Dietary Antimicrobial Peptides Improve Intestinal Function, Microbial Composition and Oxidative Stress Induced by Aeromonas hydrophila in Pengze Crucian Carp (Carassius auratus var. Pengze)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Experimental Fish, Diets, and Experimental Design
2.3. Sample Collection
2.4. Intestinal Morphological Analysis
2.5. Biochemical Parameter Analysis
2.6. Gene Expression Analysis
2.7. 16S Sequencing and Intestinal Microbial Analysis
2.8. Aeromonas Hydrophila Infection Analysis
2.8.1. Vitro Antibacterial Test
2.8.2. Vivo infection Test
2.9. Statistical Analysis
3. Results
3.1. AMPs Alter Intestinal Morphology
3.2. AMPs Affect Intestinal Biochemical Parameters
3.3. AMPs Regulate Intestinal Immune-Related Gene Expression
3.4. AMPs Supplementation and Intestinal Microbiota Diversity
3.5. AMPs Extracts’ In Vitro Bacteriostatic Efficacy against Aeromonas hydrophila
3.6. AMPs Improve the Resistance of the Intestinal Ecosystem to Aeromonas hydrophila Infection
3.6.1. AMPs Reduce Intestinal Damage after Aeromonas hydrophila Infection
3.6.2. AMPs Increase Intestinal Immune-Related Gene Expression after Aeromonas hydrophila infection
3.6.3. AMPs Ameliorate Intestinal Microbiota Diversity after Aeromonas hydrophila Infection
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Jia, F.; Wang, J.; Zhang, L.; Zhou, J.; He, Y.; Lu, Y.; Liu, K.; Yan, W.; Wang, K. Multiple action mechanism and in vivo antimicrobial efficacy of antimi-crobial peptide Jelleine-I. J. Pept. Sci. 2021, 27, e3294. [Google Scholar] [CrossRef] [PubMed]
- Martens, E.; Demain, A.L. The antibiotic resistance crisis, with a focus on the United States. J. Antibiot. 2017, 70, 520–526. [Google Scholar] [CrossRef] [PubMed]
- Shi, Y.; Li, C.; Wang, M.; Chen, Z.; Luo, Y.; Xia, X.S.; Song, Y.; Sun, Y.; Zhang, A.M. Cathelicidin-DM is an Antimicrobial Peptide from Duttaphrynus mel-anostictus and Has Wound-Healing Therapeutic Potential. ACS Omega 2020, 5, 9301–9310. [Google Scholar] [CrossRef] [PubMed]
- Lazzaro, B.P.; Zasloff, M.; Rolff, J. Antimicrobial peptides: Application informed by evolution. Science 2020, 368, eaau5480. [Google Scholar] [CrossRef]
- Nawrot, R.; Barylski, J.; Nowicki, G.; Broniarczyk, J.; Buchwald, W.; Goździcka-Józefiak, A. Plant antimicrobial peptides. Folia Microbiol. 2014, 59, 181–196. [Google Scholar] [CrossRef]
- Van Hoek, M.L. Antimicrobial Peptides in Reptiles. Pharmaceuticals 2014, 7, 723–753. [Google Scholar] [CrossRef]
- Zasloff, M. Antimicrobial peptides of multicellular organisms. Nature 2002, 415, 389–395. [Google Scholar] [CrossRef]
- Hutchings, M.I.; Truman, A.W.; Wilkinson, B. Antibiotics: Past, present and future. Curr. Opin. Microbiol. 2019, 51, 72–80. [Google Scholar] [CrossRef]
- Ma, Z.; Yang, J.; Han, J.; Gao, L.; Liu, H.; Lu, Z.; Zhao, H.; Bie, X. Insights into the Antimicrobial Activity and Cytotoxicity of Engineered α-Helical Peptide Amphiphiles. J. Med. Chem. 2016, 59, 10946–10962. [Google Scholar] [CrossRef]
