Solid-State Fermentation of Wheat Bran with Clostridium butyricum: Impact on Microstructure, Nutrient Release, Antioxidant Capacity, and Alleviation of Ulcerative Colitis in Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Fermentation Procedure
2.3. Microstructure of Bran
2.4. Water-Extractable Arabinoxylans, Dietary Fiber, and Phytic Acid Content Detection
2.5. Extraction of Phenolic Compounds and Content Detection
2.6. In Vitro Antioxidant Activity Measurement
2.7. Bacteriostatic Activity
2.8. Untargeted Metabolomics
2.9. Animal Experiments
2.10. Histopathological Analysis of Colon Tissue
2.11. Immunohistochemical Analysis
2.12. Enzyme-Linked Immunosorbent Assay
2.13. Quantitative Real-Time PCR
2.14. Gut Microbiota Analysis
2.15. Levels of Short-Chain Fatty Acids in Feces
2.16. Statistical Analysis
3. Results and Discussion
3.1. Changes in Structure and Nutrient Composition of Bran before and after Fermentation with C. butyricum
3.2. Evaluation of Antioxidant Activity and Bacteriostatic Capability of Fermented Bran In Vitro
3.3. Significant Increase in Phenolic Acids and Flavonoids in FB
3.4. Synergistic Action of FB Components Mitigates Colitis in Mice
3.5. FB Reduces Oxidative Stress and Inflammatory Response in Mice with Colitis
3.6. FB Enhances Intestinal Barrier Function in Mice with Colitis
3.7. FB Modulates Gut Microbiota Structure and Function in Mice with Colitis
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Lizardi-Jimenez, M.A.; Hernandez-Martinez, R. Solid state fermentation (SSF): Diversity of applications to valorize waste and biomass. 3 Biotech 2017, 7, 44. [Google Scholar] [CrossRef]
- Chilakamarry, C.R.; Mimi Sakinah, A.M.; Zularisam, A.W.; Sirohi, R.; Khilji, I.A.; Ahmad, N.; Pandey, A. Advances in solid-state fermentation for bioconversion of agricultural wastes to value-added products: Opportunities and challenges. Bioresour. Technol. 2022, 343, 126065. [Google Scholar] [CrossRef]
- Kumar, V.; Ahluwalia, V.; Saran, S.; Kumar, J.; Patel, A.K.; Singhania, R.R. Recent developments on solid-state fermentation for production of microbial secondary metabolites: Challenges and solutions. Bioresour. Technol. 2021, 323, 124566. [Google Scholar] [CrossRef]
- De Villa, R.; Roasa, J.; Mine, Y.; Tsao, R. Impact of solid-state fermentation on factors and mechanisms influencing the bioactive compounds of grains and processing by-products. Crit. Rev. Food Sci. 2023, 63, 5388–5413. [Google Scholar] [CrossRef]
- Egbune, E.O.; Ezedom, T.; Orororo, O.C.; Egbune, O.U.; Avwioroko, O.J.; Aganbi, E.; Anigboro, A.A.; Tonukari, N.J. Solid-state fermentation of cassava (Manihot esculenta Crantz): A review. World J. Microb. Biot. 2023, 39, 259. [Google Scholar] [CrossRef]
- Bartkiene, E.; Krungleviciute, V.; Juodeikiene, G.; Vidmantiene, D.; Maknickiene, Z. Solid state fermentation with lactic acid bacteria to improve the nutritional quality of lupin and soya bean. J. Sci. Food Agric. 2015, 95, 1336–1342. [Google Scholar] [CrossRef]
