Next Article in Journal
Phytochemical Composition and Bioactivities of Some Hydrophytes: Antioxidant, Antiparasitic, Antibacterial, and Anticancer Properties and Mechanisms
Next Article in Special Issue
Genetic Control of Effective Seedling Leaf Rust Resistance in Aegilops biuncialis Vis. Accessions from the VIR Collection
Previous Article in Journal
Sterility Mosaic Disease of Pigeonpea (Cajanus cajan (L.) Huth): Current Status, Disease Management Strategies, and Future Prospects
Previous Article in Special Issue
Genetic Dissection of Diverse Seed Coat Patterns in Cowpea through a Comprehensive GWAS Approach
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characterization of Genetic Variability of Common and Tartary Buckwheat Genotypes Using Microsatellite Markers

1
Institute of Biotechnology, Faculty of Biotechnology and Food Sciences, Slovak University of Agriculture in Nitra, Tr. A. Hlinku 2, 949 76 Nitra, Slovakia
2
Crop Science Department, Agricultural Institute of Slovenia, Hacquetocva Ulica 17, SI-1000 Ljubljana, Slovenia
*
Author to whom correspondence should be addressed.
Plants 2024, 13(15), 2147; https://doi.org/10.3390/plants13152147
Submission received: 3 July 2024 / Revised: 24 July 2024 / Accepted: 29 July 2024 / Published: 2 August 2024
(This article belongs to the Special Issue Genetic Diversity of Germplasm Resources in Cereals and Legumes)

Abstract

Buckwheat is a highly nutritional pseudocereal with antioxidant potential. The aim of this study was to analyze the genetic variability of 21 varieties of common buckwheat (Fagopyrum esculentum Moench.) and 14 varieties of Tartary buckwheat (Fagopyrum tataricum Gaertn.) using microsatellite markers. By analyzing 21 SSR markers, an average of 11.6 alleles per locus were amplified and an average PIC value of 0.711 was determined. We determined the heterozygous status of the individuals and variability in the set using the SSR analysis on the basis of expected heterozygosity (He, 0.477), observed heterozygosity (Ho, 0.675), Shannon’s index (I, 0.820), and fixation indices (FST, FIS, FIT). Based on the SSR analyses, the lower level of expected heterozygosity in the analyzed set of Tartary buckwheat genotypes was observed compared to common buckwheat. With the help of a hierarchical cluster analysis using the UPGMA algorithm, Structure analysis, and PCoA analysis for the SSR markers, we divided the buckwheat varieties in the dendrogram into two main clusters according to the species. The AMOVA analysis showed that genetic variability between the individuals prevails in the analyzed set. The SSR technique proved to be a suitable tool for the determination of intra- and inter-varietal genetic variability and for analysis of diversity.

1. Introduction

Buckwheat (Polygonaceae family, Fagopyrum genus) is a commonly consumed crop in arid and cold regions of the world [1]. Buckwheat is a minor food crop that is classified as a pseudocereal [2]. The Fagopyrum genus consists of 23 species, of which the most important and the most widespread are 2 diploid species (2n = 2x = 16): common buckwheat (Fagopyrum esculentum Moench) and Tartary buckwheat (Fagopyrum tataricum Gaertn.) [1]. Common buckwheat is characterized by a short growth period and high resistance to environmental stress [3]. Tartary buckwheat is cultivated as a minor and popular crop in southwestern and northern China [4]. The short growing season and resistance to cold climate and high altitudes allow buckwheat to be grown in temperate Eurasia [5]. Buckwheat is considered to be a smart food crop of the future [2]. Its cultivation is widespread in the northern hemisphere, mainly in Asia, Europe, and North America. China is one of the world’s leading producers. Buckwheat most probably originated from southwest China where it is still cultivated in mountainous areas [6,7].
A buckwheat grain is rich in carbohydrates, fiber, lipids, minerals, but also antioxidants [1,8]. The amount of protein (12%) and fat (3%) in buckwheat is very similar to wheat. Globulin (43.3%) is the most abundant protein fraction, followed by glutelin (22.7%), albumin (18.2%), and prolamin (0.8%) [1,9]. Both common and Tartary buckwheat can be characterized by a high content of crude fiber and tannin [10]. A buckwheat grain contains proteins with a balanced composition of essential amino acids (methionine, tryptophan, lysine, histidine), and is rich in beneficial flavonoids, which also allow us to use buckwheat in the production of cosmetic, medical, and pharmaceutical preparations mainly thanks to its antioxidant, anti-inflammatory, antimutagenic, and anticarcinogenic properties [1,11,12]. Rutin stands out as the most important flavonoid; the highest concentration has been determined in the dry matter of Tartary buckwheat [13,14]. Consumption of buckwheat is beneficial for lowering cholesterol levels, controlling hypertension, diabetes, and preventing colon cancer. Buckwheat flour does not contain gluten, it is therefore suitable for patients suffering from celiac disease [1,8]. Despite its many benefits, buckwheat seeds also contain potent allergens that can induce anaphylactic reactions in sensitive patients. The buckwheat storage proteins, such as 13 S globulin and 2S albumin, have been reported as the major allergens of buckwheat [15].
In the last decade, great progress has been made in improving the properties of buckwheat and functional foods from buckwheat [10]. Due to its high protein content, antioxidants, and excellent low-cultivation properties, research on the genetic diversity of buckwheat is in high demand. Buckwheat is cultivated as a minor crop. But since it has many beneficial properties, breeders are developing new varieties with better yields and more desirable traits [5]. Molecular breeding of buckwheat has been held back due to the lack of genomic resources [16]. Information on genetic diversity is essential for the breeders to study the evolution of buckwheat [17]. Genetic diversity plays a key role in the survival of any species [7].
Genetic studies of buckwheat using a diverse gene pool are necessary to ensure the nutrition of the world’s population. The strategy should be to breed local specific varieties in different regions of the world [2].
Microsatellite markers (SSRs) are highly polymorphic, stable, and codominant [18]. These SSR markers have been used in the analyses of many crops, such as durum wheat [19], bread wheat [18,20,21], triticale [22,23], rice [24], maize [25,26], castor [27], and others, to assess their genetic diversity, phylogenetic relationships, and population structures [17]. Analyses of buckwheat using SSR markers have been performed by [1,17,28,29,30,31,32,33,34,35,36]. Microsatellite markers are a very effective tool for analyzing the genetic diversity and population structure of buckwheat [17]. Genetic mapping and construction of genetic maps was performed using the newly developed SSR markers, which proved to be highly efficient and provided useful information for the study of diversity and molecular breeding of the species in the Fagopyrum genus [11]. An assessment of the genetic diversity of 63 buckwheat genotypes was conducted using the SSR and ISSR markers by Sabreena et al. [34] and it showed that both marker techniques are highly efficient and informative for the detection of polymorphism in selected buckwheat genotypes. A genome-wide screening to develop the SSR markers associated with agronomic traits and rutin content for 97 genetic resources of Tartary buckwheat was evaluated by Hou et al. [32] in their study. The SSR markers were also used to analyze the morphological and molecular characterization of 112 varieties of Tartary buckwheat from 29 populations by Song et al. [7]. The SSR markers were also shown to be highly effective in determining the genetic purity of the Darja buckwheat cultivar [36]. The polymorphism among 52 genotypes of common buckwheat (Fagopyrum esculentum) was studied using 15 SSRs and furthered the evaluation of used SSRs for transferability to other buckwheat species [1]. The phenotypic and genetic diversity analysis of a global collection of the 2 cultivated buckwheat species Fagopyrum esculentum and Fagopyrum tataricum (190 and 51 accessions, respectively) using 37 agro-morphological traits and 24 SSR markers was performed by Pipan et al. [35].
The aim of our work was to (1) reveal the SSR-based polymorphism in a selected set of genotypes of common and Tartary buckwheat using 21 SSR markers, (2) assess the inter- and intra-species genetic variability, and also the variety-specific relationships in a selected set of genotypes of common and Tartary buckwheat, and at the same time to (3) prove the effectiveness of the used SSR markers for the analysis of the buckwheat genotypes in the identification and selection of genotypes for applicability in MAS (marker-assisted selection) breeding.

2. Results

2.1. Genetic Variability Based on the Occurrence of Alleles and Frequency of the SSR Markers Used

The 21 SSR primer pairs were used to analyze 35 genotypes of buckwheat of which 21 genotypes were common buckwheat (Fagopyrum esculentum Moench) and 14 genotypes were Tartary buckwheat (Fagopyrum tataricum Gaertn.).
Altogether, 244 different alleles were obtained (Table 1). The number of alleles per locus ranged from 2 (TBP6) to 17 (SXAU089) with an average of 11.62 per locus. The number of effective alleles (Ne) was 2.326 on average. The length ranged from 126 bp to 478 bp. The average polymorphism of all loci was 82.720%.
The selected set of 21 SSR markers showed an average polymorphic information content (PIC) value of 0.711 (Table 1) that proved to be useful for differentiation of the analyzed genotypes of Fagopyrum esculentum Moench and Fagopyrum tataricum Gaertn. The PIC vales ranged from 0.007 (TBP6) to 0.851 (Fem1840). The Fem 1840 locus was determined as the most informative. For the Fem 1840 locus, the values of He 0.868, Ne 2.818 were determined. The marker index (MI) value that reflects its ability to differentiate the given genotypes using a selective marker was 0.711.
The observed heterozygosity (Ho) values ranged from 0.007 (TBP6 locus) to 0.986 (GB-FE-025, TBP5 loci), with an average value of 0.675. Compared to the observed heterozygosity, we obtained a lower average value of the expected heterozygosity (He) of 0.477. We did not notice a significant deviation from the Hardy–Weinberg equilibrium (HWE).
The Shannon index (I) values ranged from 0.011 (TBP 6 locus) to 1.093 (Ft3_572) in our analyzed set. The average value of I was 0.820 (Table 1), which indicates a relatively high diversity in the analyzed set of varieties of Fagopyrum esculentum Moench and Fagopyrum tataricum Gaertn.

2.2. Genetic Relationships in the Fagopyrum Species

Using the AMOVA analysis, 140 individuals from 35 populations revealed high molecular variation and significant genetic changes (p ≤ 0.01) across the populations and within the individuals (Table 2). A variation of 24% was found among the populations, with an estimated variance of 2.292, but no variance was found among the individuals. The highest variation of 76% was found within the individuals themselves, with an estimated variance of 7.086 (Table 2). An estimated variance of 9.378 was observed among and within the individuals of the populations studied. Based on the molecular variance observed, the fixation indices Fst of 0.294, Fis of −0.289, and Fit of 0.091 were observed among the populations based on their genetic content.
The results also showed that the selected species of common buckwheat and Tartary buckwheat are sufficiently diverse and the markers used are a suitable tool to differentiate the genotypes. This is evidenced by the lower demonstrated genetic variability within the species (46%) compared to the genetic variability between the species (56%), which we determined based on the AMOVA analysis.
The correlation indices based on allele frequency, locus by locus, include a set of parameters Fis, Fit, Fst (Table 2). The average inbreeding coefficient (Fis = −0.380) was negative, indicating that individuals from the set of genotypes are heterozygous.
The genetic diversity (Fst) values ranged from 0.122 (TBP6) to 0.498 (SXAU129) with an average value of 0.343 (Table 2). A moderate genetic diversity (Fst) value indicates moderate genetic differentiation. The mean value of excess heterozygotes (Fit) was 0.078.

2.3. Population Structure and Genetic Diversity Analysis between Fagopyrum Species

Using the Structure analysis, we were able to detect variability within a group of 35 genotypes using 21 SSR markers. Using all 35 genotypes, simulations were performed using Structure with K ranging from 1 to 10 and with 6 runs for K. The population groups in K were equal to two in this work (Figure 1 and Figure 2). As shown in the figure, the genotypes were divided into 2 groups: group I had 15 genotypes and group II had 20 genotypes. Based on the results obtained, we can assume the existence of genetic variability among the genotypes, which is an important aspect for studying the genetic diversity of the genotypes in question. The average determined genetic distance between the two clusters ranged from 0.464 (Cluster 1) to 0.688 (Cluster 2), with an average value of 0.576, which corresponded to the F statistics (Fst). The Fst values ranged from 0.125 (Cluster 1) to 0.453 (Cluster 2) with an average of 0.289.
A dendrogram was constructed using the UPGMA algorithm (Figure 3). The UPGMA dendrogram separated the genotypes of common and Tartary buckwheat into two main clusters (I, II). Twenty varieties of common buckwheat were separated in Cluster I. Cluster I was subsequently divided into two subclusters (Ia, Ib). In Subcluster Ia, the genotype Ballada (2) from Russia was separated from other common buckwheat genotypes. On the basis of Nei’s genetic distance coefficient, we evaluated the genotypes PI 481644 (22) and PI 481671 (23), both originating from Bhutan, as the genetically closest (0.038). The genotype Rana 60 (16) was separated from the common buckwheat genotypes and included in Cluster II where it was separated from the 14 genotypes of Tartary buckwheat. Cluster II was subsequently divided into two subgroups (IIa, IIb). A total of 12 out of 14 Tartary buckwheat genotypes clustered together, partly according to the country of origin. As the most genetically distant varieties within the interspecies analysis, we evaluated the common buckwheat variety Darina (5) from Slovenia and the Tartary buckwheat variety Weswod Ican (27) of unknown origin. For the mentioned varieties, we determined the genetic distance based on Nei’s coefficient of 1.668. The most diverse varieties could be used in breeding programs.
The PCoA analysis also showed that the genotypes of buckwheat were divided into two big groups and separated according to species. The Tartary buckwheat genotypes grouped in the red circle (quadrant 2, 3) and the genotypes of common buckwheat grouped in the blue circle (Figure 4). The common buckwheat variety Rana 60 (16) was assigned to the group of Tartary buckwheat genotypes (red circle).

2.4. Population Structure and Genetic Diversity Analysis within the Fagopyrum Species

Genetic diversity within the Fagopyrum esculentum Moench buckwheat species was also statistically evaluated. Four individuals from each variety were used in the analysis. The average value of the percentage representation of polymorphic loci was 92.29%. This indicates high genetic variability. The average determined value of the Shannon index (I) of 0.982 confirms the assumption of high genetic diversity in the analyzed set. The mean value of observed heterozygosity (Ho) (0.748) was slightly higher than the mean value of expected heterozygosity (He, 0.555). Based on the results it can be concluded that the set of buckwheat varieties is highly genetically diverse with a slight excess of heterozygous individuals (Table 3A).
By analyzing 21 varieties of common buckwheat, simulations were performed using the Structure 2.3.4 statistical software for K equal to 2 with 6 replicates. The buckwheat varieties were separated into two clusters (1, 2). Cluster 1 consists of 20 buckwheat varieties, and the Rana 60 (16) buckwheat variety was separated in Cluster 2 (Figure 5A).
The genetic distance between the two clusters varied from 0.683 (Cluster 2) to 0.712 (Cluster 1) with an average value of 0.698 (Table 3A), which corresponded to an F statistic (Fst) from 0.092 (Cluster 2) to 0.238 (Cluster 1) with an average of 0.165.
The results from the Structure analysis were also confirmed using the UPGMA algorithm. In the dendrogram constructed for the 21 varieties of Fagopyrum esculentum Moench (Figure 6A), the variety Rana 60 (16) was separated from the other varieties of common buckwheat genotypes and included into the group of Tartary buckwheat genotypes. The Ballada (2) variety was separated from other common buckwheat genotypes. Based on Nei’s coefficient (1.540), we identified the variety Emka (7) from Poland and Tohno Zairai (20) from Canada as the most genetically distant.
Genetic diversity was also statistically evaluated within the Fagopyrum tataricum Gaertn species in more detail using four individuals from each variety. The analyzed set of 14 varieties of Tartary buckwheat (Fagopyrum tataricum Gaertn.) showed a lower Shannon index value (0.578) compared to the value determined for the set of buckwheat varieties (0.982). We also recorded a lower average value of the percentage representation of polymorphic loci of 68.37%. We expected lower evaluated values of expected heterozygosity in the Tartary buckwheat varieties compared to common buckwheat due to the self-pollination of Tartary buckwheat. The observed that the heterozygosity value was higher than the expected heterozygosity value.
The analysis of 14 varieties of Tartary buckwheat was carried out using simulations using the Structure software for K equal to 2 with 6 repetitions. The number of clusters was two (1, 2). A total of 3 varieties of Tartary buckwheat originating from Bhutan (22, 23) and China (24) were grouped in Cluster I, while 11 varieties of Tartary buckwheat were grouped in Cluster II (Figure 5B). The average determined genetic distance between the clusters varied from 0.389 (Cluster 2) to 0.448 (Cluster 1) with an average value of 0.419 (Table 3B), which corresponded to the F statistic (Fst) from 0.062 (Cluster 1) to 0.291 (Cluster 2) with an average of 0.177.
Three varieties, PI 481644 (22), PI 481671 (23), and 903016 (24), which were separated into a separate cluster (Cluster I) based on the structural analysis, were also separated in the dendrogram constructed using the UPGMA algorithm (Figure 6B). Based on the Nei coefficient (0.367), we evaluated the variety named PI481644 (22) from Bhutan and the variety named Liuqiao-3 (32) from China as the most genetically distant. The most diverse varieties could be used in breeding programs.

3. Discussion

Research into the genetic diversity of buckwheat is currently needed to ensure the breeding of varieties with desirable traits with the aim to achieve the best possible traits in buckwheat, which is perceived as a functional crop of the future. The production of specific varieties of buckwheat with regard to its chemical composition and resistance to adverse environmental influences is a prerequisite to ensuring a sufficient quantity and quality of food.
The proper identification and characterization of genetic resources of plants is a key point in the breeding processes and for the maintenance of the genetic resources in the gene banks [37]. Molecular markers are the tool of choice to evaluate the genetic variability of genotypes and study their genetic relationships. Microsatellite markers are codominant, highly polymorphic, reproducible, and can be transferred among species. Each of the 21 SSR markers used was able to produce a different and polymorphic DNA. Altogether, 244 alleles were amplified. The results presented by authors [35] confirmed a high degree of polymorphism of the selected 24 SSR markers. Altogether, they detected 205 and 118 alleles in F. esculentum and F. tataricum, respectively. For the Fagopyrum esculentum accessions, the authors determined the maximum number of alleles (25) in the SXAU048 locus, while the lowest averaged allele values per locus were observed in the TBP6 locus (13.95). In our study, we also identified the TBP6 locus as the least polymorphic, determined by the lowest average number of alleles per locus (2). The authors [1] used 15 SSR markers to study polymorphism among 52 Fagopyrum esculentum genotypes. Of the 15 SSR markers, 14 were evaluated as polymorphic. They determined a total of 143 alleles in the set of genotypes of common buckwheat; most alleles were polymorphic with an average of 9 alleles per locus. By way of comparison, in our study we determined a slightly higher than average number of alleles per locus of 11.62 using 21 SSR markers. A lower average number of alleles (7.90 alleles per locus) was also obtained by Song et al. [17] and Grahić et al. [36] who determined an average of 7.1 alleles per locus. Lower average values of alleles were also reported by Ma et al. [31] who analyzed 41 populations of buckwheat using SSR markers and determined the average level of alleles of 5.90. Song et al. [7] also determined a slightly lower than average number of alleles (4.5) per locus.
The values of polymorphic information content (PIC) characterize the molecular markers in terms of variability and frequency of amplified alleles in the given populations, and thus represent the extent of the marker’s effectiveness in the determination of polymorphism. The PIC values calculated in our study ranged from 0.007 (TBP6) to 0.851 (Fem 1840) with an average PIC value of 0.711 per marker. The PIC values higher than 0.8 have been estimated using our data for the SXAU089, Ft2_2899, and Ft3_572 loci, and these results are in accordance with the results of [35]. The authors [35] identified the SXAU060 locus as the least polymorphic for Fagopyrum tataricum. Based on our data (PIC = 0.741; number of alleles = 12), we could conclude that the SXAU060 locus showed a high degree of polymorphism in the selected set of genotypes. The average PIC value (0.711) in our study was higher compared to the results presented by Bashir et al. [1] who achieved an average PIC value of 0.56. In the study of [1], the polymorphism information content (PIC) values for a set of common buckwheat genotypes ranged from 0.29 (primer GB-FE-054) to 0.92 (primer GB-FE-035). They evaluated GB-FE-035 (PIC = 0.92) as the most informative and highly effective SSR marker in the collection of common buckwheat genotypes, which was comparable to studies [17] and [34]. For the GB-FE-035 locus, we determined a lower average PIC value (0.679) in the set of common buckwheat and Tartary buckwheat genotypes. The GB-FE-035 locus marker also proved to be the most informative in analyzing the variability and population structure for 63 accessions of the Fagopyrum genus in the work of [34]. Using 15 SSR markers, Bashir et al. [1] also analyzed the transferability of selected SSR markers for a set of accessions of Tartary buckwheat (Fagopyrum tataricum). Out of 15 SSR primers, they determined 7 markers as evaluable. The total number of alleles was 136, with an average of 19 alleles per primer. The maximum number of alleles was determined for the Fem1322 (30) locus. The average PIC value per primer was 0.86. The Fem1322 locus was evaluated as the most polymorphic (PIC = 0.93). For the Fem 1322 locus, we determined a slightly lower PIC value (0.743) in the analyzed set of common buckwheat and Tartary buckwheat genotypes. The genetic diversity and agronomic traits of common buckwheat were analyzed by [28] using the AFLP and SSR markers. Five SSR markers showed a high degree of polymorphism. The authors determined an average PIC value of 0.84 and detected 203 alleles. The authors [28] reported the Fem1322 locus as the most informative. On the other hand, the authors determined the Fem1840 (PIC = 0.452) locus as the least informative. Based on our results, the Fem1840 locus was evaluated as the most informative and the most polymorphic (PIC = 0.851).
The authors of [28] determined the average expected heterozygosity (He) value as 0.819. In our study, we have achieved a comparatively lower value of He (0.477). Kishore et al. [38] analyzed the genetic diversity of 75 accessions of Fagopyrum tataricum using 15 SSR markers. The markers revealed high polymorphism (the average PIC = 0.93). The AMOVA showed that the genetic variability between 75 accessions of Fagopyrum tataricum was mainly between the populations (83.49%). On the contrary, in our set of the common buckwheat and Tartary buckwheat genotypes, the AMOVA analysis showed that the genetic variability in the analyzed set is most significantly influenced by the differences between the individuals (62%). Kishore et al. [38] reported the mean value of Shannon’s index (I) as 0.036, which is relatively lower than the I value determined in our study (0.820). It is important to note that the difference between the outcomes of the previously mentioned studies and our assessed data could be a consequence of using diverse genetic material or varying the amount of the SSR markers applied.
The dendrogram created on the basis of the SSR analyses in our study clearly separated the buckwheat species into two main clusters. Twenty common buckwheat varieties were separated into Cluster I. Fourteen Tartary buckwheat varieties were separated into Cluster II and the common buckwheat variety Rana 60 was assigned to this group as well. Based on the SSR and the other morphological characteristics of the seeds of the Rana 60 variety, such as seed shape, seed color, and seed size, we could include the Slovenian Fagopyrum esculentum Moench Rana 60 variety to the Fagopyrum tataricum Gaertn varieties. The variety Rana 60 also has the external morphological features of the plant, such as the shape of the leaves and thickness of the stem, which were comparable to the seeds and plants of the Tartary buckwheat varieties. The Structure analysis also confirmed our results of the UPGMA analysis. Different studies [1,35] showed that the SSR markers used are a suitable tool to differentiate between the Fagopyrum esculentum and Fagopyrum tataricum genotypes. Based on the SSR markers, the Fagopyrum esculentum and Fagopyrum tataricum species were also clearly separated into two groups in the work by Facho et al. [39], who analyzed the genetic material of buckwheat with 20 SSR markers. The hierarchical cluster analysis dendrogram divided the genotypes into three major clusters and found that the SSR and ISSR analyses were equally accurate in grouping the buckwheat genotypes according to their geographical origins [34]. In the study by [35], the SSR data also showed a clear genetic differentiation between common and Tartary buckwheat, confirming the cross incompatibility between the two species. However, within the species, the level of genetic diversity was not significantly different across the regions and the accessions were not geographically structured, indicating a weak genetic differentiation between the regions. The absence of such clustering suggests that a strong natural selection has been ongoing, resulting in continuous diversity.

4. Material and Methods

4.1. Biological Material

The genetic material analyzed in this study was obtained from the Gene Bank at the Research Institute of Plant Production in Piešťany, Slovakia and the Gene Bank at the Research Institute of Plant Production in Ruzyně, Prague, Czech Republic. The plant material analyzed (Table 4) consisted of 21 genotypes of common buckwheat (Fagopyrum esculentum Moench) and 14 genotypes of Tartary buckwheat (Fagopyrum tataricum Gaertn.). The genotypes of common buckwheat mostly originated from Austria (Bamby), Canada (Tohno Zairai), the Czech Republic (Pyra), France (La Harpe, St Jacut), Japan (Kasho-2), Poland (Emka, Hruszowska, Kora, Pulawska), Latvia (Aiva), Russia (Ballada, Bogatyr, Amurskaja FAG 29/79, Kazanska FAG 38/82), Slovakia (Špačinská 1), Slovenia (Darina, Darja, Rana 60, Siva), and the USA (Winsor Royal). The Tartary buckwheat genotypes were from Bhutan (PI 4816442, PI 4816712, 290, PI481661), China (Jianzui, Jinqiao-22, Liuqiao-32, Zhaoqiao-12), Mexico (PI 451723), Nepal (PI 427239), Pakistan (903016), and the USA (PI 476852, Sarasin a Ployes). The origin of the Weswod Ican genotype is unknown.

4.2. DNA Extraction of Plant Material

Genomic DNA was extracted from the young, healthy leaf tissue of four individual plants of each variety using the DNeasy Plant Pro Kit (Qiagen, Germantown, MD, USA). Homogenization was performed using the Retsch Tissue Lyser (Qiagen, USA). The DNA concentrations of each isolate were determined using a fluorimeter with the dsDNA Broad Range Assay Kit (Qubit 3.0; ThermoFisher Scientific, Waltham, MA, USA), with the DNA diluted to the final uniform concentration of 10 ng/µL.

4.3. Visualization and DNA Quantification

The quality of DNA was checked on the agarose gel with 0.5× Tris-borate-EDTA (TBE), stained with EtBr. The collected DNA samples were run on 1% agarose gels at 100 V at 35 min 5–6 µL of each sample and 3–5 µL of the loading buffer (XC+BB, Thermo Scientific, USA) was used alongside the GeneRuler 1 kb DNA Ladder (Thermo Scientific, USA).

4.4. PCR Amplification and Fragment Analysis

A total of 21 genus-specific SSR markers were used (Table 5). The PCR reactions were performed in a final volume of 11 µL that contained 1 µL of extracted DNA and the following reagents: 2 × PCR ToughMix (QuantaBio, Beverly, MA, USA), 0.1 μL of forward primer (10 μM; Sigma-Aldrich, St. Louis, MO, USA), 0.25 μL of reverse primer (10 μM; Sigma-Aldrich, USA), and 0.183 μL of 5′ fluorescently labeled universal primer (10 μM; 6-FAM, NED, HEX; Omega, Norwalk, CT, USA). The forward primer of each SSR had an added 18 bp tail sequence 5′-TGTAAAACGACGGCCAGT-3′ (M13(−21)), as described by Schuelke [40].
The amplification reactions were carried out using Verity (Thermo Fisher Scientific, USA) and SureCycler 8800 Thermal Cycler (Agilent Technologies, Santa Clara, CA, USA) with touchdown PCR conditions [42]. The individual steps in the PCR analyses were as follows: 94 °C for 4 min; fifteen cycles at 94 °C for 1 min, auto-decrease in temperature from 60 °C (62 °C) to 49.5 °C (51.5 °C) at 0.7 °C per cycle for 30 s, 72 °C for 1 min; followed by 23 cycles at 94 °C for 30 s, 53 °C for 30 s, 72 °C for 1 min; and the final extension for 5 min at 72 °C. The fragment analysis was performed on the 3130XL genetic analyzer (Applied Biosystems, Waltham, MA, USA). The allele lengths were determined by comparison with the GeneScan-500 ROX size standard (Applied Biosystems, USA) using the GeneMapper 4.0 software (Applied Biosystems, USA).

4.5. Data Analysis

Microsatellite-Toolkit [43] was used to calculate the observed number of alleles (No), allele frequency, expected heterozygosity (He), observed heterozygosity (Ho), and polymorphic information content (PIC). The GenAlEx 6.1 software [44] was used to determine the Shannon’s information index (I), fixation indices (Fis, Fst and Fit) and conduct the analysis of molecular variance (AMOVA) and principal coordinate analysis (PCoA). The UPGMA dendrogram according to Nei’s genetic distance was constructed by the Populations 1.2.28 software. The optimal value K for population structure analysis was calculated using the Structure harvester software 2.3.4 [45].

5. Conclusions

The selected SSR markers proved to be a suitable tool for the detection of polymorphism at the DNA level, which enabled an effective differentiation and characterization of the varieties of the analyzed set of common and Tartary buckwheat. The Rana 60 common buckwheat variety from Slovenia was classified as a Tartary buckwheat variety based on the results of the genomic SSR analyses. In the hierarchical cluster analysis, PCoA, and Structure analysis, the variety Rana 60 was assigned to the Tartary buckwheat varieties. The variety Rana 60 can be correctly classified with further characterization and analysis. Based on Nei’s coefficient, within the species of common buckwheat, we identified the varieties Emka (7) from Poland and Tohno Zairai (20) from Canada as the most genetically distant. Within the Tartary buckwheat species, we evaluated the variety named PI481644 (22) from Bhutan and the variety named Liuqiao-3 (32) from China as the most genetically distant. As the most genetically distant varieties between species, we evaluated the common buckwheat variety Darina (5) from Slovenia and the Tartary buckwheat variety Weswod Ican (27) of unknown origin. The most diverse varieties could be used in for the creation of varieties in the breeding process with improved agronomically important properties in MAS selection. The SSR markers with their codominant inheritance also allow us to distinguish the homozygotes from heterozygotes during crossing. Based on the self-pollination of Tartary buckwheat, we assumed a lower level of expected heterozygosity in the analyzed set of genotypes compared to common buckwheat, which was confirmed by our results. The varieties of common and Tartary buckwheat showed a significant genetic differentiation according to the SSR analysis, which confirms their cross-incompatibility. The analyses did not show a significant differentiation of the varieties based on their geographic origin, which may indicate intense natural selection and a high level of genetic diversity. The SSR markers used can be implemented in checking the uniformity of the newly created lines, as well as in the process of identifying the new varieties. They enable and speed up the selection process of varieties with improved key agronomic traits.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/plants13152147/s1, File S1: FT_FE.

Author Contributions

L.Č., Z.H., B.P. and V.M.—methodology and investigation; Ž.B., M.C. and Z.G.—validation, writing, review, and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the KEGA project No. 027SPU-4/2021 (30%); APVV project No. APVV-21-0289 (20%); Operational program Integrated Infrastructure within the project: Demand-driven research for the sustainable and innovative food, Drive4SIFood 313011V336, cofinanced by the European Regional Development Fund (30%) and by the Agrobiodiversity Research Programme (P4-0072) funded by the Slovenian Research and Innovation Agency, Ljubljana, Slovenia (20%).

Data Availability Statement

The original contributions presented in the study are included in the article/Supplementary Materials, further inquiries can be directed to the corresponding author.

Acknowledgments

The samples of common buckwheat genotypes were provided by the Gene Bank at the Research Institute of Plant Production in Piešťany (Slovak Republic) and the samples of Tartary buckwheat genotypes by the Gene Bank at the Research Institute of Plant Production in Prague-Ruzyně (Czech Republic). The microsatellite analyses were performed at the Crop Science Department, Agricultural Institute of Slovenia, Ljubljana, Slovenia. The authors would like to thank Teja Krpan and Živa Jurič for technical assistance during the laboratory work.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Bashir, E.; Mahajan, R.; Mir, R.A.; Dar, W.A.; Zargar, S.M. Unravelling the genetic variability and population structure of buckwheat (Fagopyrum spp.): A collection of north western Himalayas. Nucleus 2021, 64, 93–101. [Google Scholar] [CrossRef]
  2. Joshi, B.K. Buckwheat (F. esculentum Moench and F. tataricum Gaertn). In Neglected and Underutilized Crops; Academic Press: Cambridge, MA, USA, 2023; pp. 151–200. [Google Scholar]
  3. Fang, X.; Zhang, Y.; Cui, J.; Yue, L.; Tao, J.; Wang, Y.; Zhang, R.; Liu, J.; Jiang, A.; Zhang, J.; et al. Genetic Map Construction, QTL Mapping, and Candidate Genes Screening of Grain Size Traits in Common Buckwheat (Fagopyrum esculentum M.). Agronomy 2022, 12, 2062. [Google Scholar] [CrossRef]
  4. Hou, S.; Ren, X.; Yang, Y.; Wang, D.; Du, W.; Wang, X.; Li, H.; Han, Y.; Liu, L.; Sun, Z. Genome-Wide Development of Polymorphic Microsatellite Markers and Association Analysis of Major Agronomic Traits in Core Germplasm Resources of Tartary Buckwheat. Front. Plant Sci. 2022, 13, 819008. [Google Scholar] [CrossRef] [PubMed]
  5. Matsui, K.; Yasui, Y. Genetic and genomic research for the development of an efficient breeding system in heterostylous self-incompatible common buckwheat (Fagopyrum esculentum). Theor. Appl. Genet. 2020, 133, 1641–1653. [Google Scholar] [CrossRef] [PubMed]
  6. Luthar, Z.; Golob, A.; Germ, M.; Vombergar, B.; Kreft, I. Tartary Buckwheat in Human Nutrition. Plants 2021, 10, 700. [Google Scholar] [CrossRef] [PubMed]
  7. Song, Y.; Zhuo, C.; Yumei, D.; Dongmei, L.; Keyu, B.; Devra, J.; Jinchao, F.; Chunlin, L. Diversity of Tartary Buckwheat (Fagopyrum tataricum) Landraces from Liangshan, Southwest China: Evidence from Morphology and SSR Markers. Agronomy 2022, 12, 1022. [Google Scholar] [CrossRef]
  8. Tang, Y.; Ding, M.Q.; Tang, Y.X.; Wu, Y.M.; Shao, J.R.; Zhou, M.L. Germplasm resources of buckwheat in China. In Molecular Breeding and Nutritional Aspects of Buckwheat; Zhou, M., Kreft, I., Woo, S.H., Chrungoo, N.K., Wieslander, G., Eds.; Academic Press: Amsterdam, The Netherlands, 2016; pp. 13–20. [Google Scholar]
  9. Ikeda, K.A.; Asami, Y. Mechanical characteristics of buckwheat noodles. Fagopyrum 2000, 17, 67–72. [Google Scholar]
  10. Zhang, Z.-L.; Zhou, M.-L.; Tang, Y.; Li, F.-L.; Tang, Y.-X.; Shao, J.-R.; Xue, W.-T.; Wu, Y.-M. Bioactive compounds in functional buckwheat food. Food Res. Int. 2012, 49, 389–395. [Google Scholar] [CrossRef]
  11. Fang, X.; Huang, K.; Nie, J.; Zhang, Y.; Zhang, Y.; Li, Y.; Wang, W.; Xu, X.; Ruan, R.; Yuan, X.; et al. Genome-wide mining, characterization, and development of microsatellite markers in Tartary buckwheat (Fagopyrum tataricum Garetn.). Euphytica 2019, 215, 183. [Google Scholar] [CrossRef]
  12. Gaberščik, A.; Grašič, M.; Vogel-Mikuš, K.; Germ, M.; Golob, A. Water Shortage Strongly Alters Formation of Calcium Oxalate Druse Crystals and Leaf Traits in Fagopyrum esculentum. Plants 2020, 9, 917. [Google Scholar] [CrossRef]
  13. Campbell, C.G. Buckwheat: Fagopyrum esculentum Moench; Bioversity International: Rome, Italy, 1997; Volume 19. [Google Scholar]
  14. Rana, J.C.; Singh, M.; Chauhan, R.S.; Chahota, R.K.; Sharma, T.R.; Yadav, R.; Archak, S. Genetic Resources of Buckwheat in India. In Molecular Breeding and Nutritional Aspects of Buckwheat; Zhou, M., Kreft, I., Woo, S.-H., Chrungoo, N., Wieslander, G., Eds.; Academic Press: Cambridge, MA, USA, 2016; pp. 109–135. [Google Scholar]
  15. Monshi, F.I.; Katsube-Tanaka, T. 2S albumin g13 polypeptide, less related to Fag e 2, can be eliminated in common buckwheat (Fagopyrum esculentum Moench) seeds. Food Chem. Mol. Sci. 2022, 5, 100138. [Google Scholar] [CrossRef] [PubMed]
  16. Shi, T.; Li, R.; Chen, Q.; Li, Y.; Pan, F.; Chen, Q. De novo sequencing of seed transcriptome and development of genic-SSR markers in common buckwheat (Fagopyrum esculentum). Mol. Breed. 2017, 37, 12. [Google Scholar] [CrossRef]
  17. Song, J.-Y.; Lee, G.-A.; Yoon, M.-S.; Ma, K.-H.; Choi, Y.-M.; Lee, J.-R.; Jung, Y.-J.; Park, H.-J.; Kim, C.-K.; Lee, M.-C. Analysis of Genetic Diversity and Population Structure of Buckwheat (Fagopyrum esculentum Moench) Landraces of Korea Using SSR Markers. Korean J. Plant Resour. 2011, 24, 702–711. [Google Scholar] [CrossRef][Green Version]
  18. Türkoglu, A.; Haliloglu, K.; Mohammadi, S.A.; Öztürk, A.; Bolouri, P.; Özkan, G.; Bocianowski, J.; Pour-Aboughadareh, A.; Jamshidi, B. Genetic Diversity and Population Structure in Türkiye Bread Wheat Genotypes Revealed by Simple Sequence Repeats (SSR) Markers. Genes 2023, 14, 1182. [Google Scholar] [CrossRef] [PubMed]
  19. Asmamaw, M.; Keneni, G.; Tesfaye, K. Genetic diversity of Ethiopian durum wheat (Triticum durum Desf.) landrace collections as reveled by SSR markers. Adv. Crop Sci. Technol. 2019, 7, 413. [Google Scholar] [CrossRef]
  20. Belete, Y.; Shimelis, H.; Laing, M.; Mathew, I. Genetic diversity and population structure of bread wheat genotypes determined via phenotypic and SSR marker analyses under drought-stress conditions. J. Crop Improv. 2020, 35, 303–325. [Google Scholar] [CrossRef]
  21. Gregáňová, Ž.; Kraic, J.; Gálová, Z. Effectiveness of microsatellites in differentiation of elite wheat cultivars. Biologia 2005, 60, 665–670. [Google Scholar]
  22. Vyhnánek, T.; Nevrtalová, E.; Slezáková, K. Detection of the genetic variability of triticale using wheat and rye SSR markers. Cereal Res. Commun. 2009, 37, 23–29. [Google Scholar] [CrossRef]
  23. Balážová, Ž.; Trebichalský, A.; Gálová, Z.; Hornyák-Gregáňová, R. Application of wheat SSR markers for detection of genetic diversity in triticale (× Triticosecale witt.). Genetika 2015, 47, 983–992. [Google Scholar] [CrossRef]
  24. Aljumaili, S.J.; Rafii, M.Y.; Latif, M.A.; Sakimin, S.Z.; Arolu, I.W.; Miah, G. Genetic Diversity of Aromatic Rice Germplasm Revealed by SSR Markers. BioMed Res. Int. 2018, 2018, 7658032. [Google Scholar] [CrossRef]
  25. Adu, G.B.; Awuku, F.J.; Amegbor, I.K.; Haruna, A.; Manigben, K.A.; Aboyadana, P.A. Genetic characterization and population structure of maize populations using SSR markers. Ann. Agric. Sci. 2019, 64, 47–54. [Google Scholar] [CrossRef]
  26. Vivodík, M.; Gálová, Z.; Balážová, Ž.; Petrovičová, L. Genetic variation of european maize genotypes (Zea mays L.) Detected using ssr markers. Potravinárstvo Slovak J. Food Sci. 2017, 11, 126–131. [Google Scholar] [CrossRef] [PubMed]
  27. Vivodík, M.; Saadaoui, E.; Balážová, Ž.; Gálová, Z. Genetic diversity and relationship of Tunisian castor (Ricinus communis L.) genotypes revealed by SSR markers. Genetika 2020, 52, 765–776. [Google Scholar] [CrossRef]
  28. Iwata, H.; Imon, K.; Tsumura, Y.; Ohsawa, R. Genetic diversity among Japanese indigenous common buckwheat (Fagopyrum esculentum) cultivars as determined from amplified fragment length polymorphism and simple sequence repeat markers and quantitative agronomic traits. Genome 2005, 48, 367–377. [Google Scholar] [CrossRef] [PubMed]
  29. Konishi, T.; Ohnishi, O. Close genetic relationship between cultivated and natural populations of common buckwheat in the Sanjiang area is not due to recent gene flow between them-An analysis using microsatellite markers. Genes Genet. Syst. 2007, 82, 53–64. [Google Scholar] [CrossRef] [PubMed][Green Version]
  30. Li, Y.Q.; Shi, T.L.; Zhang, Z.W. Development of microsatellite markers from Tartary buckwheat. Biotechnol. Lett. 2007, 29, 823–827. [Google Scholar] [CrossRef] [PubMed]
  31. Ma, K.H.; Kim, N.S.; Lee, G.A.; Lee, S.Y.; Lee, J.K.; Yi, J.Y.; Park, Y.J.; Kim, T.S.; Gwag, J.G.; Kwo, S.J. Development of SSR markers for studies of diversity in the genus Fagopyrum. Theor. Appl. Genet. 2009, 119, 1247–1254. [Google Scholar] [CrossRef] [PubMed]
  32. Hou, S.; Sun, Z.; Linghu, B.; Xu, D.; Wu, B.; Zhang, B.; Wang, X.; Han, Y.; Zhang, L.; Qiao, Z.; et al. Genetic Diversity of Buckwheat Cultivars (Fagopyrum tartaricum Gaertn.) Assessed with SSR Markers Developed from Genome Survey Sequences. Plant Mol. Biol. Rep. 2016, 34, 233–241. [Google Scholar] [CrossRef]
  33. Barcaccia, G.; Volpato, M.; Gentili, R.; Abeli, T.; Galla, G.; Orsenigo, S.; Citterio, S.; Sgorbati, S.; Rossi, G. Genetic identity of common buckwheat (Fagopyrum esculentum Moench) landraces locally cultivated in the Alps. Genet. Resour. Crop Evol. 2016, 63, 639–651. [Google Scholar] [CrossRef]
  34. Sabreena, M.N.; Mahajan, R.; Hashim, M.J.; Iqbal, J.; Alyemeni, M.N.; Bashir, A.G.; Zargar, S.M. Deciphering allelic variability and population structure in buckwheat: An analogy between the efficiency of ISSR and SSR markers. Saudi J. Biol. Sci. 2021, 28, 6050–6056. [Google Scholar] [CrossRef]
  35. Pipan, B.; Sinkovič, L.; Neji, M.; Janovská, D.; Zhou, M.; Meglič, V. Agro-Morphological and Molecular Characterization Reveal Deep Insights in Promising Genetic Diversity and Marker-Trait Associations in Fagopyrum esculentum and Fagopyrum tataricum. Plants 2023, 12, 3321. [Google Scholar] [CrossRef] [PubMed]
  36. Grahić, J.; Kurtović, M.; Šimon, S.; Đikić, M.; Gaši, F. Genetic purity assessment of common buckwheat variety ‘Darja’ with the use of SSR molecular markers. Genet. Appl. 2017, 1, 8–13. [Google Scholar] [CrossRef][Green Version]
  37. Mascher, M.; Schreiber, M.; Scholz, U.; Graner, A.; Reif, J.C.; Stein, N. Genebank genomics bridges the gap between the conservation of crop diversity and plant breeding. Nat. Genet. 2019, 51, 1076–1081. [Google Scholar] [CrossRef] [PubMed]
  38. Kishore, G.; Gupta, S.; Pandey, A. Assessment of population genetic diversity of Fagopyrum tataricum using SSR molecular marker. Biochem. Syst. Ecol. 2012, 43, 32–41. [Google Scholar] [CrossRef]