- Domalaon, R.; Idowu, T.; Zhanel, G.G.; Schweizer, F. Antibiotic Hybrids: The Next Generation of Agents and Adjuvants against Gram-Negative Pathogens? Clin. Microbiol. Rev. 2018, 31, e17–77. [Google Scholar] [CrossRef] [Green Version]
- Garbacz, K.; Kamysz, W.; Piechowicz, L. Activity of antimicrobial peptides, alone or combined with conventional antibiotics, against Staphylococcus aureus isolated from the airways of cystic fibrosis patients. Virulence 2017, 8, 94–100. [Google Scholar] [CrossRef] [PubMed]
- Yoon, J.H.; Ingale, S.L.; Kim, J.S.; Kim, K.H.; Lee, S.H.; Park, Y.K.; Lee, S.C.; Kwon, I.K.; Chae, B.J. Effects of dietary supplementation of synthetic antimicrobi-al peptide-A3 and P5 on growth performance, apparent total tract digestibility of nutrients, fecal and intestinal microflora and intestinal morphology in weanling pigs. Livest. Sci. 2014, 159, 53–60. [Google Scholar] [CrossRef]
- Wu, S.; Zhang, F.; Huang, Z.; Liu, H.; Xie, C.; Zhang, J.; Thacker, P.A.; Qiao, S. Effects of the antimicrobial peptide cecropin AD on performance and intestinal health in weaned piglets challenged with Escherichia coli. Peptides 2012, 35, 225–230. [Google Scholar] [CrossRef] [PubMed]
- Cutler, S.A.; Lonergan, S.M.; Cornick, N.; Johnson, A.K.; Stahl, C.H. Dietary Inclusion of Colicin E1 Is Effective in Preventing Postweaning Diarrhea Caused by F18-Positive Escherichia coli in Pigs. Antimicrob. Agents Chemother. 2007, 51, 3830–3835. [Google Scholar] [CrossRef]
- Baldissera, M.D.; Souza, C.F.; Parmeggiani, B.; Leipnitz, G.; Verdi, C.M.; Santos, R.; Stefani, L.M.; Baldisserotto, B. The disturbance of antioxidant/oxidant balance in fish experimentally infected by Aeromonas caviae: Relationship with disease pathophysiology. Microb. Pathog. 2018, 122, 53–57. [Google Scholar] [CrossRef]
- Su, Y.; Feng, J.; Li, Y.; Bai, J.; Li, A. Development of a quantitative PCR assay for monitoring Streptococcus agalactiae coloni-zation and tissue tropism in experimentally infected tilapia. J. Fish Dis. 2016, 39, 229–238. [Google Scholar] [CrossRef]
- Nguyen, T.V.; Alfaro, A.; Arroyo, B.B.; Leon, J.A.R.; Sonnenholzner, S. Metabolic responses of penaeid shrimp to acute hepato-pancreatic necrosis disease caused by Vibrio parahaemolyticus. Aquaculture 2021, 533, 736174. [Google Scholar] [CrossRef]
- Su, Y.; Chen, G.; Chen, L.; Li, J.; Wang, G.; He, J.; Zhan, T.Y.; Li, Y.W.; Yan, M.T.; Huang, Y.H.; et al. Effects of antimicrobial peptides on serum biochemical parameters, anti-oxidant activity and non-specific immune responses in Epinephelus coioides. Fish Shellfish Immun. 2019, 86, 1081–1087. [Google Scholar] [CrossRef] [PubMed]
- Rashidian, G.; Moghaddam, M.M.; Mirnejad, R.; Azad, Z.M. Supplementation of zebrafish (Danio rerio) diet using a short antimicrobial peptide: Evaluation of growth performance, immunomodulatory function, antioxidant activity, and disease resistance. Fish Shellfish Immunol. 2021, 119, 42–50. [Google Scholar] [CrossRef]
- Ke, F.; Xie, P.; Yang, Y.; Yan, L.; Guo, A.; Yang, J.; Zhang, J.; Liu, L.; Wang, Q.; Gao, X. Effects of Nisin, Cecropin, and Penthorum chinense Pursh on the Intesti-nal Microbiome of Common Carp (Cyprinus carpio). Front. Nutr. 2021, 8, 729437. [Google Scholar] [CrossRef]
- Liu, S.; Wang, S.; Liu, X.; Wen, L.; Zou, J. Effects of dietary antimicrobial peptides on intestinal morphology, antioxidant sta-tus, immune responses, microbiota and pathogen disease resistance in grass carp Ctenopharyngodon idellus. Microb. Pathog. 2022, 165, 105386. [Google Scholar] [CrossRef]
- Wang, Y.; Li, J.; Dai, X.; Wang, Z.; Ni, X.; Zeng, D.; Zeng, Y.; Zhang, D.; Pan, K. Effects of Antimicrobial Peptides Gal-13 on the Growth Performance, Intestinal Microbiota, Digestive Enzyme Activities, Intestinal Morphology, Antioxidative Activities, and Immunity of Broilers. Probiotics Antimicrob. Proteins 2022. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Zhan, Y.; Ma, W.; Zhu, Y.; Wang, Z. Effects of Antimicrobial peptides on egg production, egg quality and caecal microbiota of hens during the late laying period. Anim. Sci. J. 2020, 91, e13387. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.; Yao, S.; Chen, Y.; Gao, S.; Yang, Y.; Deng, J.; Ren, Z.; Shen, L.; Cui, H.; Hu, Y.; et al. Use of antimicrobial peptides as a feed additive for juvenile goats. Sci. Rep. 2017, 7, 12254. [Google Scholar] [CrossRef]
- Lynch, S.V.; Pedersen, O. The Human Intestinal Microbiome in Health and Disease. N. Engl. J. Med. 2016, 375, 2369–2379. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Xie, S.; Zhou, A.; Zhang, C.; Wen, L.; Xu, G.; Zou, J. Effects of mixed antimicrobial peptide on the growth performance, antioxidant and immune responses and disease resistance of Pengze crucian carp (Carassius auratus var. Pengze). Fish Shellfish Immunol. 2021, 114, 112–118. [Google Scholar] [CrossRef] [PubMed]
- Magoč, T.; Salzberg, S.L. FLASH: Fast length adjustment of short reads to improve genome assemblies. Bioinformatics 2011, 27, 2957–2963. [Google Scholar] [CrossRef]
- Edgar, R.C.; Haas, B.J.; Clemente, J.C.; Quince, C.; Knight, R. UCHIME improves sensitivity and speed of chimera detection. Bioinformatics 2011, 27, 2194–2200. [Google Scholar] [CrossRef]
- Edgar, R.C. UPARSE: Highly accurate OTU sequences from microbial amplicon reads. Nat. Methods 2013, 10, 996–998. [Google Scholar] [CrossRef]
- Chao, A.; Lee, S.-M. Estimating the Number of Classes via Sample Coverage. J. Am. Stat. Assoc. 1992, 87, 210. [Google Scholar] [CrossRef]
- Jiang, X.; Peng, X.; Deng, G.; Sheng, H.; Wang, Y.; Zhou, H.; Tam, N.F.-Y. Illumina Sequencing of 16S rRNA Tag Revealed Spatial Varia-tions of Bacterial Communities in a Mangrove Wetland. Microb. Ecol. 2013, 66, 96–104. [Google Scholar] [CrossRef] [PubMed]
- Langille, M.G.I.; Zaneveld, J.; Caporaso, J.G.; McDonald, D.; Knights, D.; Reyes, J.A.; Clemente, J.C.; Burkepile, D.E.; Thurber, R.L.V.; Knight, R.; et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nat. Biotechnol. 2013, 31, 814–821. [Google Scholar] [CrossRef] [PubMed]
- Di, G.; Li, H.; Zhang, C.; Zhao, Y.; Zhou, C.; Naeem, S.; Kong, X. Label-free proteomic analysis of intestinal mucosa proteins in com-mon carp (Cyprinus carpio) infected with Aeromonas hydrophila. Fish Shellfish Immunol. 2017, 66, 11–25. [Google Scholar] [CrossRef]
- Blikslager, A.T.; Moeser, A.; Gookin, J.; Jones, S.; Odle, J. Restoration of Barrier Function in Injured Intestinal Mucosa. Physiol. Rev. 2007, 87, 545–564. [Google Scholar] [CrossRef] [PubMed]
- Yin, J.; Li, Y.; Han, H.; Liu, Z.; Zeng, X.; Li, T.; Yin, Y. Long-term effects of lysine concentration on growth performance, intestinal microbiome, and metabolic profiles in a pig model. Food Funct. 2018, 9, 4153–4163. [Google Scholar] [CrossRef]
- Li, C.; Wang, J.; Zhang, H.; Wu, S.; Hui, Q.; Yang, C.; Fang, R.; Qi, G. Intestinal Morphologic and Microbiota Responses to Dietary Bacillus spp. in a Broiler Chicken Model. Front. Physiol. 2019, 9, 1968. [Google Scholar] [CrossRef]
- Infante, J.L.Z.; Cahu, C.L. Ontogeny of the gastrointestinal tract of marine fish larvae. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2001, 130, 477–487. [Google Scholar] [CrossRef]
- Yin, Z.; Liu, Q.; Liu, Y.; Gao, S.; He, Y.; Yao, C.; Huang, W.; Gong, Y.; Mai, K.; Ai, Q. Early Life Intervention Using Probiotic Clostridium butyricum Improves Intestinal Development, Immune Response, and Gut Microbiota in Large Yellow Croaker (Larimichthys crocea) Larvae. Front. Immunol. 2021, 12, 640767. [Google Scholar] [CrossRef]
- Limbach, J.R.; Espinosa, C.D.; Perez-Calvo, E.; Stein, H.H. Effect of dietary crude protein level on growth performance, blood characteristics, and indicators of intestinal health in weanling pigs. J. Anim. Sci. 2021, 99, b166. [Google Scholar] [CrossRef]
- Yu, C.; Zhang, J.; Qin, Q.; Liu, J.; Xu, J.; Xu, W. Berberine improved intestinal barrier function by modulating the intestinal mi-crobiota in blunt snout bream (Megalobrama amblycephala) under dietary high-fat and high-carbohydrate stress. Fish Shellfish Immunol. 2020, 102, 336–349. [Google Scholar] [CrossRef]
- Manniello, M.D.; Moretta, A.; Salvia, R.; Scieuzo, C.; Lucchetti, D.; Vogel, H.; Sgambato, A.; Falabella, P. Insect antimicrobial peptides: Potential weap-ons to counteract the antibiotic resistance. Cellular and molecular life sciences. Cell. Mol. Life Sci. 2021, 78, 4259–4282. [Google Scholar] [CrossRef] [PubMed]
- Biasato, I.; Ferrocino, I.; Biasibetti, E.; Grego, E.; Dabbou, S.; Sereno, A.; Gai, F.; Gasco, L.; Schiavone, A.; Cocolin, L.; et al. Modulation of intestinal microbiota, morphology and mucin composition by dietary insect meal inclusion in free-range chickens. BMC Vet. Res. 2018, 14, 383. [Google Scholar] [CrossRef]
- Tsirtsikos, P.; Fegeros, K.; Balaskas, C.; Kominakis, A.; Mountzouris, K.C. Dietary probiotic inclusion level modulates intestinal mucin composition and mucosal morphology in broilers. Poult. Sci. 2012, 91, 1860–1868. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Dou, X.; Song, J.; Lyu, Y.; Zhu, X.; Xu, L.; Li, W.; Shan, A. Antimicrobial peptides: Promising alternatives in the post feeding antibi-otic era. Med. Res. Rev. 2019, 39, 831–859. [Google Scholar] [CrossRef] [PubMed]
- Dong, X.; Qu, G.; Chen, Y.; Wang, G.; Jiang, D. Effects of antimicrobial peptides on growth, morphology of foregut villi and re-lated genes mRNA expression in the common carp (Cyprinus carpio). Aquac. Res. 2019, 50, 1752–1761. [Google Scholar] [CrossRef]
- Li, S.; Chi, S.; Cheng, X.; Wu, C.; Xu, Q.; Qu, P.; Gao, W.; Liu, Y. Effects of antimicrobial peptides on the growth performance, antioxidant and intestinal function in juvenile largemouth bass, Micropterus salmoides. Aquac. Rep. 2020, 16, 100252. [Google Scholar] [CrossRef]
- Pelaseyed, T.; Bergström, J.H.; Gustafsson, J.K.; Ermund, A.; Birchenough, G.M.H.; Schütte, A.; van der Post, S.; Svensson, F.; Rodríguez-Piñeiro, A.M.; Nyström, E.E.; et al. The mucus and mucins of the goblet cells and enterocytes provide the first defense line of the gastrointestinal tract and interact with the immune system. Immunol. Rev. 2014, 260, 8–20. [Google Scholar] [CrossRef]
- Kim, Y.S.; Ho, S.B. Intestinal Goblet Cells and Mucins in Health and Disease: Recent Insights and Progress. Curr. Gastroenterol. Rep. 2010, 12, 319–330. [Google Scholar] [CrossRef]
- Mantle, M.; Atkins, E.; Kelly, J.; Thakore, E.; Buret, A.; Gall, D.G. Effects of Yersinia enterocolitica infection on rabbit intestinal and colonic goblet cells and mucin: Morphometrics, histochemistry, and biochemistry. Gut 1991, 32, 1131–1138. [Google Scholar] [CrossRef]
- Wu, H.; Ye, L.; Lu, X.; Xie, S.; Yang, Q.; Yu, Q. Lactobacillus acidophilus Alleviated Salmonella-Induced Goblet Cells Loss and Colitis by Notch Pathway. Mol. Nutr. Food Res. 2018, 62, e1800552. [Google Scholar] [CrossRef]
- Circu, M.L.; Aw, T.Y. Redox biology of the intestine. Free Radic. Res. 2011, 45, 1245–1266. [Google Scholar] [CrossRef] [PubMed]
- Wang, B.; Liu, Y.; Feng, L.; Jiang, W.-D.; Kuang, S.-Y.; Jiang, J.; Li, S.-H.; Tang, L.; Zhou, X.-Q. Effects of dietary arginine supplementation on growth performance, flesh quality, muscle antioxidant capacity and antioxidant-related signalling molecule expression in young grass carp (Ctenopharyngodon idella). Food Chem. 2015, 167, 91–99. [Google Scholar] [CrossRef] [PubMed]
- Tovar-Ramírez, D.; Infante, J.Z.; Cahu, C.; Gatesoupe, F.; Vázquez-Juárez, R. Influence of dietary live yeast on European sea bass (Dicentrarchus labrax) larval development. Aquaculture 2004, 234, 415–427. [Google Scholar] [CrossRef]
- Wang, Y.; Heng, C.; Zhou, X.; Cao, G.; Jiang, L.; Wang, J.; Li, K.; Wang, D.; Zhan, X. Supplemental Bacillus subtilis DSM 29784 and enzymes, alone or in combination, as alternatives for antibiotics to improve growth performance, digestive enzyme activity, anti-oxidative status, immune response and the intestinal barrier of broiler chickens. Br. J. Nutr. 2021, 125, 494–507. [Google Scholar] [CrossRef] [PubMed]
- Förstermann, U.; Sessa, W.C. Nitric oxide synthases: Regulation and function. Eur. Heart J. 2012, 33, 829–837. [Google Scholar] [CrossRef]
- Luo, Y.; Song, Y. Mechanism of Antimicrobial Peptides: Antimicrobial, Anti-Inflammatory and Antibiofilm Activities. Int. J. Mol. Sci. 2021, 22, 11401. [Google Scholar] [CrossRef]
- Johansson, M.E.; Jakobsson, H.E.; Holmén-Larsson, J.; Schütte, A.; Ermund, A.; Rodríguez-Piñeiro, A.M.; Arike, L.; Wising, C.; Svensson, F.; Bäckhed, F.; et al. Normalization of Host Intestinal Mucus Layers Requires Long-Term Microbial Colonization. Cell Host Microbe 2015, 18, 582–592. [Google Scholar] [CrossRef]
- Rigottier-Gois, L. Dysbiosis in inflammatory bowel diseases: The oxygen hypothesis. ISME J. 2013, 7, 1256–1261. [Google Scholar] [CrossRef]
- Zhou, S.; Dong, J.; Liu, Y.; Yang, Q.; Xu, N.; Yang, Y.; Ai, X. Effects of acute deltamethrin exposure on kidney transcriptome and intestinal microbiota in goldfish (Carassius auratus). Ecotoxicol. Environ. Saf. 2021, 225, 112716. [Google Scholar] [CrossRef]
- Binda, C.; Lopetuso, L.R.; Rizzatti, G.; Gibiino, G.; Cennamo, V.; Gasbarrini, A. Actinobacteria: A relevant minority for the maintenance of gut homeostasis. Dig. Liver Dis. 2018, 50, 421–428. [Google Scholar] [CrossRef]
- van Kessel, M.A.; Dutilh, B.E.; Neveling, K.; Kwint, M.P.; Veltman, J.A.; Flik, G.; Jetten, M.S.; Klaren, P.H.; Op den Camp, H.J. Pyrosequencing of 16S rRNA gene amplicons to study the microbiota in the gastrointestinal tract of carp (Cyprinus carpio L.). AMB. Express. 2011, 1, 41. [Google Scholar] [CrossRef] [PubMed]
- He, J.; Zhang, P.; Shen, L.; Niu, L.; Tan, Y.; Chen, L.; Zhao, Y.; Bai, L.; Hao, X.; Li, X.; et al. Short-Chain Fatty Acids and Their Association with Signalling Path-ways in Inflammation, Glucose and Lipid Metabolism. Int. J. Mol. Sci. 2020, 21, 6356. [Google Scholar] [CrossRef] [PubMed]






| Ingredient (%) | G0 | G1 | G2 | G3 | G4 | G5 |
|---|---|---|---|---|---|---|
| Canola meal | 20.00 | 20.00 | 20.00 | 20.00 | 20.00 | 20.00 |
| Soybean meal | 35.00 | 35.00 | 35.00 | 35.00 | 35.00 | 35.00 |
| Wheat flour | 12.00 | 12.00 | 12.00 | 12.00 | 12.00 | 12.00 |
| Corn starch | 5.00 | 5.00 | 5.00 | 5.00 | 5.00 | 5.00 |
| Fish meal | 15.00 | 15.00 | 15.00 | 15.00 | 15.00 | 15.00 |
| Mixed antimicrobial peptide | 0.00 | 0.01 | 0.02 | 0.04 | 0.08 | 0.16 |
| Calcium dihydrogen phosphate | 2.00 | 2.00 | 2.00 | 2.00 | 2.00 | 2.00 |
| Fish oil | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 |
| Soybean oil | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 | 3.00 |
| Premix * | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 |
| Microcrystalline cellulose | 3.20 | 3.19 | 3.18 | 3.16 | 3.12 | 3.04 |
| Carboxymethyl cellulose(CMC) | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 |
| Choline chloride (50%) | 0.20 | 0.20 | 0.20 | 0.20 | 0.20 | 0.20 |
| Vitamin C phosphate | 0.10 | 0.10 | 0.10 | 0.10 | 0.10 | 0.10 |
| Proximate composition | ||||||
| Moisture | 13.42 | 12.95 | 13.16 | 13.34 | 13.08 | 13.12 |
| Crude protein | 36.10 | 35.98 | 36.22 | 36.16 | 35.88 | 36.16 |
| Crude lipid | 8.41 | 8.23 | 8.37 | 8.31 | 8.46 | 8.29 |
| Ash | 7.24 | 7.45 | 7.38 | 7.55 | 7.35 | 7.51 |
| Primer Name | Sequence (5′–3′) | Size of PCR Amplicon (bp) |
|---|---|---|
| TLR-4-F | GTAGTTCTTTTGTCATTCTTGGTT | 122 |
| TLR-4-R | TGACCCAATCTTCATCATAGC | |
| TNF-α-F | CGCGACTGACACTGAAGACC | 79 |
| TNF-α-R | GCAGGAGTTCTGTGGTGGTG | |
| MYD88-F | TGACAGCCTACACCCTT | 166 |
| MYD88-R | GATGCCGTGGCGACTA | |
| IL-11-F | CCACAGAGATTGATCACCATAGG | 191 |
| IL-11-R | TGTCAGCTTTGGTACTGAGC | |
| IL-10-F | GTTATTAAAGCCATGGGAGAGC | 198 |
| IL-10-R | GAAGTCCATTTGTGCCATATCC | |
| β-actin-F | CTCCCCTCAATCCCAAAGCCAA | 127 |
| β-actin-R | ACACCATCACCAGAATCCATCA |
| Items | G0 | G1 | G2 | G3 | G4 | G5 |
|---|---|---|---|---|---|---|
| T-AOC | 59.33 ± 6.47 a | 113.15 ± 2.99 b | 67.35 ± 15.34 a | 129.91 ± 23.10 b | 69.59 ± 7.57 a | 46.91 ± 2.79 a |
| SOD | 48.72 ± 6.79 ab | 64.00 ± 10.66 ab | 38.23 ± 2.84 a | 118.73 ± 48.25 c | 84.24 ± 14.64 bc | 62.36 ± 21.58 ab |
| MDA | 14.64 ± 0.52 b | 14.61 ± 0.78 b | 13.23 ± 0.25 ab | 10.54 ± 1.57 a | 14.66 ± 0.36 b | 15.01 ± 3.30 b |
| α-Ams | 0.11 ± 0.02 ab | 0.17 ± 0.03 b | 0.30 ± 0.09 c | 0.40 ± 0.07 c | 0.07 ± 0.01 a | 0.14 ± 0.06 ab |
| α-chmo | 1.08 ± 0.44 a | 4.44 ± 0.64 bc | 3.72 ± 1.13 bc | 7.79 ± 2.20 d | 5.86 ± 1.01 cd | 2.69 ± 0.73 ab |
| Lip | 1.51 ± 0.22 a | 3.38 ± 0.70 cd | 2.89 ± 1.30 bc | 4.20 ± 0.31 d | 1.85 ± 0.18 ab | 1.51 ± 0.51 a |
| Items | 0 (65 % Ethanol) | 1 (160 mg/mL) | 2 (16 mg/mL) | 3 (1.6 mg/mL) | 4 (0.16 mg/mL) | 5 (0.016 mg/mL) |
|---|---|---|---|---|---|---|
| Inhibition zone diameter (mm) | 0 | 5.53 ± 1.05 | 4.78 ± 0.65 | 4.68 ± 0.48 | 0 | 0 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, S.; Liu, S.; Wang, C.; Ye, B.; Lv, L.; Ye, Q.; Xie, S.; Hu, G.; Zou, J. Dietary Antimicrobial Peptides Improve Intestinal Function, Microbial Composition and Oxidative Stress Induced by Aeromonas hydrophila in Pengze Crucian Carp (Carassius auratus var. Pengze). Antioxidants 2022, 11, 1756. https://doi.org/10.3390/antiox11091756
Wang S, Liu S, Wang C, Ye B, Lv L, Ye Q, Xie S, Hu G, Zou J. Dietary Antimicrobial Peptides Improve Intestinal Function, Microbial Composition and Oxidative Stress Induced by Aeromonas hydrophila in Pengze Crucian Carp (Carassius auratus var. Pengze). Antioxidants. 2022; 11(9):1756. https://doi.org/10.3390/antiox11091756
Chicago/Turabian StyleWang, Shaodan, Shulin Liu, Chong Wang, Bin Ye, Liqun Lv, Qiao Ye, Shaolin Xie, Guocheng Hu, and Jixing Zou. 2022. "Dietary Antimicrobial Peptides Improve Intestinal Function, Microbial Composition and Oxidative Stress Induced by Aeromonas hydrophila in Pengze Crucian Carp (Carassius auratus var. Pengze)" Antioxidants 11, no. 9: 1756. https://doi.org/10.3390/antiox11091756
APA StyleWang, S., Liu, S., Wang, C., Ye, B., Lv, L., Ye, Q., Xie, S., Hu, G., & Zou, J. (2022). Dietary Antimicrobial Peptides Improve Intestinal Function, Microbial Composition and Oxidative Stress Induced by Aeromonas hydrophila in Pengze Crucian Carp (Carassius auratus var. Pengze). Antioxidants, 11(9), 1756. https://doi.org/10.3390/antiox11091756