- Gupta, S.; Lee, J.J.L.; Chen, W.N. Analysis of Improved Nutritional Composition of Potential Functional Food (Okara) after Probiotic Solid-State Fermentation. J. Agric. Food Chem. 2018, 66, 5373–5381. [Google Scholar] [CrossRef]
- Karabulut, G.; Nemzer, B.V.; Feng, H. -Aminobutyric Acid (GABA)-enriched Hemp Milk by Solid-state Co-fermentation and Germination Bioprocesses. Plant Food Hum. Nutr. 2024, 79, 322–329. [Google Scholar] [CrossRef]
- Martelli, F.; Cirlini, M.; Lazzi, C.; Neviani, E.; Bernini, V. Solid-State Fermentation of to Implement New Food Products: Evaluation of Stabilization Treatments and Bacterial Growth on the Volatile Fraction. Foods 2021, 10, 67. [Google Scholar] [CrossRef]
- Calinoiu, L.F.; Catoi, A.F.; Vodnar, D.C. Solid-State Yeast Fermented Wheat and Oat Bran as a Route for Delivery of Antioxidants. Antioxidants 2019, 8, 372. [Google Scholar] [CrossRef]
- Figueiredo, C.C.M.; Granero, F.O.; Silva, L.P.; Nogueira, I.F.A.; de Souza, J.F.; Escaramboni, B.; Neto, P.D.; da Silva, R.M.G. Solid-state fermentation using wheat bran to produce glucose syrup and functional cereal bars. Bioprocess Biosyst. Eng. 2024, 47, 1081–1094. [Google Scholar] [CrossRef]
- Chen, Z.W.; Mense, A.L.; Brewer, L.R.; Shi, Y.C. Wheat bran layers: Composition, structure, fractionation, and potential uses in foods. Crit. Rev. Food Sci. 2024, 64, 6636–6659. [Google Scholar] [CrossRef]
- Katileviciute, A.; Plakys, G.; Budreviciute, A.; Onder, K.; Damiati, S.; Kodzius, R. A Sight to Wheat Bran: High Value-Added Products. Biomolecules 2019, 9, 887. [Google Scholar] [CrossRef]
- Venkataraman, S.; Vaidyanathan, V.K. Dephytinization of wheat and rice bran by cross-linked enzyme aggregates of phytase: A viable prospect for food and feed industries. J. Sci. Food Agr. 2023, 103, 1935–1945. [Google Scholar] [CrossRef]
- Javed, M.M.; Zahoor, S.; Shafaat, S.; Mehmooda, I.; Gul, A.; Rasheed, H.; Bukhari, S.A.I.; Aftab, M.N.; Ikram-ul-Haq. Wheat bran as a brown gold: Nutritious value and its biotechnological applications. Afr. J. Microbiol. Res. 2012, 6, 724–733. [Google Scholar] [CrossRef]
- Onipe, O.O.; Ramashia, S.E.; Jideani, A.I.O. Wheat Bran Modifications for Enhanced Nutrition and Functionality in Selected Food Products. Molecules 2021, 26, 3918. [Google Scholar] [CrossRef]
- Stoeva, M.K.; Garcia-So, J.; Justice, N.; Myers, J.; Tyagi, S.; Nemchek, M.; McMurdie, P.J.; Kolterman, O.; Eid, J. Butyrate-producing human gut symbiont, Clostridium butyricum, and its role in health and disease. Gut Microbes 2021, 13, 1–28. [Google Scholar] [CrossRef]
- Mann, E.R.; Lam, Y.K.; Uhlig, H.H. Short-chain fatty acids: Linking diet, the microbiome and immunity. Nat. Rev. Immunol. 2024, 24, 577–595. [Google Scholar] [CrossRef]
- Jiao, P.; Wang, Z.; Wang, X.; Zuo, Y.; Yang, Y.; Hu, G.; Lu, C.; Xie, X.; Wang, L.; Yang, W. Effect of Clostridium butyricum Supplementation on in vitro Rumen Fermentation and Microbiota With High Grain Substrate Varying With Media pH Levels. Front. Microbiol. 2022, 13, 912042. [Google Scholar] [CrossRef]