  39. Facho, Z.H.; Khan, F.; Tao, W.; Ali, S. Species divergence and diversity in buckwheat landraces collected from the western Himalayan region of Pakistan. Pak. J. Bot. 2019, 51, 6. [Google Scholar] [CrossRef] [PubMed]
  40. Schuelke, M. An economic method for the fluorescent labeling of PCR fragments. Nat. Biotechnol. 2000, 18, 233. [Google Scholar] [CrossRef] [PubMed]
  41. Gao, F.; Zhang, Z.; Wu, B. Construction and application of SSR molecular markers system for genetic diversity analysis of Chinese tartary buckwheat germplasm resources. Scientia Agricultura Sinica. 2012, 45, 1042–1053. [Google Scholar]
  42. Pipan, B.; Meglič, V. Diversification and genetic structure of the western-to-eastern progression of European Phaseolus vulgaris L. germplasm. BMC Plant Biol. 2019, 19, 442. [Google Scholar] [CrossRef] [PubMed]
  43. Park, S. Microsatellite Toolkit; Department of Genetics, Trinity College: Dublin, Ireland, 2001. [Google Scholar]
  44. Peakall, R.; Smouse, P.E. GenAlEx 6: Genetic analysis in excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar] [CrossRef]
  45. Earl, D.A.; vonHoldt, B.M. Structure harvester: A website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv. Genet. Resour. 2012, 4, 359–361. [Google Scholar] [CrossRef]
Figure 1. Structure plot of membership coefficients for all genotypes of buckwheat. The optimal number of clusters.
Figure 1. Structure plot of membership coefficients for all genotypes of buckwheat. The optimal number of clusters.
Plants 13 02147 g001
Figure 2. Population Structure analysis of Fagopyrum esculentum (red colour) and Fagopyrum tataricum (green colour) genotypes.
Figure 2. Population Structure analysis of Fagopyrum esculentum (red colour) and Fagopyrum tataricum (green colour) genotypes.
Plants 13 02147 g002
Figure 3. Dendrogram of 21 Fagopyrum esculentum and 14 Fagopyrum tataricum genotypes constructed using 21 SSR markers.
Figure 3. Dendrogram of 21 Fagopyrum esculentum and 14 Fagopyrum tataricum genotypes constructed using 21 SSR markers.
Plants 13 02147 g003
Figure 4. The PCoA plot of 21 Fagopyrum esculentum (blue circle) and 14 Fagopyrum tataricum (red circle) genotypes constructed using 21 SSR markers.
Figure 4. The PCoA plot of 21 Fagopyrum esculentum (blue circle) and 14 Fagopyrum tataricum (red circle) genotypes constructed using 21 SSR markers.
Plants 13 02147 g004
Figure 5. Structure analysis plots of the Fagopyrum esculentum Moench (A) and Fagopyrum tataricum Gaertn (B) varieties analyzed by 21 SSR markers.
Figure 5. Structure analysis plots of the Fagopyrum esculentum Moench (A) and Fagopyrum tataricum Gaertn (B) varieties analyzed by 21 SSR markers.
Plants 13 02147 g005
Figure 6. Dendrograms of 21 varieties of Fagopyrum esculentum Moench (A) and 14 varieties of Fagopyrum tataricum Gaertn. (B) constructed on the basis of 21 SSR markers.
Figure 6. Dendrograms of 21 varieties of Fagopyrum esculentum Moench (A) and 14 varieties of Fagopyrum tataricum Gaertn. (B) constructed on the basis of 21 SSR markers.
Plants 13 02147 g006
Table 1. Main statistical parameters for each microsatellite locus used.
Table 1. Main statistical parameters for each microsatellite locus used.
LocusRange of Allele Lengths (bp) NoHeHoMIPICFstFisFitI
Fem1303198–354130.5490.6140.7420.7420.416−0.3620.2050.774
Fem1322129–37990.5310.5500.7430.7430.477−0.3690.2840.716
Fem1407173–225120.6000.8860.7820.7820.263−0.487−0.0971.041
Fem1840170–296130.5250.7360.8510.8510.299−0.2140.1491.063
SXAU060170–366120.5860.4860.7410.7410.488−0.2340.3680.681
SXAU089190–266170.6100.4710.8030.8030.4130.0200.4250.857
SXAU129276–37090.3940.4210.6730.6730.498−0.1770.4090.640
SXAU138167–245120.5400.5360.7280.7280.453−0.3070.2850.792
Ft1_114160–18680.5600.2860.6660.6660.606−0.0220.5970.482
Ft2_1743152–327160.5490.7140.8020.8020.355−0.3510.1290.871
Ft3_572143–478100.5550.9070.8290.8290.266−0.458−0.0711.093
Ft4_2725232–322130.5310.9210.8120.8120.292−0.564−0.1070.973
Ft5_2899140–310120.5830.9360.8180.8180.250−0.489−0.1171.083
Ft6_2849202–33260.3110.5430.4270.4270.260−0.551−0.1480.527
Ft7_382211–385130.3590.6710.7990.7990.372−0.3120.1760.917
Ft8_605192–416150.4200.9430.8460.8460.323−0.617−0.0950.968
GB-FE-025126–288130.3530.9860.8010.8010.236−0.570−0.1991.087
GB-FE-121160–272140.3440.6210.6080.6080.271−0.3670.0030.818
GB-FE-035172–390140.3480.9500.6790.6790.179−0.610−0.3220.983
TBP5218–388110.3760.9860.7640.7640.307−0.789−0.2400.853
TBP6205–21120.3690.0070.0070.0070.122−0.143−0.0040.011
Total 244
Average 11.620.4770.6750.7110.7110.340−0.3800.0780.820
Number of alleles (No); expected heterozygosity (He); observed heterozygosity (Ho); polymorphic information content (PIC); fixation indices (Fst, Fis, Fit); marker index (MI); Shannon’s information index (I).
Table 2. Summary of the analysis of molecular variance (AMOVA).
Table 2. Summary of the analysis of molecular variance (AMOVA).
SourcedfSSMSEst. Var.%
Among Pops34756.53922.2512.29224%
Among Indiv105410.7503.9120.0000%
Within Indiv140992.0007.0867.08676%
Total2792159.289 9.378100%
F-StatisticsValueP(rand ≥ data)
Fst0.2940.010
Fis−0.2891.000
Fit0.0910.010
Fst = AP/(WI + AI + AP) = AP/TOT
Fis = AI/(WI + AI)
Fit = (AI + AP)/(WI + AI + AP) = (AI + AP)/TOT
Key: AP = Est. Var. Among Pops, AI = Est. Var. Among Individuals, WI = Est. Var. Within Individuals
Table 3. Heterozygosity and Fst values calculated for two clusters of Fagopyrum esculentum Moench (A) and Fagopyrum tataricum Gaertn (B).
Table 3. Heterozygosity and Fst values calculated for two clusters of Fagopyrum esculentum Moench (A) and Fagopyrum tataricum Gaertn (B).
(A)
Cluster (K)Genetic DistanceFst for K
10.7120.238
20.6830.092
Average0.6980.165
(B)
Cluster (K)Genetic DistanceFst for K
10.4480.062
20.3890.291
Average0.4190.177
Table 4. List of analyzed buckwheat genotypes.
Table 4. List of analyzed buckwheat genotypes.
NAccession NumberAccession NameGenusSpeciesCountry of Origin
1SVK001 Z50 00026Aiva 1Fagopyrumesculentum MoenchLVA
2SVK001 Z50 00004Ballada 1Fagopyrumesculentum MoenchRUS
3SVK001 Z50 00025Bamby 1Fagopyrumesculentum MoenchAUT
4SVK001 Z50 00003Bogatyr 1Fagopyrumesculentum MoenchRUS
5SVK001 Z50 00020Darina 1Fagopyrumesculentum MoenchSVN
6SVK001 Z50 00022Darja 1Fagopyrumesculentum MoenchSVN
7SVK001 Z50 00023Emka 1Fagopyrumesculentum MoenchPOL
8SVK001 Z50 00015Amurskaja 1 FAG 29/79Fagopyrumesculentum MoenchRUS
9SVK001 Z50 00016Kazanska 1 FAG 38/82Fagopyrumesculentum MoenchRUS
10SVK001 Z50 00032Hruszowska 1Fagopyrumesculentum MoenchPOL
11SVK001 Z50 00030Kasho-2 1Fagopyrumesculentum MoenchJPN
12SVK001 Z50 00024Kora 1Fagopyrumesculentum MoenchPOL
13SVK001 Z50 00005La Harpe 1Fagopyrumesculentum MoenchFRA
14SVK001 Z50 00035Pulawska 1Fagopyrumesculentum MoenchPOL
15SVK001 Z50 00007Pyra 1Fagopyrumesculentum MoenchCZE
16SVK001 Z50 00021Rana 60 1Fagopyrumesculentum MoenchSVN
17SVK001 Z50 00019Siva 1Fagopyrumesculentum MoenchSVN
18SVK001 Z50 00013St Jacut 1Fagopyrumesculentum MoenchFRA
19SVK001 Z50 00008Spacinska 1 1Fagopyrumesculentum MoenchSVK
20SVK001 Z50 00028Tohno Zairai 1Fagopyrumesculentum MoenchCAN
21SVK001 Z50 00034Winsor Royal 1Fagopyrumesculentum MoenchUSA
2201Z5100001PI 481644 2Fagopyrumtataricum (L.) Gaertn.BTN
2301Z5100009PI 481671 2Fagopyrumtataricum (L.) Gaertn.BTN
2401Z5100011903016 2Fagopyrumtataricum (L.) Gaertn.PAK
2501Z5100013PI 451723 2Fagopyrumtataricum (L.) Gaertn.MEX
2601Z5100014PI 476852 2Fagopyrumtataricum (L.) Gaertn.USA
2701Z5100017Weswod Ican 2Fagopyrumtataricum (L.) Gaertn.Unknown
2801Z5100025290 2Fagopyrumtataricum (L.) Gaertn.BTN
2901Z5100030PI 427239 2Fagopyrumtataricum (L.) Gaertn.NEP
3001Z5100037PI 481661 2Fagopyrumtataricum (L.) Gaertn.BTN
3101Z5100041Jianzui 2Fagopyrumtataricum (L.) Gaertn.CHN
3201Z5100042Liuqiao-3 2Fagopyrumtataricum (L.) Gaertn.CHN
3301Z5100044Zhaoqiao-1 2Fagopyrumtataricum (L.) Gaertn.CHN
3401Z5100046Jinqiao-2 2Fagopyrumtataricum (L.) Gaertn.CHN
3501Z5100050Sarasin a Ployes 2Fagopyrumtataricum (L.) Gaertn.USA
Sources of genetic material: 1 Gene Bank Piešťany, Slovakia, 2 Gene Bank Prague-Ruzyně, Czech Republic, Country of origin: SVN—Slovenia, SVK—Slovakia, POL—Poland, CZE—Czech Republic, AUT—Austria, BTN—Bhutan, CHN—China, RUS—Russia, LVA—Latvia, FRA—France, NEP—Nepal, USA—United States of America, PAK—Pakistan, MEX—Mexico, JPN—Japan.
Table 5. Characteristics of microsatellite markers used in the genetic diversity analysis of buckwheat.
Table 5. Characteristics of microsatellite markers used in the genetic diversity analysis of buckwheat.
MarkerSequence FSequence RRepeat MotifReference
Fem1303F: AGGAGACGGGAGAGAAGCAGR: GGATGTTTGGGTGATTTCAG(AG)31[28]
Fem1322F: AAGCATTCATTCATTCATTCR: GAGTTTGTTGTGTTTGGAGG(TC)32[28]
Fem1407F: GTGATGAGTAGTTGCCTCTGR: CTTGGCTTAGACCTCTCGTA(CT)13A(CT)21(CA)9[28]
Fem1840F: ACGACGAAGACAAATGAGGAR: ATATGGACGGCCTGGATTAT(GA)8[28]
SXAU060F: TCCCAATAGCCAATAGTACATGR: GACCTAATTAACCGTTAGCACA(AAT)10[32]
SXAU089F: CAAAAGAAAAGTGCCGAAGTR: TTATGTCACCGCCATTGTT(CCA)10[32]
SXAU129F: CTCAAAGGATGCCATTGTAACR: GACTTTGAGAACGCCTTGAC(TA)11[32]
SXAU138F: CACCTGCTACAATACTCTCAR: GCTTAATCAACAGTAGGCAC(AGT)10[32]
Ft1_114F: CAACAGCATCTTTCCCTTCAR: CCATAAACACAGCAACAGCC(T)24[11]
Ft2_1743F: ACCACTGACAATAAGGGGGAR: CAAAAGGTTGATGTGGATGG(AT)37[11]
Ft3_572F: CATCACCCCTCTCAAGACCTR: AGAATCCTACCCCGTCCTTT(TA)14[11]
Ft4_2725F: TAGCGATTTGAAGGGGACTTR: CGTAACAATGGTCGTTACTCG(AT)10[11]
Ft5_2899F: AAGCTTCCTTCCATGACCACR: GTTTCTTGTGTGGACCGTTG(TA)11[11]
Ft6_2849F: ACAATTCATCAAGCGACTCCR: CTTTGCCGAATGTAGGGAAT(AAAAC)4[11]
Ft7_382F: TGGTCTCTAAAACGGACCGAR: TCGGAACCGGATTCTCTTAC(AT)27[11]
Ft8_605F: AACGAGGGTACTAACCGGAAR: CCCCAGCTGTAAAACAATCA(ATA)19[11]
GB-FE-025F: CAGATGTTACCCGAGGCAR: ACCCATATGTCACGAGCG(ACCTCC)6[31]
GB-FE-121F: TCCATACCAAGCAGGTGGR: GTGCCTGATGAGGTTCCA(AGG)6[31]
GB-FE-035F: TGCAATGACTTGGAGGAGAR: ACCACCATTCAACAAGCG(GAK)6 (GAT)3 (GAT)2 K(G/T)[31]
TBP5F: GGGGATTGATCGAGAAAGR: CCGAAGAGTAACTAGGAC-[41]
TBP6F: CGGCTAATAAGTCGTTTCR: GGATCATAGGTCGTGAAT-[41]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Balážová, Ž.; Čišecká, L.; Gálová, Z.; Hromadová, Z.; Chňapek, M.; Pipan, B.; Meglič, V. Characterization of Genetic Variability of Common and Tartary Buckwheat Genotypes Using Microsatellite Markers. Plants 2024, 13, 2147. https://doi.org/10.3390/plants13152147

AMA Style

Balážová Ž, Čišecká L, Gálová Z, Hromadová Z, Chňapek M, Pipan B, Meglič V. Characterization of Genetic Variability of Common and Tartary Buckwheat Genotypes Using Microsatellite Markers. Plants. 2024; 13(15):2147. https://doi.org/10.3390/plants13152147

Chicago/Turabian Style

Balážová, Želmíra, Lucia Čišecká, Zdenka Gálová, Zuzana Hromadová, Milan Chňapek, Barbara Pipan, and Vladimir Meglič. 2024. "Characterization of Genetic Variability of Common and Tartary Buckwheat Genotypes Using Microsatellite Markers" Plants 13, no. 15: 2147. https://doi.org/10.3390/plants13152147

APA Style

Balážová, Ž., Čišecká, L., Gálová, Z., Hromadová, Z., Chňapek, M., Pipan, B., & Meglič, V. (2024). Characterization of Genetic Variability of Common and Tartary Buckwheat Genotypes Using Microsatellite Markers. Plants, 13(15), 2147. https://doi.org/10.3390/plants13152147

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop