Skip to Content
AntibioticsAntibiotics
  • Article
  • Open Access

22 December 2024

Comparative Genome Analysis of Canine Frederiksenia canicola Isolates

,
,
,
,
,
and
1
HUN-REN Veterinary Medical Research Institute, 1143 Budapest, Hungary
2
Department of Microbiology and Infectious Diseases, University of Veterinary Medicine, 1143 Budapest, Hungary
3
National Laboratory of Infectious Animal Diseases, Antimicrobial Resistance, Veterinary Public Health and Food Chain Safety, University of Veterinary Medicine, 1078 Budapest, Hungary
*
Author to whom correspondence should be addressed.

Abstract

Background/Objectives: The One Health approach is crucial for managing and controlling the spread of antimicrobial resistance. Frederiksenia canicola is a recently identified bacterial species that seems to be a component of the oral microbiota of dogs; however, its pathogenic nature is questionable. Methods: In this study, the antibacterial susceptibility of F. canicola isolates was determined using the disk diffusion and broth microdilution methods. Genome-wide comparative analyses were performed to identify the genetic factors driving virulence and antimicrobial drug resistance (e.g., virulence factors, antimicrobial resistance genes (ARGs) and prophage-related sequences). Results: Most of the F. canicola isolates lacked virulence-associated genes. F. canicola is likely resistant to clindamycin, lincomycin and neomycin, but susceptible to penicillin, erythromycin and enrofloxacin. Antimicrobial resistance genes were not found in the F. canicola genomes, but prophage-related sequences were identified, suggesting its potential in the transfer of genes associated with drug resistance between bacteria in the oral microbiome. Conclusions: F. canicola is presumably a commensal organism with low virulence potential, as evidenced by the absence of virulence-associated genes. As F. canicola can colonize a wide range of hosts, including humans, further investigation with a greater number of isolates is needed to better understand the role of F. canicola in disease development and the spread of drug resistance.

1. Introduction

The mammalian oral cavity is colonized by diverse microbial species that co-evolve with the host and adapt to highly dynamic environmental changes. The genetic determinants of host–microbe relations and microbial–microbial interactions that drive the composition of complex polymicrobial communities might play a role in the development of species-specific microbiota [1]. Research on the microbiome of companion animals (mainly dogs and cats) is of great interest, as close daily contact with them opens a way for the transmission of zoonotic diseases. Moreover, when the oral microbial ecosystem is perturbed, the proliferation of potentially pathogenic bacteria leads to oral diseases such as gingivitis, periodontitis and dental caries [2]. Metagenomic analyses of canine saliva reveal several bacterial genera, including Porphyromonas, Prevotella, Pasteurella, Neisseria, Capnocytophaga, Conchiformibius, Frederiksenia, Cutibacterium, Actinomyces, Campylobacter, Desulfomicrobium, Bacteroides, Fusobacterium, Mycoplasmopsis, Treponema, Streptococcus, Bergeyella and Histophilus [3,4], out of which some species are associated with the development of oral or wound infections [5]. Over past decades, the popularity of keeping dogs has been steadily increasing [6]; therefore, accurate species-level identification and correct classification of the members of canine oral microbiota are essential to adequate therapy and disease prevention.
From the majority of dog-bite infections, Pasteurella species can be isolated as causative agents [3,7]. P. multocida-associated diseases are the most common in humans, although other species of the genus have also been isolated from human infections (Pasteurella dagmatis, Pasteurella canis and Pasteurella stomatis) [8]. Frederiksenia canicola is the single representative of the genus Frederiksenia (Pasteurellaceae family), described in 2014 as a new species previously known as Bisgaard taxon 16 [9]. F. canicola might be misidentified as P. canis, P. stomatis and P. dagmatis as it shares phenotypic characteristics, genome size and cellular fatty acid composition with the genus Pasteurella. Based on MALDI-TOF mass spectrometry, chemotaxonomy, amino acid signature-specific PCR and phylogenetic analyses of 16S rRNA, rpoB (encoding beta subunit of the DNA-dependent polymerase), infB (encoding translation initiation factor 2) and recN (encoding DNA repair protein), Korczak et al. identified F. canicola in dogs, dog-bite wounds, a cat, a lion, a hedgehog and a mongoose [10]. Since then, F. canicola has been isolated from Tasmanian devils, long-nosed potoroos, spotted-tailed quolls, eastern quolls and as a component of dog oral microbiota [2,3,11,12,13]. It was also detected in the upper respiratory tract microbiota of humans with and without a severe acute respiratory syndrome coronavirus-2 infection [14]. Of note, despite the high prevalence of F. canicola in mammals, especially dogs, clarification of its pathogenic role in the development of infection remains. In addition, the antimicrobial susceptibility profile of this species is largely unknown.
Canine saliva may be a source of antimicrobial resistance genes (ARGs) as well, posing an emerging major concern. ARG-carrying bacteria might enter the human body through biting, scratching, or licking by animals and via contact with nasopharyngeal secretions. Subsequently, ARGs might be exchanged with the host microbiota by horizontal gene transfer. As non-pathogenic bacteria may also harbour acquired antibiotic resistance genes [15], it is essential to assess the genetic characteristics of F. canicola along with its potential threats to animal and human health. In this study, we aimed to explore the pathogenic, as well as zoonotic, potential of F. canicola. Therefore, we performed antibacterial susceptibility testing of F. canicola isolates originating from different body sites (oral cavity, nasal cavity, pharynx and bronchoalveolar lavage) in dogs and carried out a comprehensive genomic analysis to determine possible factors that might contribute to pathogenesis or antimicrobial resistance.

2. Results

During 2023, forty-three F. canicola isolates have been identified in the oral cavities of healthy dogs. Colonies showed variable phenotypes on Columbia agar plates (small or medium or large in size, greyish or yellowish, smooth and glistening). Isolates were catalase-positive and oxidase-positive, except for three isolates. As breakpoints and susceptible or resistant categories have not yet been established for F. canicola, we predicted their susceptibility according to the inhibition zone diameter and low or high minimal inhibitory concentration (MIC) values relative to those of other members of Pasteurellaceae. All isolates seemed to be susceptible to the tested antibiotics with the disk diffusion method, except for amoxicillin–clavulanic acid, clindamycin, lincomycin and neomycin (Table 1). One isolate (FC5) was likely resistant to ampicillin, whereas two isolates (FC6 and FC8) showed reduced susceptibility to erythromycin. One isolate (FC5) showed moderate susceptibility to cephalexin and another (FC8) to sulfamethoxazole–trimethoprim. In general, the susceptibility of isolates by broth microdilution was consistent with disk diffusion. The majority of isolates showed low MIC values for ampicillin (0.25–2 mg/L), erythromycin (<0.125–0.5 mg/L), enrofloxacin (≤0.03–0.25 mg/L), penicillin (≤0.03–0.25 mg/L) and tetracycline (0.25–2 mg/L). FC5 and FC10 had MIC values suggestive of the nonsusceptible category to ampicillin. FC14 had reduced susceptibility to tetracycline (2 mg/L) and enrofloxacin (0.25 mg/L). The lowest MIC values were observed for enrofloxacin with MIC90 ≤ 0.03 mg/L. All F. canicola isolates had relatively high MIC values for clindamycin (4–32 mg/L) and lincomycin (8–128 mg/L). Neomycin proved to be effective in vitro only against FC3 (0.25 mg/L); otherwise, it demonstrated weak activity against F. canicola isolates (4–64< mg/L) (Table 1).
Table 1. Antibiotic susceptibility of F. canicola isolates determined by disk diffusion and broth microdilution methods. Numbers under disk diffusion represent diameter (mm) and numbers under BMD represent mg/L. Green, yellow and red colours indicate susceptible, intermediate and resistant categories, respectively, according to CLSI guidelines, based on Pasteurella species.
The sequencing of F. canicola genomes resulted in 22,010,483–28,422,845 reads with 1284–1711.9-fold mean coverage of the whole genome. We determined that the average nucleotide identity between the sequenced F. canicola genomes and the reference sequence was 92.92%, reflecting the degree of evolutionary distance between the genomes. ARGs were not found in the investigated genomes; however, SNP in 23S rRNA conferring resistance to clindamycin and mutation in 16S rRNA conferring resistance to spectinomycin were detected in all isolates using the Bacterial and Viral Bioinformatics Resource Center (BV-BRC) database. In FC14, SNP in 23S rRNA, associated with resistance to macrolides and streptogramins, was also identified. Based on the Comprehensive Antibiotic Resistance Database (CARD) and Resistance Gene Identifier (RGI), SNP in the elongation factor Tu (EF-Tu), yielding resistance to pulvomycin, was detected in all F. canicola sequences. Known virulence factors were not identified by BV-BRC. In FC1, FC3, FC4 and FC5, a heat-shock protein sequence (htpB) was identified with VRprofile2. The sequence of undecaprenyl-phosphate galactose phosphotransferase (wbaP/rfbP), involved in O-antigen biosynthesis, was found only in FC14. The F. canicola genomes FC1, FC2 and FC14 contained complete prophage regions with lengths of 40.2 Kb, 16.5 Kb and 9.6 Kb, respectively. FC6, FC8, FC9, FC10, FC11 and FC13 harboured questionable prophages (a length range of 9.6–34.8 Kb). Moreover, an incomplete prophage was found in FC2 (12.6 Kb) and FC14 (12.4 Kb) (Table 2, Figure 1). Phylogenetic analysis of the concatenated sequences, including whole 16S rRNA, rpoB, infB and recN genes, revealed that the F. canicola isolates were highly similar in comparison with each other or the reference strain HPA 21. The 9812-bp-long sequences of isolates obtained in our study demonstrated 98.7% pairwise identity with 9359 identical sites (95.4%). The F. canicola gene sequences formed a monophyletic group and bore the closest relation to Glaesserella parasuis and Actinobacillus indolicus (Figure 2).
Table 2. Characteristics of prophage regions identified in F. canicola genomes.
Figure 1. A comparative chromosomal genome visualization of the F. canicola isolates FC1, FC2 and FC14, generated by Proksee and PHASTEST. On the left, circular genomes illustrate coding sequences (CDS), repeat regions, tRNAs, rRNAs, GC content and GC skew. On the right, genomes illustrate the location of phage-related genes (terminase, head protein, portal protein, phage-like protein, integrase, antirepressor, regulatory protein, tail protein and protease).
Figure 2. The phylogenetic relationships of bacterial isolates representing the members of the Pasteurellaceae family. The tree was generated by the neighbor-joining algorithm with the p-distance method based on concatenated sequences of 16S rRNA, rpoB, infB and recN genes (9812 bp). The numbers along the branches indicate bootstrap values. The F. canicola isolates involved in the study are marked in blue.

3. Discussion

Most antibiotics are used in both human and veterinary medicine; thus, the One Health approach is inevitable in adequate disease management and control of the spread of antimicrobial resistance. Since animals and their owners can exchange microbiota and even non-pathogenic bacterial strains may acquire and maintain ARGs [16], the identification and examination of animal microbial populations that can endanger animal and human health is of great importance. In 2014, a new species was described within the Pasteurellaceae family, named Frederiksenia canicola [10]. The widespread use of next-generation sequencing technologies over the last decade has allowed for the identification of this species in various hosts, with an outstanding prevalence in the oral cavities of dogs. Lisjak et al. reported that the most abundant bacteria in the oral microbiota of healthy dogs were the Porphyromonas species and Conchiformibius steedae, followed by Neisseria weaveri and F. canicola. Interestingly, Frederiksenia was present in high frequency in dogs with oral tumours, along with the Bergeyella and Pasteurella species [4]. In another study, the most prevalent oral bacteria at the genus level were Porphyromonas, Bergeyella, Capnocytophaga, Pasteurella, Tannerella, Neisseria, Desulfomicrobium, Frederiksenia, Treponema, Conchiformibius, Fusobacterium, Campylobacter and Pseudomonas [17]. In addition, 16S rRNA coding gene sequences of F. canicola have been detected in the upper respiratory tract microbiota of asymptomatic individuals, as well as patients with confirmed COVID-19, suggesting that F. canicola can colonize a wide range of hosts, including humans [14].
Only a few data regarding the antimicrobial susceptibility of F. canicola are available in the scientific literature. Gutman et al. investigated the susceptibility of the members of the Pasteurellaceae family, including F. canicola, originated in the oral cavities of Tasmanian devils. All F. canicola isolates demonstrated MIC values > 32 mg/L for amikacin, whereas penicillin proved to be the most efficient drug (MIC range: ≤0.06–0.25 mg/L) [18]. In our study, we investigated the susceptibility of F. canicola isolates with the disk diffusion and broth microdilution methods and obtained similar results to Gutman et al.; one of the most effective drugs was penicillin G (MIC90 = 0.125 mg/L). However, the lowest MIC values were observed for enrofloxacin (MIC90 =≤ 0.03). Gutman et al. examined the activity of enrofloxacin and also found low MIC values [18]. Nevertheless, the lowest tested concentration was 0.25 mg/L, in contrast to our study (0.03 mg/L). Instead of amikacin, we chose neomycin, from the aminoglycoside drug class, for our susceptibility testing and found that inhibition of bacterial growth could be seen at high concentrations (MIC90 = 16 mg/L). Our observations, and the overall high prevalence of strains from the Pasteurellaceae family with high MIC values for amikacin and gentamicin, further support that these strains possess resistance mechanisms to aminoglycosides [18,19]. The highest MIC values were seen for clindamycin (MIC90 = 16 mg/L) and lincomycin (MIC90 = 32 mg/L), which belong to the lincosamide drug class; hence, resistance to these agents is presumed. Although resistance cannot be declared in the absence of breakpoints, the SNPs found in genes encoding 23S rRNA and 16S rRNA confirmed these hypotheses. Spectinomycin is an aminocyclitol antibiotic that has a similar chemical structure and mechanism of action to aminoglycosides; thus, a mutation in 16S rRNA might explain the reduced activity of aminoglycosides against F. canicola. Overall, F. canicola isolates are likely susceptible to ampicillin, penicillin, tetracycline, erythromycin, enrofloxacin, cefalexin, cefovecin and sulfamethoxazole–trimethoprim.
Several bacterial genomes harbour regions that include prophage-associated genes acting as hotspots for horizontal gene transfer and thereby contribute to host adaptation, virulence, stress tolerance and antimicrobial resistance [20,21]. A lambda-like phage carrying the toxin-encoding gene toxA and other prophage-associated genes were detected in the genome of toxigenic P. multocida serogroup D strains, suggesting that these genes might influence the short-term evolution of P. multocida [22]. We identified complete prophage regions in three out of fifteen of the F. canicola isolates and additional incomplete prophages in two isolates. Only questionable prophage regions were detected in the other isolates. As intact and incomplete prophage regions consisted of genes specific to phage-inducible chromosomal islands (e.g., integrase and transcriptional regulator) found in pathogenic bacteria, F. canicola isolates may have the potential to play some role in the transfer of resistance genes due to carrying prophages, although we could not detect any genes contributing to drug resistance.
Virulence factors associated with pathogenicity were identified in bacterial species by genomic analyses. Understanding the role of these factors in pathogenic mechanisms facilitates the prevention and control of infection. Species within the Pasteurellaceae family share several genes associated with virulence that often participate in the biosynthesis of lipopolysaccharide and adhesins, iron regulation, or help bacteria to evade the host’s innate immune system. Gong et al. investigated the genome of 764 G. parasuis isolates and identified 24 potential virulence factors, all of which linked to lipooligosaccharides. Thirteen of these genes (galE, galU, gmhA, isgF, kdsA, lgtF, lpxA, lpxC, lpxD, neuA, rfaD, rfaE and yhxB/manB) were present in all the G. parasuis isolates [23]. Some genes, required for the biosynthesis of lipid A (lpxA, lpxC, lpxD and kdsA) and inner core oligosaccharide (gmhA), were detected in P. multocida strains, as well [21]. Besides these conserved virulence factors in the G. parasuis genome, there were specific genes whose presence correlated with different serovars. Previously, the presence of lsgB-encoding sialyltransferase was counted specifically in isolates that cause systemic infections; however, Gong et al. reported that nasal isolates also carried the lsgB gene. In addition, lsgB was mainly detected in highly virulent G. parasuis strains belonging to serovars 7–10 and 13 [23]. We only found a heat-shock protein sequence (htpB) in four of the F. canicola isolates and an undecaprenyl-phosphate galactose phosphotransferase (wbaP/rfbP) in one isolate. As F. canicola shows the closest phylogenetic relationship with G. parasuis and A. indolicus and we did not identify any of the above-mentioned virulence genes or other virulence-associated factors, such as adhesins, toxins, iron-regulated, iron acquisition proteins, nor enzymes involved in the sialic acid metabolism, we conclude F. canicola strains are likely non-virulent.

4. Materials and Methods

4.1. Sample Collection and Identification

During 2023, oral swab samples were collected from healthy dogs representative of different sexes, breeds and ages (Table 3). The swab samples were collected by the veterinarian working at the practice, with the consent of the animals’ owners, and in full compliance with the ethical guidelines outlined in the code of ethics of the HUN-REN Veterinary Medical Research Institute. The samples were cultured on Columbia agar plates supplemented with 5% sheep’s blood and incubated at 37 °C for 24 h under aerobic conditions. Pasteurella-like colonies were further investigated by biochemical testing and molecular methods. Five isolates from our F. canicola strain collection were also involved in the study. Species-specific PCR testing was carried out with the primers recN_Fred-1 CCACGCTCTATCAAACTATTCG and recN_first-R CCRCTAATYCCMACATCNACYTCATC amplifying a 747 bp fragment of a recN gene. Briefly, the genomic DNA template used in the PCR tests was obtained from bacterial colonies by heat inactivation. The 25 µL reaction mixture contained 1 µL bacterial DNA, 2.5 µL 10× DreamTaq buffer, 0.3 µL MgCl2 (25 mM), 0.5 µL dNTP (10 mM), 0.3 µL forward and reverse primers (10 µM each), 0.2 µL DreamTaq DNA polymerase (5 U/µL; Thermo Fisher Scientific, Waltham, MA, USA) and 19.9 µL distilled water. The PCR condition was set up with an initial denaturation step at 94 °C for 3 min, followed by 30 cycles of 94 °C for 15 s, annealing at 50 °C for 20 s, extension at 72 °C for 30 s and a final extension step at 72 °C for 2 min. Signature sequence-specific amplicons for F. canicola were verified on a 1.5% agarose gel [10].
Table 3. The origin of the sequenced F. canicola isolates and the distribution of the age, sex and breed of the studied population of healthy dogs.

4.2. Antibiotic Susceptibility Testing

The in vitro susceptibility of F. canicola isolates was evaluated by disk diffusion and broth microdilution methods according to Clinical and Laboratory Standards Institute (CLSI) guidelines [24,25]. The antibiotics involved in the study were chosen based on the following criteria: the most antibiotic classes are represented, including agents used in small-animal practices in Hungary, and those antibiotics previously used in the susceptibility testing of F. canicola in other publications. The initial concentration of bacterial cell suspension in sterile saline was adjusted to an optical density of 0.5 McFarland for both susceptibility methods. Disk diffusion was performed on Mueller–Hinton agar plates supplemented with 5% sheep’s blood. Commercially prepared paper disks containing a fixed concentration of antibiotics were applied to the inoculated agar. The following antibiotics were tested: penicillin G (10 U), amoxicillin + clavulanic acid (20/10 µg), ampicillin (10 µg), neomycin (30 U), lincomycin (2 µg), cephalexin (30 µg), cefovecin (30 µg), clindamycin (2 µg), enrofloxacin (5 µg), erythromycin (15 µg), sulfamethoxazole–trimethoprim (25 µg) and tetracycline (30 µg). The results were analysed 24 h after inoculation. Escherichia coli ATCC 25922 and Staphylococcus aureus ATCC 25923 strains were used as quality controls. In the broth microdilution method, the activity of penicillin (0.03–16 mg/L), ampicillin (0.125–64 mg/L), clindamycin (0.25–128 mg/L), erythromycin (0.125–64 mg/L), lincomycin (0.25–128 mg/L), neomycin (0.125–64 mg/L), cephalexin (0.03–16 mg/L), enrofloxacin (0.03–16 mg/L) and tetracycline (0.06–32 mg/L) against F. canicola was tested. Twofold dilutions of the drug solutions in Brain Heart Infusion (BHI) broth were dispensed into 96-well plates. E. coli ATCC 25922 and S. aureus ATCC 29213 were used as quality control strains to check the reproducibility of the procedure. The plates were incubated at 37 °C for 24 h. The growth of each isolate of various drug concentrations was read at 450 nm using a microplate reader and the results were evaluated in comparison to the growth of isolates in a drug-free medium. The MIC endpoint was defined as the lowest concentration that completely inhibited bacterial growth. The concentration of antibiotics that inhibited the growth of 90% of the tested isolates was considered the MIC90 value.

4.3. Whole-Genome Sequencing and Bioinformatical Analyses

Genomic DNA was extracted with a Quick-DNA Fungal/Bacterial Miniprep Kit (Zymo Research, Irvine, CA, USA), in accordance with the manufacturer’s instructions, after a 24-h incubation of the F. canicola isolates in BHI broth at 37 °C. Ten isolates from the oral cavities of dogs collected in 2023 and five isolates from our culture collection obtained in 2018–2019 were chosen for sequencing purposes. Sequencing of the whole genome of the isolates was performed by SeqOmics Biotechnology Ltd. (Mórahalom, Hungary) on an Illumina platform. Paired-end reads were quality-checked and trimmed using the BBDuk algorithm in Geneious Prime (version 2023.2.1) [26]. Genome assembly was carried out by mapping the trimmed reads to the reference (F. canicola strain HPA 21, GenBank accession number: CP015029) using Geneious Prime software. The characteristics of bacterial genomes (e.g., genes, GC content) were visualized by Proksee (https://proksee.ca/ (accessed on 15 July 2024)). ARG sequences or SNPs conferring antibiotic resistance were assessed in paired reads and their genomes assembled with the BV-BRC (https://www.bv-brc.org/ (accessed on 1 July 2024)) and the CARD RGI (https://card.mcmaster.ca/analyze/rgi (version RGI 6.0.3, CARD 3.3.0, accessed on 10 July 2024)), respectively. Only those genes or SNPs that met the STRICT threshold criteria established by the CARD database and a query and template sequence pairwise identity of ≥90% were taken into account. Potential virulence factors were determined with the BV-BRC and VRprofile2 (https://tool2-mml.sjtu.edu.cn/VRprofile/VRprofile.php (accessed on 1 July 2024)). Prophage content in the F. canicola genomes was estimated with the PHASTEST web server (https://phastest.ca/ (accessed on 17 July 2024)). Prophage sequences were categorized as intact (score of >90), questionable (score of 70–90) and incomplete (score of <70). The phylogenetic relationship between the F. canicola isolates and other members of the Pasteurellaceae family, based on concatenated sequences of 16S rRNA, rpoB, infB and recN, were reconstructed with the neighbor-joining algorithm and p-distance model, supported by bootstrapping, with 1000 replications, as implemented in MEGA 11 [27]. One isolate with publicly available complete genome sequences from each species belonging to the Pasteurellaceae family was chosen for phylogenetic analysis.

5. Conclusions

Although we examined a low number of isolates, to the best of our knowledge, this study is the first comparative genome analysis of F. canicola isolates that provides deeper insight into the genetic factors driving virulence or antimicrobial drug resistance. Virulence-associated genes that might contribute to pathogenesis were not found in any of the investigated F. canicola genomes; therefore, F. canicola is presumed a commensal bacterial organism in the oral cavities of dogs rather than a pathogen. F. canicola is likely resistant to clindamycin, lincomycin and neomycin, however, penicillin, erythromycin and enrofloxacin showed excellent antibacterial activity against the isolates. ARGs were not detected in the F. canicola genomes; nevertheless, prophage-related sequences were identified, and so the possibility of resistance gene transfer between F. canicola and other oral bacterial strains cannot be ruled out. Despite the high genome-wide pairwise nucleotide identity of the F. canicola isolates, further investigation, including a greater number of isolates, as well as clinical samples, is needed to elucidate its role in disease development and the spread of drug resistance.

Author Contributions

Conceptualization, M.D. and T.M.; formal analysis, M.D., E.W. and M.T.; investigation, M.D., K.P., B.D.P. and Á.P.; data curation, M.D., K.P., B.D.P. and Á.P.; writing—original draft preparation, M.D.; writing—review and editing, K.P., E.W., M.T. and T.M.; visualization, M.D. All authors have read and agreed to the published version of the manuscript.

Funding

Krisztina Pintér was supported by the EKÖP-2024 University Researcher Scholarship Program of the Ministry for Culture and Innovation from the source of the National Research, Development and Innovation Fund. Additional support was provided by the National Laboratory for Infectious Animal Diseases, Antimicrobial Resistance, Veterinary Public Health and Food Chain Safety, RRF-2.3.1-21-2022-00001.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

Raw reads of the sequenced F. canicola isolates have been deposited to the NCBI Sequence Read Archive under BioProject ID PRJNA1161829.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Podar, N.A.; Carrell, A.A.; Cassidy, K.A.; Klingeman, D.M.; Yang, Z.; Stahler, E.A.; Smith, D.W.; Stahler, D.R.; Podar, M. From Wolves to Humans: Oral Microbiome Resistance to Transfer across Mammalian Hosts. mBio 2024, 15, e03342-23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Alessandri, G.; Fontana, F.; Mancabelli, L.; Tarracchini, C.; Lugli, G.A.; Argentini, C.; Longhi, G.; Rizzo, S.M.; Vergna, L.M.; Anzalone, R.; et al. Species-Level Characterization of Saliva and Dental Plaque Microbiota Reveals Putative Bacterial and Functional Biomarkers of Periodontal Diseases in Dogs. FEMS Microbiol. Ecol. 2024, 100, fiae082. [Google Scholar] [CrossRef] [Scilit]
  3. Tóth, A.G.; Tóth, I.; Rózsa, B.; Dubecz, A.; Patai, Á.V.; Németh, T.; Kaplan, S.; Kovács, E.G.; Makrai, L.; Solymosi, N. Canine Saliva as a Possible Source of Antimicrobial Resistance Genes. Antibiotics 2022, 11, 1490. [Google Scholar] [CrossRef] [Scilit]
  4. Lisjak, A.; Correa Lopes, B.; Pilla, R.; Nemec, A.; Suchodolski, J.S.; Tozon, N. A Comparison of the Oral Microbiota in Healthy Dogs and Dogs with Oral Tumors. Animals 2023, 13, 3594. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Krishnan, K.; Chen, T.; Paster, B. A Practical Guide to the Oral Microbiome and Its Relation to Health and Disease. Oral Dis. 2017, 23, 276–286. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Bedford, E. Number of Dogs in the United States from 2000 to 2017; American Pet Products Association: Stamford, CT, USA, 2019. [Google Scholar]
  7. Thomas, N.; Brook, I. Animal Bite-Associated Infections: Microbiology and Treatment. Expert Rev. Anti-Infect. Ther. 2011, 9, 215–226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Chatelier, E.; Mahieu, R.; Hamel, J.-F.; Chenouard, R.; Lozac’h, P.; Sallé, A.; Kouatchet, A.; Martin, L.; Lavigne, C.; Pailhoriès, H.; et al. Pasteurella Bacteraemia: Impact of Comorbidities on Outcome, Based on a Case Series and Literature Review. Int. J. Infect. Dis. 2020, 92, 89–96. [Google Scholar] [CrossRef] [Scilit]
  9. Bisgaard, M.; Mutters, R. Characterization of Some Previously Unclassified “Pasteurella” spp. Obtained from the Oral Cavity of Dogs and Cats and Description of a New Species Tentatively Classified with the Family Pasteurellaceae Pohl 1981 and Provisionally Called Taxon 16. Acta Pathol. Microbiol. Scand. Ser. B Microbiol. 1986, 94B, 177–184. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  10. Korczak, B.M.; Bisgaard, M.; Christensen, H.; Kuhnert, P. Frederiksenia Canicola Gen. Nov., Sp. Nov. Isolated from Dogs and Human Dog-Bite Wounds. Antonie Van Leeuwenhoek 2014, 105, 731–741. [Google Scholar] [CrossRef] [Scilit]
  11. Brix, L.; Hansen, M.J.; Kelly, A.; Bertelsen, M.F.; Bojesen, A.M. Occurrence of Pasteurellaceae Bacteria in the Oral Cavity of the Tasmanian Devil (Sarcophilus harrisii). J. Zoo Wildl. Med. 2015, 46, 241–245. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Hansen, M.J.; Bertelsen, M.F.; Kelly, A.; Bojesen, A.M. Occurrence of Pasteurellaceae Bacteria in the Oral Cavity of Selected Marsupial Species. J. Zoo Wildl. Med. 2017, 48, 1215–1218. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Ujvári, B.; Orbán, B.; Incze, Z.; Psáder, R.; Magyar, T. Occurrence of Pasteurellaceae and Neisseriaceae Bacteria in the Pharyngeal and Respiratory Tract of Dogs and Cats—Short Communication. Acta Vet. Hung. 2020, 68, 231–235. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Rosas-Salazar, C.; Kimura, K.S.; Shilts, M.H.; Strickland, B.A.; Freeman, M.H.; Wessinger, B.C.; Gupta, V.; Brown, H.M.; Boone, H.H.; Rajagopala, S.V.; et al. Upper Respiratory Tract Microbiota Dynamics Following COVID-19 in Adults. Microb. Genom. 2023, 9, 000957. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Kaszab, E.; Laczkó, L.; Kardos, G.; Bányai, K. Antimicrobial Resistance Genes and Associated Mobile Genetic Elements in Lactobacillales from Various Sources. Front. Microbiol. 2023, 14, 1281473. [Google Scholar] [CrossRef] [Scilit]
  16. Erika, E.; Scarpellini, R.; Celli, G.; Marliani, G.; Zaghini, A.; Mondo, E.; Rossi, G.; Piva, S. Wild Birds as Potential Bioindicators of Environmental Antimicrobial Resistance: A Preliminary Investigation. Res. Vet. Sci. 2024, 180, 105424. [Google Scholar] [CrossRef] [Scilit]
  17. Templeton, G.B.; Fefer, G.; Case, B.C.; Roach, J.; Azcarate-Peril, M.A.; Gruen, M.E.; Callahan, B.J.; Olby, N.J. Longitudinal Analysis of Canine Oral Microbiome Using Whole Genome Sequencing in Aging Companion Dogs. Animals 2023, 13, 3846. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Gutman, N.; Hansen, M.J.; Bertelsen, M.F.; Bojesen, A.M. Pasteurellaceae Bacteria from the Oral Cavity of Tasmanian Devils (Sarcophilus harrisii) Show High Minimum Inhibitory Concentration Values towards Aminoglycosides and Clindamycin. Lett. Appl. Microbiol. 2016, 62, 237–242. [Google Scholar] [CrossRef] [Scilit]
  19. Michael, G.B.; Bossé, J.T.; Schwarz, S. Antimicrobial Resistance in Pasteurellaceae of Veterinary Origin. Microbiol. Spectr. 2018, 6, 1–33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  20. Fillol-Salom, A.; Martínez-Rubio, R.; Abdulrahman, R.F.; Chen, J.; Davies, R.; Penadés, J.R. Phage-Inducible Chromosomal Islands Are Ubiquitous within the Bacterial Universe. ISME J. 2018, 12, 2114–2128. [Google Scholar] [CrossRef] [Scilit]
  21. Peng, Z.; Wang, X.; Zhou, R.; Chen, H.; Wilson, B.A.; Wu, B. Pasteurella multocida: Genotypes and Genomics. Microbiol. Mol. Biol. Rev. 2019, 83, e00014-19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Pullinger, G.D.; Bevir, T.; Lax, A.J. The Pasteurella multocida Toxin Is Encoded within a Lysogenic Bacteriophage. Mol. Microbiol. 2004, 51, 255–269. [Google Scholar] [CrossRef] [Scilit]
  23. Gong, X.; Cui, Q.; Zhang, W.; Shi, Y.; Zhang, P.; Zhang, C.; Hu, G.; Sahin, O.; Wang, L.; Shen, Z.; et al. Genomic Insight into the Diversity of Glaesserella parasuis Isolates from 19 Countries. mSphere 2024, 9, e00231-24. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals—Approved Standard, 2nd ed.; Document M31-A2; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2002. [Google Scholar]
  25. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals, 3rd ed.; CLSI Supplement VET01S, Approved Standard; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2015. [Google Scholar]
  26. Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C.; et al. Geneious Basic: An Integrated and Extendable Desktop Software Platform for the Organization and Analysis of Sequence Data. Bioinformatics 2012, 28, 1647–1649. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [Scilit]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Article Metrics

Citations

Article Access Statistics

Multiple requests from the same IP address are counted as one view.