- Agagunduz, D.; Yilmaz, B.; Kocak, T.; Altintas Basar, H.B.; Rocha, J.M.; Ozogul, F. Novel Candidate Microorganisms for Fermentation Technology: From Potential Benefits to Safety Issues. Foods 2022, 11, 3074. [Google Scholar] [CrossRef]
- Li, Y.; Zhang, Y.; Dong, L.; Li, Y.; Liu, Y.; Liu, Y.; Liu, L.; Liu, L. Fermentation of Lactobacillus fermentum NB02 with feruloyl esterase production increases the phenolic compounds content and antioxidant properties of oat bran. Food Chem. 2024, 437, 137834. [Google Scholar] [CrossRef]
- Zhang, D.; Ye, Y.; Tan, B. Comparative study of solid-state fermentation with different microbial strains on the bioactive compounds and microstructure of brown rice. Food Chem. 2022, 397, 133735. [Google Scholar] [CrossRef]
- Liu, L.; Guo, J.; Zhang, R.; Wei, Z.; Deng, Y.; Guo, J.; Zhang, M. Effect of degree of milling on phenolic profiles and cellular antioxidant activity of whole brown rice. Food Chem. 2015, 185, 318–325. [Google Scholar] [CrossRef]
- Lin, M.Y.; Yen, C.L. Antioxidative ability of lactic acid bacteria. J. Agric. Food Chem. 1999, 47, 1460–1466. [Google Scholar] [CrossRef]
- Mei, Z.W.; Huang, X.X.; Zhang, H.; Cheng, D.Y.; Xu, X.; Fang, M.Y.; Hu, J.T.; Liu, Y.Y.; Liang, Y.X.; Mei, Y.X. Chitin derivatives ameliorate DSS-induced ulcerative colitis by changing gut microbiota and restoring intestinal barrier function. Int. J. Biol. Macromol. 2022, 202, 375–387. [Google Scholar] [CrossRef]
- Huang, X.; Hu, J.; Zhang, H.; Li, J.; Zhu, X.; Liu, Y.; Liang, Y.; Mei, Y. Clostridium butyricum and Chitooligosaccharides in Synbiotic Combination Ameliorate Symptoms in a DSS-Induced Ulcerative Colitis Mouse Model by Modulating Gut Microbiota and Enhancing Intestinal Barrier Function. Microbiol. Spectr. 2023, 11, e0437022. [Google Scholar] [CrossRef]
- Liu, Y.; Zhang, H.; Xie, A.; Sun, J.; Yang, H.; Li, J.; Li, Y.; Chen, F.; Mei, Y.; Liang, Y. Lactobacillus rhamnosus and L. plantarum Combination Treatment Ameliorated Colitis Symptoms in a Mouse Model by Altering Intestinal Microbial Composition and Suppressing Inflammatory Response. Mol. Nutr. Food Res. 2023, 67, e2200340. [Google Scholar] [CrossRef]
- Gill, S.K.; Rossi, M.; Bajka, B.; Whelan, K. Dietary fibre in gastrointestinal health and disease. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 101–116. [Google Scholar] [CrossRef]
- Nawirska, A.; Kwasniewska, M. Dietary fibre fractions from fruit and vegetable processing waste. Food Chemistry 2005, 91, 221–225. [Google Scholar] [CrossRef]
- Rhodes, J.M. Nutrition and gut health: The impact of specific dietary components—It’s not just five-a-day. Proc. Nutr. Soc. 2021, 80, 9–18. [Google Scholar] [CrossRef]
- Hussain, M.; Saeed, F.; Niaz, B.; Imran, A.; Tufail, T. Biochemical and Structural Characterization of Ferulated Arabinoxylans Extracted from Nixtamalized and Non-Nixtamalized Maize Bran. Foods 2022, 11, 3374. [Google Scholar] [CrossRef]
- Arjmand, S.; Mollakhalili-Meybodi, N.; Akrami Mohajeri, F.; Madadizadeh, F.; Khalili Sadrabad, E. Quinoa dough fermentation by Saccharomyces cerevisiae and lactic acid bacteria: Changes in saponin, phytic acid content, and antioxidant capacity. Food Sci. Nutr. 2023, 11, 7594–7604. [Google Scholar] [CrossRef]
- Fischer, M.M.; Egli, I.M.; Aeberli, I.; Hurrell, R.F.; Meile, L. Phytic acid degrading lactic acid bacteria in tef-injera fermentation. Int. J. Food Microbiol. 2014, 190, 54–60. [Google Scholar] [CrossRef]
- Matsumura, Y.; Kitabatake, M.; Kayano, S.I.; Ito, T. Dietary Phenolic Compounds: Their Health Benefits and Association with the Gut Microbiota. Antioxidants 2023, 12, 880. [Google Scholar] [CrossRef]
- Rana, A.; Samtiya, M.; Dhewa, T.; Mishra, V.; Aluko, R.E. Health benefits of polyphenols: A concise review. J. Food Biochem. 2022, 46, e14264. [Google Scholar] [CrossRef]
- Pérez-Torres, I.; Castrejón-Téllez, V.; Soto, M.E.; Rubio-Ruiz, M.E.; Manzano-Pech, L.; Guarner-Lans, V. Oxidative Stress, Plant Natural Antioxidants, and Obesity. Int. J. Mol. Sci. 2021, 22, 1786. [Google Scholar] [CrossRef]
- Ayyash, M.; Johnson, S.K.; Liu, S.Q.; Mesmari, N.; Dahmani, S.; Al Dhaheri, A.S.; Kizhakkayil, J. In vitro investigation of bioactivities of solid-state fermented lupin, quinoa and wheat using Lactobacillus spp. Food Chem. 2019, 275, 50–58. [Google Scholar] [CrossRef]
- Chen, D.; Jin, D.; Huang, S.; Wu, J.; Xu, M.; Liu, T.; Dong, W.; Liu, X.; Wang, S.; Zhong, W.; et al. Clostridium butyricum, a butyrate-producing probiotic, inhibits intestinal tumor development through modulating Wnt signaling and gut microbiota. Cancer Lett. 2020, 469, 456–467. [Google Scholar] [CrossRef]
- Leonard, W.; Zhang, P.; Ying, D.; Fang, Z. Hydroxycinnamic acids on gut microbiota and health. Compr. Rev. Food Sci. Food Saf. 2021, 20, 710–737. [Google Scholar] [CrossRef]
- Valencia-Hernandez, L.J.; Wong-Paz, J.E.; Ascacio-Valdés, J.A.; Chávez-González, M.L.; Contreras-Esquivel, J.C.; Aguilar, C.N. Procyanidins: From Agro-Industrial Waste to Food as Bioactive Molecules. Foods 2021, 10, 3152. [Google Scholar] [CrossRef]
- Salehi, B.; Venditti, A.; Sharifi-Rad, M.; Kregiel, D.; Sharifi-Rad, J.; Durazzo, A.; Lucarini, M.; Santini, A.; Souto, E.B.; Novellino, E.; et al. The Therapeutic Potential of Apigenin. Int. J. Mol. Sci. 2019, 20, 1305. [Google Scholar] [CrossRef]
- Ross, J.A.; Kasum, C.M. Dietary flavonoids: Bioavailability, metabolic effects, and safety. Annu. Rev. Nutr. 2002, 22, 19–34. [Google Scholar] [CrossRef]
- Ungaro, R.; Mehandru, S.; Allen, P.B.; Peyrin-Biroulet, L.; Colombel, J.F. Ulcerative colitis. Lancet 2017, 389, 1756–1770. [Google Scholar] [CrossRef]
- da Silva, A.P.; Ellen, R.P.; Sorensen, E.S.; Goldberg, H.A.; Zohar, R.; Sodek, J. Osteopontin attenuation of dextran sulfate sodium-induced colitis in mice. Lab. Investig. 2009, 89, 1169–1181. [Google Scholar] [CrossRef]
- Zeinali, M.; Rezaee, S.A.; Hosseinzadeh, H. An overview on immunoregulatory and anti-inflammatory properties of chrysin and flavonoids substances. Biomed. Pharmacother. 2017, 92, 998–1009. [Google Scholar] [CrossRef]
- Jacob, N.; Targan, S.R.; Shih, D.Q. Cytokine and anti-cytokine therapies in prevention or treatment of fibrosis in IBD. United Eur. Gastroenterol. J. 2016, 4, 531–540. [Google Scholar] [CrossRef]
- Uhlig, H.H.; Schwerd, T.; Koletzko, S.; Shah, N.; Kammermeier, J.; Elkadri, A.; Ouahed, J.; Wilson, D.C.; Travis, S.P.; Turner, D.; et al. The Diagnostic Approach to Monogenic Very Early Onset Inflammatory Bowel Disease. Gastroenterology 2014, 147, 990–1007. [Google Scholar] [CrossRef]
- Konig, J.; Wells, J.; Cani, P.D.; Garcia-Rodenas, C.L.; MacDonald, T.; Mercenier, A.; Whyte, J.; Troost, F.; Brummer, R.J. Human Intestinal Barrier Function in Health and Disease. Clin. Transl. Gastroenterol. 2016, 7, e196. [Google Scholar] [CrossRef]
- Chang, C.S.; Liao, Y.C.; Huang, C.T.; Lin, C.M.; Cheung, C.H.Y.; Ruan, J.W.; Yu, W.H.; Tsai, Y.T.; Lin, I.J.; Huang, C.H.; et al. Identification of a gut microbiota member that ameliorates DSS-induced colitis in intestinal barrier enhanced Dusp6-deficient mice. Cell Rep. 2021, 37, 110016. [Google Scholar] [CrossRef]
- Pittayanon, R.; Lau, J.T.; Leontiadis, G.I.; Tse, F.; Yuan, Y.H.; Surette, M.; Moayyedi, P. Differences in Gut Microbiota in Patients With vs Without Inflammatory Bowel Diseases: A Systematic Review. Gastroenterology 2020, 158, 930–946. [Google Scholar] [CrossRef]
Target | Primer (5′—3′) | Product Length (bp) |
---|---|---|
β-Actin | F: GGCTGTATTCCCCTCCATCG | 154 |
R: CCAGTTGGTAACAATGCCATGT | ||
MUC2 | F: ATGCCCACCTCCTCAAAGAC | 101 |
R: GTAGTTTCCGTTGGAACAGTGAA | ||
ZO-1 | F: GAGTGGACTATCAAGTGAGCCTAA | 137 |
R: ATCCAAGTTGCTCGTCAATCTAA | ||
Claudin-1 | F: CGACTCCTTGCTGAATCTGA | 390 |
R: CGTGGTGTTGGGTAAGAGGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, H.; Zhang, M.; Zheng, X.; Xu, X.; Zheng, J.; Hu, Y.; Mei, Y.; Liu, Y.; Liang, Y. Solid-State Fermentation of Wheat Bran with Clostridium butyricum: Impact on Microstructure, Nutrient Release, Antioxidant Capacity, and Alleviation of Ulcerative Colitis in Mice. Antioxidants 2024, 13, 1259. https://doi.org/10.3390/antiox13101259
Zhang H, Zhang M, Zheng X, Xu X, Zheng J, Hu Y, Mei Y, Liu Y, Liang Y. Solid-State Fermentation of Wheat Bran with Clostridium butyricum: Impact on Microstructure, Nutrient Release, Antioxidant Capacity, and Alleviation of Ulcerative Colitis in Mice. Antioxidants. 2024; 13(10):1259. https://doi.org/10.3390/antiox13101259
Chicago/Turabian StyleZhang, Heng, Min Zhang, Xin Zheng, Xiaofang Xu, Jiawen Zheng, Yuanliang Hu, Yuxia Mei, Yangyang Liu, and Yunxiang Liang. 2024. "Solid-State Fermentation of Wheat Bran with Clostridium butyricum: Impact on Microstructure, Nutrient Release, Antioxidant Capacity, and Alleviation of Ulcerative Colitis in Mice" Antioxidants 13, no. 10: 1259. https://doi.org/10.3390/antiox13101259
APA StyleZhang, H., Zhang, M., Zheng, X., Xu, X., Zheng, J., Hu, Y., Mei, Y., Liu, Y., & Liang, Y. (2024). Solid-State Fermentation of Wheat Bran with Clostridium butyricum: Impact on Microstructure, Nutrient Release, Antioxidant Capacity, and Alleviation of Ulcerative Colitis in Mice. Antioxidants, 13(10), 1259. https://doi.org/10.3390/antiox13101259