out as one of the most important fungal diseases affecting sugarcane worldwide [7,8,9].
The foliar phase of this disease is characterized by reddish lesions that extend along the midrib and leaf blade, having a pale color at the center where the pathogen sporulates, producing conidia within acervuli [10,11]. The pathogen subsequently infects the cane stalks, which is known as the stalk phase [10], moving downwards through the vascular tissues, resulting in a reddish discoloration that can be observed by splitting the stalks longitudinally [12]. This infection leads to the repression of sucrose transporters [13] and the inversion of sucrose, compromising juice quality and reducing cane weight by 29 to 83% [14,15].
Three species of Colletotrichum (C. falcatum, C. siamense, and C. plurivorum) have been reported to be associated with sugarcane red rot in Brazil [9,16], although Colletotrichum falcatum is the predominant etiological agent in regions such as Bangladesh, Brazil, India, and the U.S. [8,9,16,17,18,19]. Despite its global importance, this disease remains poorly characterized, with critical knowledge gaps regarding the causative agent in the U.S. and its development in sugarcane living tissue.
Red rot was first observed in the U.S. in 1909 in Louisiana [20]. Since then, it has caused significant losses in sugarcane production in the southern U.S. [21]. In Florida, the first report of C. falcatum on sugarcane was produced based on morphological characteristics in 1984 [17]. Accurate pathogen identification is essential for developing effective management strategies [22]. However, morphological and physiological characteristics alone are often insufficient to differentiate between Colletotrichum species due to significant overlap [23]. For example, in 2009, six new species of Colletotrichum were identified causing disease on grasses, yet they showed no significant morphological similarities to other grass-associated Colletotrichum species, highlighting the necessity for molecular techniques in an accurate identification [24].
Colletotrichum falcatum has exhibited high variability in virulence, leading to the emergence of new pathotypes [5,8,25,26]. These new pathotypes pose a challenge to red rot management and breeding efforts, as they can overcome the resistance of existing varieties [25,26,27]. In Florida, the limited information on the resistance levels of local sugarcane varieties to red rot further complicates disease control.
Although extensive research has been conducted on the symptomatology and overall life cycle of C. falcatum in sugarcane, the majority of studies have focused on the stalk phase [22,28,29,30]. Consequently, our knowledge of the pathogen development within sugarcane leaves remains limited. A comprehensive understanding of the foliar phase is essential for elucidating the host–pathogen interaction during leaf infection and ultimately developing more effective management strategies against red rot [31,32].
Given the limited understanding of Colletotrichum species and the gaps in knowledge regarding their pathogenicity in Florida, there is a critical need to perform the molecular characterization and assess the pathogenicity of the Colletotrichum species associated with sugarcane in southern Florida. Therefore, the aims of this study were to (i) conduct a multilocus molecular phylogenetic analysis of Colletotrichum strains from southern Florida, (ii) investigate the foliar phase of C. falcatum at the cellular level, and (iii) assess the pathogenicity of representative isolates on three commercial sugarcane varieties grown in the region. These findings are vital for improving red rot management strategies and enhancing sugarcane resistance to this devastating disease.

2. Materials and Methods

2.1. Fungal Isolation

Sugarcane leaf samples were collected in 2022 and 2023 from plants in field from varieties CL85-1040, CP96-1252, and CP89-2143 exhibiting symptoms of red rot at the University of Florida Everglades Research and Education Center (EREC), Belle Glade, Florida (26°40′03″ N 80°38′06″ W). One symptomatic leaf was collected per plant, resulting in a total of 13 leaves for fungal isolation. Triangular fragments of healthy and symptomatic tissue were surface sterilized in 70% ethanol for 30 s and in 1.2% of sodium hypochlorite for 3 min, washed three times in sterile distilled water (SDW), and dried in a sterile paper towel. Four fragments of each leaf were plated in potato dextrose agar (PDA) (BD Difco™, New York, NY, USA) amended with 1% (v/v) neomycin-penicillin-streptomycin (Sigma-Aldrich, St Louis, MO, USA) at 23 °C for 7 to 10 days [33].
Single spores were transferred to new PDA plates to establish pure cultures and stored in 50% glycerol (v/v) at −80 °C. A negative control was obtained from anthracnose lesions from the crown of celery, subjected to the same isolation process, and included in the analyses.

2.2. DNA Extraction, PCR, and Sequencing

Genomic DNA of the 14 strains collected from the three sugarcane varieties CL85-1040 (n = 3), CP96-1252 (n = 6), and CP89-2143 (n = 4), and from the celery (n = 1), was extracted using 50 mg of fungal mycelia grown on PDA for 2 weeks at 23 °C under continuous fluorescent light. The DNA was extracted using the SYNERGY™ 2.0 DNA Extraction Kit (OPS Diagnostics, Lebanon, NJ, USA), following the manufacturer’s instructions. The total DNA obtained was eluted in 50 µL of Monarch® DNA Elution Buffer (New England Biolabs, Ipswich, MA, USA). The final DNA concentration was measured using a NanoDropTM2000/2000c Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Primers used in the study were synthesized by Integrated DNA Technologies (IDT®, Coralville, IA, USA) (Table 1). Polymerase chain reaction (PCR) was performed in a 25 µL reaction volume containing 1 µL of DNA (25 ng/µL), 12.5 µL o1f GoTaq® Green Master Mix Kit (PROMEGA, Madison, WI, USA), and 11.5 µL of water. The cycling conditions were initial denaturation at 95 °C for 4 min, followed by 35 cycles of denaturation at 95 °C for 45 s; annealing at 51 °C, 59 °C, 56 °C, 58 °C, and 59 °C for ITS, ACT, TUB2, GAPDH, and CHS-1, respectively, for 45 s; extension at 72 °C for 59 s; and a final extension at 72 °C for 10 min. Following PCR amplification, the resulting DNA products were visualized on a 1% agarose gel stained with SYBR Safe (Thermo Fisher Scientific, Waltham, MA, USA). The amplified DNA was purified before Sanger sequencing on the ABI 3730XL sequencer at Molecular Cloning Laboratories (MCLAB, South San Franciso, CA, USA).

2.3. Phylogenetic Analyses

In addition to the 14 strains obtained in this study, 18 reference sequences were retrieved from NCBI GenBank, totaling 32 strains used in the phylogenetic analyses (Table 2). Raw DNA sequences from the 14 strains were manually annotated for each of the five gene regions (ITS, ACT, TUB2, GAPDH, and CHS-1) to ensure the accuracy and high quality of the final consensus sequences before performing a BLAST search and aligning them using Geneious Prime 6.0.6. The sequence alignment was performed with MAFFT v. 7.407_1, and the most conserved regions were filtered by Gblocks v. 0.91.1 integrated within NGPhylogeny.fr [39,40,41]. Phylogenetic trees were constructed using both maximum likelihood (ML) estimated with MEGA v.11 [42] and the Bayesian inference (BI) performed with MrBayes v. 3.2.6. For the ML analysis, the best-fit models K2 + G + I (ITS), K2 + I (ACT), K2 + G (TUB2, GAPDH and CHS-1), and TN93 + G (concatenated tree) were selected based on the Bayesian information criterion (BIC), with 1000 bootstrap replicates [43]. The BI analysis employed SYM + I + G (ITS), HKY + I (ACT), HKY + G (TUB2, GAPDH), and GTR + G (CHS-1) substitution models based on the Akaike information criterion (AIC) and utilized a Markov Chain Monte Carlo (MCMC) search with 5,000,000 generations, sampling trees every 100 generations [44]. The phylogenetic trees of the individual and concatenated genes were developed using iTOL (https://itol.embl.de/, accessed on 23 October 2024). Colletotrichum boninense was used as the outgroup. All the sequences resulting from this study of Colletotrichum spp. from sugarcane (n = 13) and one from celery (n = 1) were deposited in GenBank (https://www.ncbi.nlm.nih.gov/genbank/, accessed on 23 October 2024) under the following accession numbers: PP782092 to PP782105 (ITS), PP855401 to PP855414 (ACT), PQ349366 to PQ349379 (TUB2), PQ349380 to PQ349393 (GAPDH), and PQ349352 to PQ349365 (CHS-1) (Table 2).

2.4. Fungal Inoculum

Colletotrichum strains were grown on PDA at 23 °C under continuous fluorescent light for 2 weeks. The spores were scraped using a sterilized mini pestle in SDW and filtered in a double layer of cotton gauze [56,57]. The spore suspension was centrifuged three times at 3500× g, 25 °C for 5 min, and the SDW was changed between the centrifugation cycles [56,57]. A spore concentration was adjusted to 105 spores/mL and immediately used for both leaf sheath assays and seedling spray inoculations [56,57].

2.5. Sugarcane Plants

Single-eye pieces were obtained from sugarcane stalks (CL85-1040, CP96-1252, and CP89-2143) and planted 2 cm apart in a rectangular tray (40 × 50 cm) filled with a potting mixture (Professional Growing mix, Sun Gro Horticulture, Agawam, MA, USA). One-week-old seedlings were transferred to pots (21 × 22 cm) filled with a potting mixture for the whole-seedling spray inoculation experiment. The variety CL85-1040 used in the leaf sheath assay was kept in the trays, and 1-month-old seedlings were cut at the soil line and brought to the laboratory for the leaf sheath assay. Osmocote fertilizer (14-14-14) (ICL growing solutions, Tel Aviv, Israel) was added 1 week after planting the seed eyes and seedlings. The plants were kept in the greenhouse at ambient temperature, under 1 min irrigation twice a day, and then they were used to set up the whole plant or the leaf sheath experiments.

2.6. Leaf Sheath Colonization Assay

The colonization of C. falcatum on the cellular level was investigated using the most susceptible variety, CL85-1040, and the most virulent strain, KX144, in a time-course experiment. Detached sugarcane leaf sheaths were collected and prepared according to Belisário et al. [57] with modifications. Briefly, the leaf sheaths were inoculated with 100 μL of KX144 spore suspension (105 spores/mL) and incubated at 21 ± 1 °C under continuous fluorescent light in 100% humidity. For negative controls, we used two treatments: (1) inoculation with the non-pathogenic Colletotrichum theobromicola isolate KX164, originally isolated from celery, and (2) inoculation with SDW. Treatments were arranged in a completely randomized design with four replicates. The evaluation was performed at 12, 24, 36, 48, 60, 72, and 146 h after inoculation (hai). A total of 50 infection sites per repetition were evaluated randomly using the Leica ICC50 E microscope (Leica Microsystems, Leica, Wetzlar, Germany) and visualized using Leica Application Suite LAS EZ v. 3.4.0 software, following the diagrammatic scale developed by Xavier et al. [56].

2.7. Pathogenicity Tests

2.7.1. Leaf Sheath Pathogenicity Assay

One fungal strain from each variety (KX144, KX145, and KX146 from CL85-1040, CP96-1252, and CP89-2143, respectively) was selected for the leaf sheath pathogenicity assay to inoculate on the ‘CL85-1040’. Additionally, KX164 (negative control) was included. All the plants were inoculated with a spore suspension of 105 spores/mL. Inoculation with SDW was used as a control. The evaluation was performed at 60 hai based on 50 infection sites per repetition under the light microscope based on the scale developed by Xavier et al. [56] with modifications. Briefly, it was performed in two different ways: (i) attending to how the pathogen was colonizing the plant cells, and (ii) attending to how the plant was responding against the pathogen by restricting its growth to one cell or by the presence of red vesicles at the infection sites.

2.7.2. Whole-Seedling Spray Inoculation

The pathogenicity of the strains (KX144, KX145, and KX146) from the local sugarcane varieties (CL85-1040, CP96-1252, and CP89-2143, respectively) was assessed by spray-inoculating each variety with a spore suspension of 105 spores/mL in 1% (v/v) Tween 20. The strain KX164 from celery and Tween 20 were used as the negative control. After spray inoculation, the plants were bagged with a clear bag and maintained in a 100% humidity chamber for 48 h. After that, the bags were removed, and the plants were kept on the greenhouse benches, where they were irrigated twice a day at 7 am and 7 pm for 1 min each time. Treatments were arranged in a completely randomized block design with four replicates and two plants per pot per replicate. Disease severity was evaluated weekly after disease symptoms were observed, and re-isolation was performed after the last assessment to fulfill Koch’s postulate. The experiment was performed three times (October and November 2023 and February 2024).

2.7.3. Statistical Analysis

Statistical analyses were performed in R version 4.3.2 [58]. The two repetitions of the leaf sheath virulence experiment were analyzed through a cumulative logistic mixed model (CLMM) using the clmm function of the ‘ordinal’ package v. 4.1 [59]. This approach appropriately models ordinal data [60,61]. Experiments, fungi, and their interaction were treated as fixed effects, and replicates within experiments were treated as random effects. In both pathogenicity tests’ statistical analyses ((whole-seedling spray inoculation and leaf sheath pathogenicity assay), the means and 95% confidence intervals of each group were estimated using the emmeans function of the ‘emmeans’ package v. 1.10.4 [62]. Statistically significant pairwise differences (p < 0.05 following Tukey’s adjustment) were visualized using a compact letter display via the cld function of the ‘multcomp’ package v. 1.4.26 [63]. All graphs were created using functions from the ‘tidyverse’ package v. 2.0.0 [64] and ‘ggplot2’ package v. 3.5.1 [65].
The AUDPC values resultant from the three repetitions of the whole-seedling spray inoculation experiment were analyzed through generalized linear mixed models (GLMMs) using the function glmmTMB of the ‘glmmTMB’ package v. 1.1.9 [66]. A Tweedie distribution with a log link function was employed to account for zero-inflated data due to negative controls. Variety, fungal strain, and their interaction were included as fixed effects, while experiment and experimental unit were included as random effects. Model fit was assessed via plotting the simulated quantile residuals using the simulateResiduals function from the ‘DHARMa’ package v. 0.4.6 [67]. Those figures and comparisons by Akaike’s information criteria (AIC) subsequently confirmed that model fit was improved by modeling dispersion as varying among the different strains. A Wald χ2 test was then performed, followed by the calculation of estimated marginal means, 95% confidence intervals, and pairwise comparisons (using Tukey’s adjustment) among fungal strains within each variety, and for each variety averaged across all strains.

3. Results

3.1. Colletotrichum spp. in Southern Florida

Red rot was observed on local sugarcane varieties during the summers of 2022 and 2023, at the Everglades Research and Education Center, University of Florida, in Belle Glade, Florida. The average disease incidence in the field was approximately 60–80%on varieties not treated with pesticides. Symptoms of red rot included reddish lesions on the midrib, with a pale center in which the pathogen sporulated, producing black dots corresponding to acervuli when visualized at higher magnification. Thirteen isolates collected from three sugarcane varieties [CL85-1040 (n = 3), CP96-1252 (n = 6), and CP89-2143 (n = 4)] were identified as Colletotrichum spp. based on morphological traits such as the presence of acervuli with setae, banana-shaped spores, and gray mycelium with orange sporulation on PDA media.

3.2. Molecular Characterization

The final alignment of the concatenated gene sequences contained a total of 1568 bp (Figure 1) (ITS: 412 bp; ACT: 277 bp, TUB2: 497 bp, GAPDH: 121 bp, CHS-1: 261 bp), which were utilized in the phylogenetic analyses, considering alignment gaps and missing data from incomplete genes, representing 507 phylogenetically informative site patterns (ITS: 76, ACT: 121, TUB2: 200, GAPDH: 56, CHS-1: 54) (Figures S1–S5). Based on the concatenated alignment, our sugarcane strains from Florida had 99.8% similarity with the C. falcatum isolate from sugarcane CML4075 in Brazil [16]. Furthermore, the concatenated phylogenetic tree revealed that all 13 sugarcane strains from Florida clustered within the Colletotrichum falcatum clade alongside reference isolates of this species, confirming their species identification. All 13 strains had identical ITS, ACT, TUB2, GAPDH, and CHS-1 sequences, except for KX145, KX146, KX652, and KX661, which exhibited a single nucleotide polymorphism at the same position in the GAPDH gene.

3.3. Leaf Sheath Development Assay

At the earliest time point (12 hai), pathogen spores germinated, formed appressoria (Figure 2a and Figure 3a), and infected the host cells. In some instances, primary thick hyphae were already forming (Figure 2b and Figure 3a), indicating the start of biotrophic infection and colonization. By 24 hai, the pathogen had extended its colonization to two cells (Figure 2c and Figure 3b), and at 36 hai, it had spread to three or more cells (Figure 2d and Figure 3c). The formation of the thin secondary hyphae developing from primary thick hyphae was observed at 36 hai (Figure 2e,f and Figure 3c), marking the transition from biotrophic to necrotrophic infection. From 48 to 72 hai, extensive colonization by both thick and thin hyphae was evident across multiple host cells (Figure 2g and Figure 3d). Remarkably, by 146 hai (or 6 days after inoculation), the pathogen had completed its life cycle, with the formation of acervuli, from which conidia were formed and released (Figure 2h and Figure 3e,f).

3.4. Pathogenicity Tests

3.4.1. Leaf Sheath Pathogenicity Assay

The leaf sheath time-course assay described above revealed that colonization beyond two host cells would lead to compatible interaction. Furthermore, no significant differences were observed between 48, 60, and 72 hai. Therefore, the virulence of strains KX144, KX145, and KX146 on the variety CL85-1040 was assessed at 60 hai. In addition, the assessment of plant responses revealed distinct infection sites characterized by hyphae constricted within a single cell (Figure 4a). Additionally, some sites were observed to be surrounded by red vesicles, indicating active defense mechanisms at play (Figure 4b).
There were no significant differences between the two experimental replications (p = 0.7247), allowing the data to be combined for further analysis. Our results indicated that strain KX144 exhibited the greatest virulence, with a higher capacity to colonize more than two cells (p < 0.0001) (Figure 5). Correspondingly, this strain triggered the lowest observed plant response. Conversely, the negative control (KX164) caused the strongest plant response. Strains KX145 and KX146 demonstrated similar behavior and were not statistically different from each other, suggesting a lower level of virulence compared to KX144 (Figure 5).

3.4.2. Whole-Seedling Spray Inoculation

The pathogenicity of Florida Colletotrichum falcatum strains was evaluated in sugarcane whole seedlings in the greenhouse. The first symptoms of red rot, characterized as small reddish lesions, were observed on the midrib and leaf blade at 48 hai, when the plants were removed from the humidity chambers. Overall, the symptoms gradually increase in size, forming pale necrotic lesions in the center, where black dots (acervuli) first appeared at 4, 5, and 7 days in experiments 1, 2, and 3, respectively, indicating that the pathogen can complete its life cycle as early as 4 days after inoculation (Figure 6). However, there were some specific symptoms that were characteristic among the isolates regardless of the sugarcane variety inoculated. Isolate KX144 caused oval-shaped lesions with a light pale center surrounded by dark red to brown borders on lesions found both on the leaf blade and midrib (Figure 6a). Plants inoculated with isolate KX146 displayed round lesions, red to orange, with a pale center primarily on the midrib (Figure 6c), whereas isolate KX145 induced the formation of fine, elongated reddish lesions mainly on the leaf blade of newly developed leaves (Figure 6b).
In summary, all three strains, KX144 from CL85-1040, KX145 from CP96-1252, and KX146 from CP89-2143, exhibited pathogenicity on all the sugarcane varieties tested in this study. Re-isolations from symptomatic leaves confirmed that red rot was caused by the inoculated strains. No pathogen was recovered from the control treatments. The presence of banana-shaped conidia (Figure 6d–f) in the re-isolated cultures fulfilled Koch’s postulate.
The GLMM indicated that the Area Under Disease Progress Curve (AUDPC) was significantly affected by fungi (p < 0.0001) and fungi–variety interaction (p = 0.0014). Based on the AUDPC, strain KX144 isolated from variety CL85-1040 was the most virulent among the fungi tested. The exception was on the variety CP89-2143, in which there was no statistical difference among the evaluated strains. The strains KX145 and KX146 showed similar virulence among the varieties. The negative control KX164 was not significantly different from plants sprayed with water (Tween 1%).(Figure 7).
To assess resistance levels among the three sugarcane varieties, the AUDPC values were calculated for each variety based on the combined disease severity caused by all three strains (KX144, KX145, and KX146). Varieties CP96-1252 and CP89-2143 exhibited significantly lower AUDPC values compared to variety CL85-1040, indicating greater resistance to red rot (Figure 8).

4. Discussion

This study presents the first comprehensive characterization of Colletotrichum falcatum as the causative agent of red rot on sugarcane in southern Florida. Recent observations at the Everglades Research and Education Center in Belle Glade, Florida, have revealed a concerning incidence of red rot, with infection rates ranging from 60% to 80% during the summer months across local sugarcane varieties. Similar red rot outbreaks have also been reported in other major sugarcane-producing regions, such as India [30], suggesting the global relevance of this disease. Although red rot has been present in Florida for several years, its economic impact on sugarcane yields has remained minimal, especially when compared to other tropical regions like Brazil, where the disease has caused yield losses of up to 24.2% [68]. A key factor that may play a role in mitigating the impact of red rot in Florida is the pre-harvest practice of burning fields, which likely reduces pathogen inoculum by eliminating crop debris between seasons.
This study collected 13 Colletotrichum isolates for molecular and pathological characterization, addressing the lack of detailed data on Colletotrichum in the region. Multilocus molecular phylogenetic analysis revealed that all 13 isolates from symptomatic sugarcane leaves clustered within the Colletotrichum falcatum clade. This identification was supported by using key genetic markers—ITS, TUB2, ACT, GAPDH, and CHS-1—based on the established methodologies from earlier studies in the Colletotrichum graminicola complex [69,70]). Notably, at least two of these markers have also been employed in recent studies of C. falcatum from Pakistan, Bangladesh, and Brazil [8,16,71]. These findings highlight the reliability of these genetic markers in accurately identifying, assessing the genetic diversity of, and determining the evolutionary relationships within C. falcatum populations across different regions.
While most previous studies have focused on the stalk phase of red rot [22,28,29], the present study is the first to target the foliar phase of the fungal life cycle. The leaf sheath assays provide a unique view into the cellular interaction between pathogens and hosts, as seen in the Colletotrichum sublineola–sweet sorghum [56] and Colletotrichum graminicola–maize [57] pathosystems. We monitored the C. falcatum life cycle within sugarcane living tissue at seven time points and developed the red rot disease cycle from spore germination to pathogen sporulation. Our observations on the strain KX144 align with the established hemibiotrophic nature seen in other Colletotrichum species [32]. Initially, this fungus colonizes as a biotroph, acquiring nutrients from living host cells before switching to a necrotrophic phase, where it feeds on dead tissues [32]. Spores of C. falcatum germinate and form primary hyphae at 12 hai (Figure 2b and Figure 3a). This primary hypha is similar to haustoria in biotrophic pathogens [72], likely facilitating nutrient acquisition and the secretion of effector molecules into the host cell cytoplasm, promoting infection and/or inducing a plant response during the initial biotrophic phase [72,73]. By 24 hai, we observed colonization of up to two plant cells (Figure 2c and Figure 3b). This finding aligns with Xavier et al. [56], who proposed this threshold to separate compatible (≥2 colonized cells) from incompatible (restricted to one cell) interactions in their study of C. sublineola on sorghum plants. The transition from biotrophy to necrotrophy for strain KX144 was observed at 36 hai, marked by the development of secondary hyphae (Figure 2e,f and Figure 3c). Notably, the complete C. falcatum life cycle, including acervuli formation (conidia-bearing structures), was achieved within 146 hai (6 days) (Figure 2h and Figure 3e,f). These findings from the leaf sheath assay mirrored those observed from whole-seedling inoculations, where the life cycle was completed within 4 to 7 days. Colletotrichum falcatum manifests a significant impact on the sugarcane stalks in what is known as the stalk phase. Previous research indicates that C. falcatum spores can infect the stalk through wounds or runoff from the midrib, initiating colonization of the internal tissues (Figure 3e) [28]. As symptoms of red rot become visible in the stalks (Figure 3f), the disease may ultimately lead to stalk collapse (Figure 3g). Spores produced on the leaves, midrib, and stalks can overwinter on crop debris, contributing to the disease cycle by allowing falcate spores to be released by rain splashes and disseminated by wind to healthy plants in the same season or by surviving in crop debris to become a source of inoculum in subsequent seasons (Figure 3h) [28,68]. Understanding the complete disease is crucial for developing a management strategy that addresses both foliar and stalk impacts on sugarcane.
We reconstructed the key events of the C. falcatum foliar life cycle in sugarcane by systematically analyzing 50 infection sites per repetition. It is crucial to note that multiple infection processes often occur simultaneously, sometimes within the same leaf sheath. In some instances, plant cells exhibited strong responses to pathogen infection, while in others, the pathogen colonized several plant cells, as demonstrated in the virulence assay. This study significantly advances our understanding of C. falcatum’s foliar life cycle and pathogenicity in sugarcane. By employing the leaf sheath assay, we were able to identify key stages of infection in real time, capturing details of both the biotrophic and necrotrophic phases. This approach offers advantages over previous studies using GFP-tagged C. falcatum to explore host–pathogen interactions [74] as our method uses intact leaf sheaths, which minimizes biases introduced by the artificial injuries required in GFP assays. Furthermore, our study allowed us to observe the natural behavior of C. falcatum and host cells, providing a clearer view of their interactions.
To better understand the responses of sugarcane plants against Colletotrichum, we used a C. theobromicola isolate (KX164) from celery, which is non-pathogenic to sugarcane. These responses included hyphae confinement or red vesicle formation (Figure 4), serving as a marker for virulence assessment at the cellular level. Microscopic observations from the leaf sheath assay and macroscopic symptom development in the greenhouse experiments consistently demonstrated that strain KX144 exhibited the highest virulence (Figure 5 and Figure 7). It successfully colonized multiple cells and caused the most severe symptoms (oval lesions with dark borders) on the susceptible sugarcane variety CL85-1040. Conversely, stains KX145 and KX146 showed intermediate virulence, reflected in both their colonization ability and the disease they induced (Figure 5). Notably, all three strains exhibited distinct disease symptom profiles when inoculated on their original hosts or alternative sugarcane varieties (Figure 6), highlighting potential strain-specific interactions and the influence of host genotype on disease development. This specificity in C. falcatum has been associated with the breakdown of varieties due to the emergence of new pathotypes [25,26,75]. It could be attributed to many factors, such as host origin, adaptation to the host, environmental conditions [25], and different production of hydrolytic enzymes [8,76]. Genetic diversity in the C. falcatum population manifests as distinct pathotypes [8,25], which can complicate disease management and breeding for resistance. While the limited scope of this study (sampling and variety testing) restricts definitive conclusions, the observed variation in virulence among the three C. falcatum strains suggests the potential presence of different races in Florida. Further investigation is required to definitively identify which resistant genes are involved that could potentially be different races in this pathogen population. Additionally, the varieties CP96-1252 and CP89-2143 demonstrated greater resistance compared to CL85-1040 (Figure 8). Given that red rot resistance is one of the criteria for varietal resistance for sugarcane commercial cultivation in other regions [77], future studies on the plant-host interaction mechanisms underlying this resistance could provide valuable insights for breeding if red rot becomes an epidemic in southern Florida in the future.
In conclusion, only one species of Colletotrichum, C. falcatum, was found to be associated with sugarcane in southern Florida. Therefore, it is essential to increase the survey area to represent the entire sugarcane growing area in the state, as well as other states. Additionally, it is important to investigate if there are different races within this pathogen population in Florida, as we observed a high degree of pathological diversity among the three evaluated strains when causing red rot under greenhouse conditions on local sugarcane varieties. This diversity can have significant implications for breeding programs. Furthermore, screening a wider range of sugarcane varieties for resistance is crucial to developing effective management strategies. Future research should also focus on fungicide resistance, increasing sample sizes for more comprehensive analysis, and exploring further resistance mechanisms in sugarcane varieties.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/jof10110742/s1. Figure S1: Maximum likelihood (ML) tree of 32 Colletotrichum spp. strains based on ITS region. The tree generated by Bayesian inference (BI) had a similar topology. Figure S2: Maximum likelihood (ML) tree of 32 Colletotrichum spp. strains based on ACT gene. The tree generated by Bayesian inference (BI) had a similar topology. Figure S3: Maximum likelihood (ML) tree of 29 Colletotrichum spp. strains based on TUB2 gene. The tree generated by Bayesian inference (BI) had a similar topology. Figure S4: Maximum likelihood (ML) tree of 26 Colletotrichum spp. strains based on GAPDH gene. The tree generated by Bayesian inference (BI) had a similar topology. Figure S5: Maximum likelihood (ML) tree of 27 Colletotrichum spp. strains based on CHS-1 gene. The tree generated by Bayesian inference (BI) had a similar topology.

Author Contributions

Conceptualization, K.V.X.; methodology, F.R.S., O.A. and K.V.X.; software, F.R.S. and L.C.F.; validation, F.R.S., L.C.F. and K.V.X.; formal analysis, F.R.S.; resources, K.V.X.; data curation, F.R.S., L.C.F. and K.V.X.; writing—original draft preparation, F.R.S.; writing—review and editing, M.L.V.d.R., L.C.F. and K.V.X.; supervision, K.V.X.; project administration, F.R.S. and K.V.X.; funding acquisition, K.V.X. All authors have read and agreed to the published version of the manuscript.

Funding

Funding was provided by UF IFAS 2022 Archer Early Career Seed Grant (Grant number 00132269).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article/Supplementary Materials; further inquiries can be directed to the corresponding author.

Acknowledgments

We acknowledge the Lab X members Vitor A. S. Moura, Alba Mayers, and Tarciso A. Ferreira Jr. for their assistance during the experiments. We also extend our thanks to Andre Gama and Simon Riley for their support in the statistical analysis.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. FAOSTAT Food and Agriculture Organization of the United Nations Statistics Division. Crops: Sugarcane. 2021. Available online: http://www.fao.org/faostat (accessed on 9 August 2023).
  2. Statista Sugar Industry. Industries & Markets. 2023. Available online: https://www.statista.com/study/12810/sugar-statista-dossier/ (accessed on 28 January 2024).
  3. USDA Crop Values 2021 Summary; United States Department of Agriculture (USDA): Washington, DC, USA, 2022; ISSN 1949-0372.
  4. Rajput, M.A.; Rajput, N.A.; Syed, R.N.; Lodhi, A.M.; Que, Y. Sugarcane Smut: Current Knowledge and the Way Forward for Management. J. Fungi 2021, 7, 1095. [Google Scholar] [CrossRef] [PubMed]
  5. Viswanathan, R.; Padmanaban, P.; Selvakumar, R. Emergence of New Pathogenic Variants in Colletotrichum falcatum, Stalk Infecting Ascomycete in Sugarcane: Role of Host Varieties. Sugar Tech 2020, 22, 473–484. [Google Scholar] [CrossRef]
  6. Sharma, N.; Gandhi, G.; Pooja; Suruchi; Chauhan, V. Sugarcane Diseases: An Overview. In Emerging Trends in Agriculture Sciences; Singh, Y.V., Ed.; Integrated Publications: New Delhi, India, 2022; Volume 7, pp. 89–103. [Google Scholar] [CrossRef]
  7. Shailbala, A.K.; Sharma, S. Management of Red Rot of Sugarcane Caused by Colletotrichum falcatum Went: A Review. Int. J. Chem. Stud. 2019, 7, 5029–5039. [Google Scholar]
  8. Hossain, M.I.; Ahmad, K.; Vadamalai, G.; Siddiqui, Y.; Saad, N.; Ahmed, O.H.; Hata, E.M.; Adzmi, F.; Rashed, O.; Rahman, M.Z.; et al. Phylogenetic Analysis and Genetic Diversity of Colletotrichum falcatum Isolates Causing Sugarcane Red Rot Disease in Bangladesh. Biology 2021, 10, 862. [Google Scholar] [CrossRef]
  9. Marins, É.F.C.; da Silva, M.J.d.S.; da Silva, J.L.; Silva-Cabral, J.R.A.; Costa, J.F.d.O.; Feijó, F.M.; Assunção, I.P.; Lima, G.S.d.A. Colletotrichum Species Associated with Sugarcane Red Rot in Brazil. Fungal Biol. 2022, 126, 290–299. [Google Scholar] [CrossRef]
  10. Suman, A.; Lal, S.; Shasany, A.K.; Gaur, A.; Singh, P. Molecular Assessment of Diversity among Pathotypes of Colletotrichum falcatum Prevalent in Sub-Tropical Indian Sugarcane. World J. Microbiol. Biotechnol. 2005, 21, 1135–1140. [Google Scholar] [CrossRef]
  11. Duttamajumder, S.K. Red Rot of Sugarcane; Indian Institute of Sugarcane Research: Lucknow, India, 2008.
  12. Sharma, G.; Singh, J.; Arya, A.; Sharma, S. Biology and Management of Sugarcane Red Rot: A Review. Plant Arch. 2017, 17, 775–784. [Google Scholar]
  13. Gujjar, R.S.; Kumar, R.; Goswami, S.K.; Singh, A.; Baidya, A. Colletotrichum falcatum Infection Influences the Abundance of Sucrose Transporters and Disease Resistant Proteins in Sugarcane Stalk. J. Plant Biochem. Biotechnol. 2024, 33, 367–373. [Google Scholar] [CrossRef]
  14. Minnatullah, M.; Kamat, D.N. Losses Due to Red Rot Pathogen in Cane Juice Quality. Int. J. Curr. Microbiol. Appl. Sci. 2018, 7, 13–16. [Google Scholar] [CrossRef]
  15. Viswanathan, R. Plant Disease: Red Rot of Sugarcane; Anmol Publications Pvt. Ltd.: New Delhi, India, 2010. [Google Scholar]
  16. Costa, M.M.; Silva, B.A.A.S.; Moreira, G.M.; Pfenning, L.H. Colletotrichum falcatum and Fusarium Species Induce Symptoms of Red Rot in Sugarcane in Brazil. Plant Pathol. 2021, 70, 1807–1818. [Google Scholar] [CrossRef]
  17. Alfieri, S.A., Jr.; Langdon, K.R.; Wehlburg, C.; Kimbroug, J.W. Index of Plant Diseases in Florida (Revised); Florida Department of Agriculture and Consumer Services: Division of Plant Industries: Gainesville, FL, USA, 1984; Volume 11, pp. 1–389.
  18. Malathi, P.R.; Viswanathan, R.; Ramesh Sundar, A.; Padmanaban, P.; Prakasam, N.; Mohanraj, D.; Jothi, R. Phylogenetic Analysis of Colletotrichum falcatum Isolates Causing Red Rot in Sugarcane. J. Sugarcane Res. 2011, 1, 69–74. [Google Scholar]
  19. Prittesh, P.; Amaresan, N.; Rushabh, S.; Krishnamurthy, R.; Bhasker, V.V. Isolation and Pathogenic Variability of Colletotrichum falcatum Causing Red Rot in Sugarcane. J. Plant Dis. Prot. 2016, 123, 273–277. [Google Scholar] [CrossRef]
  20. Edgerton, C.W. Colletotrichum falcatum in the United States. Science 1910, 31, 717–718. [Google Scholar] [CrossRef] [PubMed]
  21. Carvajal, F. The Perfect Stage of Colletotrichum falcatum. Ph.D. Thesis, LSU Historical Dissertations and Theses, Louisiana State University, Baton Rouge, LA, USA, 1943. [Google Scholar] [CrossRef]
  22. Hossain, M.I.; Ahmad, K.; Siddiqui, Y.; Saad, N.; Rahman, Z.; Haruna, A.O.; Bejo, S.K. Current and Prospective Strategies on Detecting and Managing Colletotrichum falcatum Causing Red Rot of Sugarcane. Agronomy 2020, 10, 1253. [Google Scholar] [CrossRef]
  23. Phoulivong, S.; Cai, L.; Chen, H.; McKenzie, E.H.C.; Abdelsalam, K.; Chukeatirote, E.; Hyde, K.D. Colletotrichum gloeosporioides Is Not a Common Pathogen on Tropical Fruits. Fungal Divers. 2010, 44, 33–43. [Google Scholar] [CrossRef]
  24. Crouch, J.A.; Clarke, B.B.; White, J.F., Jr.; Hillman, B.I. Systematic Analysis of the Falcate-Spored Graminicolous Colletotrichum and a Description of Six New Species from Warm-Season Grasses. Mycologia 2009, 101, 717–732. [Google Scholar] [CrossRef]
  25. Viswanathan, R. Pathogen Virulence in Sugarcane Red Rot Pathogen Versus Varieties in Cultivation: Classical Case of Loss in Virulence in the Pathotype CF06 (Cf671). Sugar Tech 2017, 19, 293–299. [Google Scholar] [CrossRef]
  26. Viswanathan, R.; Selvakumar, R. Varietal Breakdown to Red Rot in Sugarcane Revealed by Comparing Two Colletotrichum falcatum Inoculation Methods. Sugar Tech 2020, 22, 1063–1075. [Google Scholar] [CrossRef]
  27. Viswanathan, R. Sustainable Sugarcane Cultivation in India Through Threats of Red Rot by Varietal Management. Sugar Tech 2021, 23, 239–253. [Google Scholar] [CrossRef]
  28. Viswanathan, R. Red Rot of Sugarcane (Colletotrichum falcatum Went). CABI Rev. 2021, 16, 57. [Google Scholar] [CrossRef]
  29. Verma, B.K.; Akhtar, O.; Singh, B. Status of Red Rot Disease: A Cancer of Sugarcane in Uttar Pradesh. Int. Res. J. Mod. Eng. Technol. Sci. 2024, 6, 2582–5208. [Google Scholar] [CrossRef]
  30. Viswanathan, R. Severe Red Rot Epidemics in Sugarcane in Sub-Tropical India: Role of Aerial Spread of the Pathogen. Sugar Tech 2023, 25, 1275–1277. [Google Scholar] [CrossRef]
  31. Prasanth, C.N.; Viswanathan, R.; Malathi, P.; Sundar, A.R. Comparative Transcriptome Analysis of Candidate Secretory Effector Proteins from Colletotrichum falcatum Infecting Sugarcane. Agri Gene 2019, 13, 100089. [Google Scholar] [CrossRef]
  32. Crouch, J.; O’Connell, R.; Gan, P.; Buiate, E.; Torres, M.F.; Beirn, L.; Shirasu, K.; Vaillancourt, L. The Genomics of Colletotrichum. In Genomics of Plant-Associated Fungi: Monocot Pathogens; Dean, R.A., Lichens-Park, A., Kole, C., Eds.; Springer: Berlin/Heidelberg, Germany, 2014; pp. 69–102. ISBN 9783662440568. [Google Scholar]
  33. Xavier, K.V.; Mizubuti, E.S.G.; Queiroz, M.V.; Chopra, S.; Vaillancourt, L. Genotypic and Pathogenic Diversity of Colletotrichum sublineola Isolates from Sorghum (Sorghum bicolor) and Johnsongrass (S. halepense) in the Southeastern United States. Plant Dis. 2018, 102, 2341–2351. [Google Scholar] [CrossRef]
  34. GARDES, M.; BRUNS, T. ITS Primers with Enhanced Specificity for Basidiomycetes—Application to the Identification of Mycorrhizae and Rusts. Mol. Ecol. 1993, 2, 113–118. [Google Scholar] [CrossRef]
  35. White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D., Sninsky, J.J., White, T.J., Eds.; Academic Press: Cambridge, MA, USA, 1990; pp. 315–322. [Google Scholar]
  36. Carbone, I.; Kohn, L.M. A Method for Designing Primer Sets for Speciation Studies in Filamentous Ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef]
  37. Wang, R.-Y.; Gao, B.; Li, X.-H.; Ma, J.; Chen, S.-L. First Report of Fusarium Solani Causing Fusarium Root Rot and Stem Canker on Storage Roots of Sweet Potato in China. Plant Dis. 2014, 98, 160. [Google Scholar] [CrossRef]
  38. Templeton, M.D.; Rikkerink, E.H.A.; Solon, S.L.; Crowhurst, R.N. Cloning and molecular characterization of the glyceraldehyde-3-phosphate dehydrogenase-encoding gene and cDNA from the plant pathogenic fungus Glomerella cingulata. Gene 1992, 122, 225–230. [Google Scholar] [CrossRef]
  39. Katoh, K.; Standley, D.M. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef]
  40. Lemoine, F.; Correia, D.; Lefort, V.; Doppelt-Azeroual, O.; Mareuil, F.; Cohen-Boulakia, S.; Gascuel, O. NGPhylogeny.Fr: New Generation Phylogenetic Services for Non-Specialists. Nucleic Acids Res. 2019, 47, W260–W265. [Google Scholar] [CrossRef]
  41. Talavera, G.; Castresana, J. Improvement of Phylogenies after Removing Divergent and Ambiguously Aligned Blocks from Protein Sequence Alignments. Syst. Biol. 2007, 56, 564–577. [Google Scholar] [CrossRef] [PubMed]
  42. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
  43. Nei, M.; Kumar, S. Molecular Evolution and Phylogenetics; Oxford University Press: New York, NY, USA, 2000; ISBN 9780195135848. [Google Scholar]
  44. Huelsenbeck, J.P.; Ronquist, F. MRBAYES: Bayesian Inference of Phylogenetic Trees. Bioinform. Apl. Note 2001, 17, 754–755. [Google Scholar] [CrossRef] [PubMed]
  45. Jiang, C.; Xu, Y.; Wei, Y.; Khan, M.T.; Wu, Y.; Li, H.; Chen, J.; Zhang, C.; Zeng, L.; Zhang, M. Occurrence and Field Evaluation of Promising Sugarcane Genotypes for Resistance to Midrib Red Rot Disease in China. Plant Pathol. 2024, 73, 1469–1479. [Google Scholar] [CrossRef]
  46. Prihastuti, H.; Cai, L.; Crouch, J.A.; Phoulivong, S.; Moslem, M.A.; McKenzie, E.H.C.; Hyde, K.D. Neotypification of Colletotrichum falcatum, the Causative Agent of Red-Rot Disease in Sugarcane. Sydowia 2010, 62, 283–293. [Google Scholar]
  47. Du, M.; Schardl, C.L.; Nuckles, E.M.; Vaillancourt, L.J. Using Mating-Type Gene Sequences for Improved Phylogenetic Resolution of Collectotrichum Species Complexes. Mycologia 2005, 97, 641–658. [Google Scholar] [CrossRef]
  48. O’Connell, R.J.; Thon, M.R.; Hacquard, S.; Amyotte, S.G.; Kleemann, J.; Torres, M.F.; Damm, U.; Buiate, E.A.; Epstein, L.; Alkan, N.; et al. Lifestyle Transitions in Plant Pathogenic Colletotrichum Fungi Deciphered by Genome and Transcriptome Analyses. Nat. Genet. 2012, 44, 1060–1065. [Google Scholar] [CrossRef]
  49. Alizadeh, A.; Javan-Nikkhah, M.; Nourmohammadi Nazarian, R.; Liu, F.; Zare, R.; Fotouhifar, K.B.; Stukenbrock, E.H.; Damm, U. New Species of Colletotrichum from Wild Poaceae and Cyperaceae Plants in Iran. Mycologia 2022, 114, 89–113. [Google Scholar] [CrossRef]
  50. Crouch, J.A.; Beirn, L.A.; Cortese, L.M.; Bonos, S.A.; Clarke, B.B. Anthracnose Disease of Switchgrass Caused by the Novel Fungal Species Colletotrichum navitas. Mycol. Res. 2009, 113, 1411–1421. [Google Scholar] [CrossRef]
  51. Crouch, J.A.; Tredway, L.P.; Clarke, B.B.; Hillman, B.I. Phylogenetic and Population Genetic Divergence Correspond with Habitat for the Pathogen Colletotrichum cereale and Allied Taxa across Diverse Grass Communities. Mol. Ecol. 2009, 18, 123–135. [Google Scholar] [CrossRef]
  52. Cannon, P.F.; Damm, U.; Johnston, P.R.; Weir, B.S. Colletotrichum—Current Status and Future Directions. Stud. Mycol. 2012, 73, 181–213. [Google Scholar] [CrossRef] [PubMed]
  53. Xu, L.; Xu, Z.; Liu, J.; Cui, H.; Long, J.; Xue, L.; Li, C. Identification, Pathogenicity, and Fungicide Sensitivity of Colletotrichum Species Associated with Anthracnose on Italian Ryegrass in Southwestern China. Plant Dis. 2024. [Google Scholar] [CrossRef] [PubMed]
  54. Weir, B.S.; Johnston, P.R.; Damm, U. The Colletotrichum gloeosporioides Species Complex. Stud. Mycol. 2012, 73, 115–180. [Google Scholar] [CrossRef] [PubMed]
  55. Damm, U.; Cannon, P.F.; Woudenberg, J.H.C.; Johnston, P.R.; Weir, B.S.; Tan, Y.P.; Shivas, R.G.; Crous, P.W. The Colletotrichum boninense Species Complex. Stud. Mycol. 2012, 73, 1–36. [Google Scholar] [CrossRef]
  56. Xavier, K.V.; Pfeiffer, T.; Parreira, D.F.; Chopra, S.; Vaillancourt, L. Aggressiveness of Colletotrichum sublineola Strains from Sorghum Bicolor and S. halepense to Sweet Sorghum Variety Sugar Drip, and Their Impact on Yield. Plant Dis. 2017, 101, 1578–1587. [Google Scholar] [CrossRef]
  57. Belisário, R.; Torres, M.F.; Buiate, E.A.S.; Xavier, K.V.; Nuckles, E.M.; Vaillancourt, L.J. Detached Maize Sheaths for Live-Cell Imaging of Infection by Fungal Foliar Maize Pathogens. J. Vis. Exp. 2023, 2023, e65755. [Google Scholar] [CrossRef]
  58. R Core Team R: A Language and Environment for Statistical Computing (4.3.2) [X86_64, Linux-Gnu]. R Foundation for Statistical Computing. 2023. Available online: https://www.R-project.org/ (accessed on 23 June 2024).
  59. Christensen R Ordinal—Regression Models for Ordinal Data. R Package Version 2023. Available online: https://CRAN.R-project.org/package=ordinal (accessed on 24 June 2024).
  60. Liddell, T.M.; Kruschke, J.K. Analyzing Ordinal Data with Metric Models: What Could Possibly Go Wrong? J. Exp. Soc. Psychol. 2018, 79, 328–348. [Google Scholar] [CrossRef]
  61. Taylor, J.E.; Rousselet, G.A.; Scheepers, C.; Sereno, S.C. Rating Norms Should Be Calculated from Cumulative Link Mixed Effects Models. Behav. Res. Methods 2023, 55, 2175–2196. [Google Scholar] [CrossRef]
  62. Lenth, R.V.; Bolker, B.; Buerkner, P.; Giné-Vázquez, I.; Herve, M.; Jung, M.; Love, J.; Miguez, F.; Piaskowski, J.; Riebl, H.; et al. Emmeans: Estimated Marginal Means, Aka Least-Squares Means. R Package Version 1.10.2. 2024. Available online: https://cran.r-project.org/web/packages/emmeans/index.html (accessed on 23 June 2024).
  63. Hothorn, T.; Bretz, F.; Westfall, P. Simultaneous Inference in General Parametric Models. Biom. J. 2008, 50, 346–363. [Google Scholar] [CrossRef]
  64. Wickham, H.; Averick, M.; Bryan, J.; Chang, W.; McGowan, L.; François, R.; Grolemund, G.; Hayes, A.; Henry, L.; Hester, J.; et al. Welcome to the Tidyverse. J. Open Source Softw. 2019, 4, 1686. [Google Scholar] [CrossRef]
  65. Wickham H Ggplot2: Elegant Graphics for Data Analysis; Springer: New York, NY, USA, 2016; Available online: https://ggplot2.tidyverse.org (accessed on 24 June 2024).
  66. Brooks, M.E.; Kristensen, K.; Van Benthem, K.J.; Magnusson, A.; Berg, C.W.; Nielsen, A.; Skaug, H.J.; Mächler, M.; Bolker, B.M. GlmmTMB Balances Speed and Flexibility Among Packages for Zero-Inflated Generalized Linear Mixed Modeling. R J. 2017, 9/2, 378–400. [Google Scholar] [CrossRef]
  67. Hartig, F. DHARMa: Residual Diagnostics for Hierarchical (Multi-Level/Mixed) Regression Models. R Package Version 0.4.6. 2021. Available online: http://florianhartig.github.io/DHARMa/ (accessed on 23 June 2024).
  68. Silva, T.C.; Moreira, S.I.; Felizardo, L.M.; Martins, R.M.; Suzuki, A.N.; Faria, G.A.; Montanari, R.; Ceresini, P.C. Dry Rot Caused by the Complex Colletotrichum falcatum and Thielaviopsis paradoxa Emerges as a Key Stalk Disorder in Newly Expanded Sugarcane Plantations from Northwestern São Paulo, Brazil. Agronomy 2023, 13, 2729. [Google Scholar] [CrossRef]
  69. dos Santos Vieira, W.A.; Bezerra, P.A.; da Silva, A.C.; Veloso, J.S.; Câmara, M.P.S.; Doyle, V.P. Optimal Markers for the Identification of Colletotrichum Species. Mol. Phylogenet. Evol. 2020, 143, 106694. [Google Scholar] [CrossRef]
  70. Liu, F.; Ma, Z.Y.; Hou, L.W.; Diao, Y.Z.; Wu, W.P.; Damm, U.; Song, S.; Cai, L. Updating Species Diversity of Colletotrichum, with a Phylogenomic Overview. Stud. Mycol. 2022, 101, 1–56. [Google Scholar] [CrossRef]
  71. Ahmad, Z.; Farooq, M.A.; Fatima, A.; Nisa, S.G.; Tabassum, S.; Ismat, B.; Waseem, S.; Iqbal, U.; Akbar, A.; Haroon, U.; et al. Molecular Diagnosis of Red Rot of Sugarcane in Pakistan and in vitro Control of Isolated Pathogen Using Rhizobacteria. Plant Prot. Sci. 2023, 59, 124–133. [Google Scholar] [CrossRef]
  72. Perfect, S.E.; Green, J.R. Infection Structures of Biotrophic and Hemibiotrophic Fungal Plant Pathogens. Mol. Plant Pathol. 2001, 2, 101–108. [Google Scholar] [CrossRef]
  73. Sharmar, N.; Gautam, A.K. Early Pathogenicity Events in Plant Pathogenic Fungi: A Comprehensive Review. Biol. Forum 2019, 11, 24–34. [Google Scholar]
  74. Nandakumar, M.; Malathi, P.; Sundar, A.R.; Viswanathan, R. Use of Green Fluorescent Protein Expressing Colletotrichum falcatum, the Red Rot Pathogen for Precise Host–Pathogen Interaction Studies in Sugarcane. Sugar Tech 2020, 22, 112–121. [Google Scholar] [CrossRef]
  75. Viswanathan, R. Degeneration in Sugarcane Varieties: Does the Sugar Industry Realize It? Sugar Tech 2024. [Google Scholar] [CrossRef]
  76. Prasanth, C.N.; Viswanathan, R.; Malathi, P.; Sundar, A.R. Carbohydrate Active Enzymes (CAZy) Regulate Cellulolytic and Pectinolytic Enzymes in Colletotrichum falcatum Causing Red Rot in Sugarcane. 3 Biotech 2022, 12, 48. [Google Scholar] [CrossRef]
  77. Viswanathan, R. Changing Scenario of Sugarcane Diseases in India Since Introduction of Hybrid Cane Varieties: Path Travelled for a Century. J. Sugarcane Res. 2018, 8, 1–35. [Google Scholar]
Figure 1. The consensus phylogenetic tree of 32 Colletotrichum species strains was generated based on maximum likelihood (ML) and Bayesian inference (BI) analyses of combined ITS, ACT, TUB2, GAPDH, and CHS-1 gene sequences. Bootstrap support values and Bayesian posterior probabilities (only values ≥ 70% and ≥ 0.9, respectively) are shown at the nodes. Isolates from this study are highlighted in bold, and ex-type cultures are marked with an asterisk. Colletotrichum boninense was used as the outgroup.
Figure 1. The consensus phylogenetic tree of 32 Colletotrichum species strains was generated based on maximum likelihood (ML) and Bayesian inference (BI) analyses of combined ITS, ACT, TUB2, GAPDH, and CHS-1 gene sequences. Bootstrap support values and Bayesian posterior probabilities (only values ≥ 70% and ≥ 0.9, respectively) are shown at the nodes. Isolates from this study are highlighted in bold, and ex-type cultures are marked with an asterisk. Colletotrichum boninense was used as the outgroup.
Jof 10 00742 g001
Figure 2. Time course of C. falcatum KX144 development in sugarcane leaf sheaths (CL85-1040). (a) Germinated spores with appressorium (black arrow) at 12 hai. (b) Primary hyphae (black arrow) in one cell at 12 hai. (c) Primary hyphae in two cells at 24 hai. (d) Primary hyphae in three or more cells at 36 hai. (eg) Secondary hyphae (black arrows) and shifting from biotrophic to necrotrophic phase at 36-48 hai. (h) Acervulus with setae (black arrow) at 146 hai.
Figure 2. Time course of C. falcatum KX144 development in sugarcane leaf sheaths (CL85-1040). (a) Germinated spores with appressorium (black arrow) at 12 hai. (b) Primary hyphae (black arrow) in one cell at 12 hai. (c) Primary hyphae in two cells at 24 hai. (d) Primary hyphae in three or more cells at 36 hai. (eg) Secondary hyphae (black arrows) and shifting from biotrophic to necrotrophic phase at 36-48 hai. (h) Acervulus with setae (black arrow) at 146 hai.
Jof 10 00742 g002
Figure 3. Scheme of red rot disease cycle on sugarcane: (af) Foliar phase: (a) Colletotrichum falcatum spore germinates, forms appressorium, and primary hyphae by 12 hai, (b) primary hyphae colonizes up to two cells by 24 hai, (c) thin secondary hyphae forms by 36 hai, (d) colonization of thick and thin hyphae continues to several cells from 48 to 72 hai, (e) first reddish lesions visible on the leaves at 48 hai, acervuli are produced around 146 hai. (eh) The stalk phase [28,68]: (e) Colletotrichum falcatum spores infect the stalk, initiating the colonization of internal tissues. (f) The symptoms of red rot in the stalks become visible, and (g) may lead to stalk collapse. During the secondary cycle, spores can be released by rain splashes and disseminated by wind to healthy plants in the same season or (h) survive in crop debris [68], becoming a source of inoculum in subsequent seasons [28]. Created with BioRender.com.
Figure 3. Scheme of red rot disease cycle on sugarcane: (af) Foliar phase: (a) Colletotrichum falcatum spore germinates, forms appressorium, and primary hyphae by 12 hai, (b) primary hyphae colonizes up to two cells by 24 hai, (c) thin secondary hyphae forms by 36 hai, (d) colonization of thick and thin hyphae continues to several cells from 48 to 72 hai, (e) first reddish lesions visible on the leaves at 48 hai, acervuli are produced around 146 hai. (eh) The stalk phase [28,68]: (e) Colletotrichum falcatum spores infect the stalk, initiating the colonization of internal tissues. (f) The symptoms of red rot in the stalks become visible, and (g) may lead to stalk collapse. During the secondary cycle, spores can be released by rain splashes and disseminated by wind to healthy plants in the same season or (h) survive in crop debris [68], becoming a source of inoculum in subsequent seasons [28]. Created with BioRender.com.
Jof 10 00742 g003
Figure 4. Plant responses to Colletotrichum infection in detached sugarcane leaf sheaths (CL85-1040) inoculated with strain KX164 from celery. (a) Primary hyphae (black arrows) in one cell. (b) Red vesicles around the infection site.
Figure 4. Plant responses to Colletotrichum infection in detached sugarcane leaf sheaths (CL85-1040) inoculated with strain KX164 from celery. (a) Primary hyphae (black arrows) in one cell. (b) Red vesicles around the infection site.
Jof 10 00742 g004
Figure 5. Plant response and pathogen colonization in sugarcane leaf sheaths (CL85-1040) at 60 hai. Different letters indicate significant differences (p < 0.05) based on the CLMM: uppercase letters for plant responses and lowercase letters for pathogen colonization.
Figure 5. Plant response and pathogen colonization in sugarcane leaf sheaths (CL85-1040) at 60 hai. Different letters indicate significant differences (p < 0.05) based on the CLMM: uppercase letters for plant responses and lowercase letters for pathogen colonization.
Jof 10 00742 g005
Figure 6. Symptoms of red rot in sugarcane varieties inoculated with their respective Colletotrichum falcatum strains: (a) KX144 on CL85-1040, (b) KX145 on CL96-1252, (c) KX146 on CL89-2143. Re-isolated banana-shaped conidia of each strain: (d) KX144, (e) KX145, (f) KX146.
Figure 6. Symptoms of red rot in sugarcane varieties inoculated with their respective Colletotrichum falcatum strains: (a) KX144 on CL85-1040, (b) KX145 on CL96-1252, (c) KX146 on CL89-2143. Re-isolated banana-shaped conidia of each strain: (d) KX144, (e) KX145, (f) KX146.
Jof 10 00742 g006
Figure 7. Area Under Disease Progress Curve (AUDPC) of three combined experiments. Different letters represent statistically different (p < 0.05) values calculated by the generalized linear mixed models (GLMMs).
Figure 7. Area Under Disease Progress Curve (AUDPC) of three combined experiments. Different letters represent statistically different (p < 0.05) values calculated by the generalized linear mixed models (GLMMs).
Jof 10 00742 g007
Figure 8. Area Under Disease Progress Curve (AUDPC) comparing sugarcane varieties, based on combined ratings for three Colletotrichum falcatum strains (KX144, KX145, and KX146). Different letters represent statistically different (p < 0.05) values determined by the generalized linear mixed models (GLMMs).
Figure 8. Area Under Disease Progress Curve (AUDPC) comparing sugarcane varieties, based on combined ratings for three Colletotrichum falcatum strains (KX144, KX145, and KX146). Different letters represent statistically different (p < 0.05) values determined by the generalized linear mixed models (GLMMs).
Jof 10 00742 g008
Table 1. Sequences, annealing temperature, and references of primers used to amplify ITS region and ACT, TUB2, GAPDH, and CHS-1 genes.
Table 1. Sequences, annealing temperature, and references of primers used to amplify ITS region and ACT, TUB2, GAPDH, and CHS-1 genes.
Locus 1PrimerSequence (5′-3′)Ta (°C) 2PS 3References
ITSITS1FCTTGGTCATTTAGAGGAAGTAA49.7429 bp[34]
ITS4TCCTCCGCTTATTATATGC52.1 [35]
ACTACT-512ATGTGCAAGGCCGGTTTCGC61.7252 bp[36]
ACT-783RTACGAGTCCTTCTGGCCCAT57.9 [36]
TUB2Bt1AACATGCGTGAGATTGTAAGT52.3750 bp[37]
Bt2ACCCTCAGTGTAGT GACCCTTGGC62.5 [37]
GAPDHGDF1GCCGTCAACGACCCCTTCATTGA61.7150 bp[38]
GDR1GGGTGGAGTCGTACTTGAGCATGT60.6 [38]
CHS-1CHS79FTGGGGCAAGGATGCTTGGAAGAAG61.7300 bp[36]
CHS354RTGGAAGAACCATCTGTGAGAGTTG56.6 [36]
1 ITS, internal transcribed spacer; ACT, actin; TUB2, β-tubulin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; CHS-1, Chitin synthase. 2 Ta, annealing temperature. 3 PS, product size; bp, base pair.
Table 2. Strains used in the molecular phylogenetic analyses.
Table 2. Strains used in the molecular phylogenetic analyses.
GenBank Accession Numbers
Strain 1SpeciesHost/SubstrateCollection Date 2CountryITSACTTUB2GAPDHCHS-1References
CML 3855C. falcatumSarccharum officinarum sp.N/ABrazilMW471107MW455488 [16]
CML 4075C. falcatumSarccharum officinarum sp.N/ABrazilMW471109MW455490 [16]
Cf2C. falcatumSarccharum officinarum sp.August-2022ChinaPP217423OR542861OR542897 [45]
LC885C. falcatumSarccharum officinarum sp.N/AChinaHM171677HM171665HM171680HM171671 [46]
Cf64-8C. falcatumSarccharum officinarum sp.N/AIndiaFJ002093FJ008099 FJ002020 [8]
CBS 147945 *C. falcatumSarccharum officinarum sp.N/AIndonesiaJQ005772JQ005835JQ005856 JQ005793[46]
CBS 130836 *C. gaminicolaZea maysN/AUSADQ003110JQ005830JQ005851MW740221JQ005788[47,48,49]
CBS 125086 *C. navitasPanicum virgatumN/AUSAGQ919067JQ005832JQ005853 JQ005790[48,50]
MAFF 511115 *C. nicholsoniiPaspalum dilatatumN/AJapanEU554126JQ005833JQ005854MW740226JQ005791[48,49,51] https://www.tandfonline.com/doi/full/10.1080/00275514.2021.2008765 accessed on 9 August 2023
CBS 131301 *C. sublineolaSorghum bicolorN/ABurkina FasoDQ003114JQ005834JQ005855MW740232JQ005792[32,47,49]
MAFF 305403 *C. paspaliPaspalum notatumN/AJapanEU554100JX519235JX519244MW740210JX519227[49,51,52]
CBS 129661 *C. eremochloaeEremochloa ophiuroidesN/AUSAJQ478447JX519236JX519245 JX519228[52]
MAFF 510857 *C. miscanthiMiscanthus sinensisN/AJapanEU554121JX519237JX519246MW740225JX519229[49,51,52]
MAFF 511155 *C. eleusinesEleusine indicaN/AJapanEU554131JX519234JX519243MW740217JX519226[49,51,52]
GZC46C. cerealeLolium multiflorumJune-2022ChinaOR976053OR995786OR995792OR995768OR995774[53]
MAFF 305460 *C. jacksoniiEchinochloa esculentaN/AJapanEU554108JX519233JX519241MW740224JX519224[49,51,52]
CBS 124945 *C. theobromicolaTheobroma cacaoN/APanamaJX010294JX009444JX010447JX010006JX009869.1[54]
CBS 123755 *C. boninenseCrinum asiaticum var.N/AJapanJQ005153JQ005501JQ005588JQ005240JQ005327[55]
KX144C. falcatumSarccharum officinarum sp./CL85-1040August-2022Florida, USAPP782093PP855401PQ349366PQ349380PQ349352First report in this study
KX652C. falcatumSarccharum officinarum sp./CL85-1040July-2023Florida, USAPP782096PP855404PQ349369PQ349383PQ349355First report in this study
KX653C. falcatumSarccharum officinarum sp./CL85-1040July-2023Florida, USAPP782097PP855405PQ349370PQ349384PQ349356First report in this study
KX145C. falcatumSarccharum officinarum sp./CP96-1252September-2022Florida, USAPP782094PP855402PQ349367PQ349381PQ349353First report in this study
KX657C. falcatumSarccharum officinarum sp./CP96-1252July-2023Florida, USAPP782101PP855408PQ349374PQ349388PQ349360First report in this study
KX658C. falcatumSarccharum officinarum sp./CP96-1252July-2023Florida, USAPP782102PP855409PQ349375PQ349389PQ349361First report in this study
KX659C. falcatumSarccharum officinarum sp./CP96-1252July-2023Florida, USAPP782103PP855410PQ349376PQ349390PQ349362First report in this study
KX661C. falcatumSarccharum officinarum sp./CP96-1252July-2023Florida, USAPP782104PP855411PQ349377PQ349391PQ349363First report in this study
KX662C. falcatumSarccharum officinarum sp./CP96-1252July-2023Florida, USAPP782105PP855412PQ349378PQ349392PQ349364First report in this study
KX146C. falcatumSarccharum officinarum sp./CP89-2143September-2022Florida, USAPP782095PP855403PQ349368PQ349382PQ349354First report in this study
KX654C. falcatumSarccharum officinarum sp./CP89-2143July-2023Florida, USAPP782098PP855406PQ349371PQ349385PQ349357First report in this study
KX655C. falcatumSarccharum officinarum sp./CP89-2143July-2023Florida, USAPP782099PP855407PQ349372PQ349386PQ349358First report in this study
KX656C. falcatumSarccharum officinarum sp./CP89-2143July-2023Florida, USAPP782100PP855413PQ349373PQ349387PQ349359First report in this study
KX164C. theobromicolaApium graveolensDecember-2022Florida, USAPP782092PP855414PQ349379PQ349393PQ349365First report in this study
1 *, ex-type cultures. 2 N/A, not available.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Silva, F.R.; Resende, M.L.V.d.; Ferreira, L.C.; Adesina, O.; Xavier, K.V. Molecular Characterization and Pathogenicity of Colletotrichum falcatum Causing Red Rot on Sugarcane in Southern Florida. J. Fungi 2024, 10, 742. https://doi.org/10.3390/jof10110742

AMA Style

Silva FR, Resende MLVd, Ferreira LC, Adesina O, Xavier KV. Molecular Characterization and Pathogenicity of Colletotrichum falcatum Causing Red Rot on Sugarcane in Southern Florida. Journal of Fungi. 2024; 10(11):742. https://doi.org/10.3390/jof10110742

Chicago/Turabian Style

Silva, Fernanda Rodrigues, Mário Lúcio V. de Resende, Larissa Carvalho Ferreira, Olamide Adesina, and Katia V. Xavier. 2024. "Molecular Characterization and Pathogenicity of Colletotrichum falcatum Causing Red Rot on Sugarcane in Southern Florida" Journal of Fungi 10, no. 11: 742. https://doi.org/10.3390/jof10110742

APA Style

Silva, F. R., Resende, M. L. V. d., Ferreira, L. C., Adesina, O., & Xavier, K. V. (2024). Molecular Characterization and Pathogenicity of Colletotrichum falcatum Causing Red Rot on Sugarcane in Southern Florida. Journal of Fungi, 10(11), 742. https://doi.org/10.3390/jof10110742

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop