Relationship between Indel Variants within the JAK2 Gene and Growth Traits in Goats
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and Zoometric Data Recording
2.2. DNA Separation and Creation of Genomic DNA Pools
2.3. Primer Design, PCR Amplifications, and Genotyping
2.4. Bioinformatics Analysis
2.5. Statistical Analyses
2.6. Linkage Disequilibrium (LD) and Combined Genotype Analysis
3. Results
3.1. Genotypic and Genetic Parameters of InDels within the Goat JAK2 Gene
3.2. Genetic Diversity of the Two InDels within the JAK2 Gene in Three Goat Populations
3.3. Bioinformatics Analysis of JAK2
3.4. Association between InDel Variants and Growth Traits in Goats
3.5. LD and Haplotype Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Correction Statement
References
- Chen, Q.; Giedt, M.; Tang, L.; Harrison, D.A. Tools and methods for studying the Drosophila JAK/STAT pathway. Methods 2014, 68, 160–172. [Google Scholar] [CrossRef] [PubMed]
- Weber-Nordt, R.M.; Mertelsmann, R.; Finke, J. The JAK-STAT pathway: Signal transduction involved in proliferation, differentiation and transformation. Leuk. Lymphoma 1998, 28, 459–467. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Wang, F.; Luo, F. The role of JAK/STAT pathway in fibrotic diseases: Molecular and cellular mechanisms. Biomolecules 2023, 13, 119. [Google Scholar] [CrossRef] [PubMed]
- Singh, A.; Mishra, A. Molecular modelling study to discover novel JAK2 signaling pathway inhibitor. J. Biomol. Struct. Dyn. 2023, 41, 5827–5838. [Google Scholar] [CrossRef] [PubMed]
- Morris, R.; Kershaw, N.J.; Babon, J.J. The molecular details of cytokine signaling via the JAK/STAT pathway. Protein Sci. 2018, 27, 1984–2009. [Google Scholar] [CrossRef] [PubMed]
- Liang, Z.X.; Wu, G.L.; Fan, C.X.; Xu, J.; Jiang, S.; Yan, X.L.; Di, S.Y.; Ma, Z.Q.; Hu, W.; Yang, Y. The emerging role of signal transducer and activator of transcription 3 in cerebral ischemic and hemorrhagic stroke. Prog. Neurobiol. 2016, 137, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.H.; Li, M.Y.; Wang, Z.; Zuo, H.X.; Wang, J.Y.; Xing, Y.; Jin, C.H.; Xu, G.H.; Piao, L.X.; Piao, H.X.; et al. Convallatoxin promotes apoptosis and inhibits proliferation and angiogenesis through crosstalk between JAK2/STAT3 (T705) and mTOR/STAT3 (S727) signaling pathways in colorectal cancer. Phytomedicine 2020, 68, 153172. [Google Scholar] [CrossRef] [PubMed]
- Perner, F.; Perner, C.; Ernst, T.; Heidel, F.H. Roles of JAK2 in aging, inflammation, hematopoiesis and malignant transformation. Cells 2019, 8, 854. [Google Scholar] [CrossRef] [PubMed]
- Parganas, E.; Wang, D.; Stravopodis, D.; Topham, D.J.; Marine, J.C.; Teglund, S.; Vanin, E.F.; Bodner, S.; Colamonici, O.R.; van Deursen, J.M.; et al. Jak2 is essential for signaling through a variety of cytokine receptors. Cell 1998, 93, 385–395. [Google Scholar] [CrossRef]
- Chen, B.; Ning, K.; Sun, M.L.; Zhang, X.A. Regulation and therapy, the role of JAK2/STAT3 signaling pathway in OA: A systematic review. Cell Commun. Signal. 2023, 21, 67. [Google Scholar] [CrossRef]
- Zhang, X.; Zhang, P.; Liu, Y.; Liu, Z.; Xu, Q.; Zhang, Y.; Liu, L.; Yang, X.Y.; Li, L.Y.; Xue, C. Effects of caprylic acid and eicosapentaenoic acid on lipids, inflammatory levels, and the JAK2/STAT3 Pathway in ABCA1-Deficient mice and ABCA1 knock-down RAW264. 7 Cells. Nutrients 2023, 15, 1296. [Google Scholar] [CrossRef] [PubMed]
- Jang, Y.N.; Baik, E.J. JAK-STAT pathway and myogenic differentiation. JAK-STAT 2013, 2, e23282. [Google Scholar] [CrossRef] [PubMed]
- Ito, M.; Nakasato, M.; Suzuki, T.; Sakai, S.; Nagata, M.; Aoki, F. Localization of janus kinase 2 to the nuclei of mature oocytes and early cleavage stage mouse embryos. Biol. Reprod. 2004, 71, 89–96. [Google Scholar] [CrossRef]
- Corbit, K.C.; Camporez, J.P.G.; Edmunds, L.R.; Tran, J.L.; Vera, N.B.; Erion, D.M.; Rahul, C.; Deo, R.C.; Perry, R.J.; Shulman, G.I.; et al. Adipocyte JAK2 regulates hepatic insulin sensitivity independently of body composition, liver lipid content, and hepatic insulin signaling. Diabetes 2018, 67, 208–221. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.P.; Wang, C.H.; Xiao, F.; Wang, H.X.; Wu, Z.G. JAK2/STAT2/STAT3 are required for myogenic differentiation. J. Biol. Chem. 2008, 283, 34029–34036. [Google Scholar] [CrossRef] [PubMed]
- Shi, S.Y.; Luk, C.T.; Brunt, J.J.; Sivasubramaniyam, T.; Lu, S.Y.; Schroer, S.A.; Woo, M. Adipocyte-specific deficiency of Janus kinase (JAK) 2 in mice impairs lipolysis and increases body weight, and leads to insulin resistance with ageing. Diabetologia 2014, 57, 1016–1026. [Google Scholar] [CrossRef]
- Liu, Y.; Li, W.Y.; Wu, X.F.; Huang, Q.L.; Gao, C.F.; Chen, X.Z.; Zhang, X.P. Transcriptome analysis of differentially gene expression associated with Longissimus doris tissue in Fuqing goat and Nubian Black goat. Sci. Agric. Sin. 2019, 52, 2525–2537. (In Chinese) [Google Scholar]
- Jiang, M.Q.; He, J.Y.; Sun, Y.X.; Dong, X.; Yao, J.Y.; Gu, H.L.; Liu, L. Leptin induced TLR4 expression via the JAK2-STAT3 pathway in obesity-related osteoarthritis. Oxid. Med. Cell. Longev. 2021, 2021, 16. [Google Scholar] [CrossRef] [PubMed]
- Nakagawa, Y.; Kumagai, K.; Han, S.I.; Mizunoe, Y.; Araki, M.; Mizuno, S.; Ohno, H.; Kazuya Matsuo, K.; Yamada, Y.; Jun-Dal Kim, J.D.; et al. Starvation-induced transcription factor CREBH negatively governs body growth by controlling GH signaling. FASEB J. 2021, 35, e21663. [Google Scholar] [CrossRef]
- Neubauer, H.; Cumano, A.; Müller, M.; Wu, H.; Huffstadt, U.; Pfeffer, K. Jak2 deficiency defines an essentialdevelopmental checkpoint in definitive hematopoiesis. Cell 1998, 93, 397–409. [Google Scholar] [CrossRef]
- Lafferty, N.; Salmon, M.; Cross, N.C.; Singer, I.; Cooney, A.; Jayaprakash, R. Chronic eosinophilic leukaemia associated with JAK2 exon 13 insertion/deletion mutations. Acta Haematol. 2022, 145, 201–206. [Google Scholar] [CrossRef]
- Yang, M.; Zhao, W.; Wang, Z.; Liu, J.; Sun, X.; Wang, S. Detection of key gene InDels in JAK/STAT pathway and their associations with growth traits in four Chinese sheep breeds. Gene 2023, 888, 147750. [Google Scholar] [CrossRef] [PubMed]
- Oster, N.; Szewczuk, M.A.; Zych, S.; Stankiewicz, T.; Błaszczyk, B.; Wieczorek-Dąbrowska, M. Association between Polymorphism in the Janus Kinase 2 (JAK2) Gene and Selected Performance Traits in Cattle and Sheep. Animals 2023, 13, 2470. [Google Scholar] [CrossRef]
- Gilbert, R.P.; Bailey, D.R.; Shannon, N.H. Linear body measurements of cattle before and after 20 years of selection for postweaning gain when fed two different diets. J. Anim. Sci. 1993, 71, 1712–1720. [Google Scholar] [CrossRef]
- Luo, J.; Wang, Z.Y. Practical Production Technology of Meat Goat; The Publishing House of Shaanxi Science and Technology: Xi’an, China, 1998. [Google Scholar]
- Wu, X.F.; Liu, Y.; Wang, Y.G.; Zhang, F.; Li, W.Y. A novel 22-bp InDel within FGF7 gene is significantly associated with growth traits in goat. Anim. Biotechnol. 2024, 35, 2262537. [Google Scholar] [CrossRef]
- Wang, K.; Liu, X.F.; Qi, T.; Hui, Y.Q.; Yan, H.L.; Qu, L.; Lan, X.Y.; Pan, C.Y. Whole-genome sequencing to identify candidate genes for litter size and to uncover the variant function in goats (Capra hircus). Genomics 2021, 113, 142–150. [Google Scholar] [CrossRef]
- Yi, W.F.; Hu, M.Y.; Shi, L.L.; Li, T.; Bai, C.Y.; Sun, F.L.; Ma, H.H.; Zhao, Z.L.; Yan, S. Whole genome sequencing identified genomic diversity and candidated genes associated with economic traits in Northeasern Merino in China. Front. Genet. 2024, 15, 1302222. [Google Scholar] [CrossRef]
- Zhang, X.Y.; Wu, X.F.; Jia, W.C.; Pan, C.Y.; Li, X.C.; Lei, C.C.; Chen, H.; Lan, X.Y. Novel nucleotide variations, haplotypes structure and associations with growth related traits of goat AT motif-binding factor (ATBF1) gene. Anim. Biosci. 2015, 28, 1394. [Google Scholar] [CrossRef] [PubMed]
- Li, W.Y.; Liu, Y.; Gao, C.F.; Lan, X.Y.; Wu, X.F. A novel duplicated insertion/deletion (InDel) of the CPT1a gene and its effects on growth traits in goat. Anim. Biotechnol. 2021, 32, 343–351. [Google Scholar] [CrossRef]
- Mi, F.; Wu, X.F.; Wang, Z.; Wang, R.L.; Lan, X.Y. Relationships between the Mini-InDel variants within the goat CFAP43 gene and body traits. Animals 2022, 2, 3447. [Google Scholar] [CrossRef]
- Liu, J.; Jin, X.B.; Gan, L.; Sun, C. The JAK2/STAT3 signal pathway regulates the expression of genes related to skeletal muscle development and energy metabolism in mice and mouse skeletal muscle cells. Biosci. Biotech. Bioch. 2012, 76, 1866–1870. [Google Scholar] [CrossRef] [PubMed]
- Saltzman, A.; Stone, M.; Franks, C.; Searfoss, G.; Munro, R.; Jaye, M.; Ivashchenko, Y. Cloning and characterization of human Jak-2 kinase: High mRNA expression in immune cells and muscle tissue. Biochem. Bioph. Res. Co. 1998, 246, 627–633. [Google Scholar] [CrossRef] [PubMed]
- Song, Z.W.; Jin, C.L.; Ye, M.; Gao, C.Q.; Yan, H.C.; Wang, X.Q. Lysine inhibits apoptosis in satellite cells to govern skeletal muscle growth via the JAK2-STAT3 pathway. Food Funct. 2020, 11, 3941–3951. [Google Scholar] [CrossRef] [PubMed]
- Shabbir, A.; Zisa, D.; Lin, H.; Mastri, M.; Roloff, G.; Suzuki, G.; Lee, T. Activation of host tissue trophic factors through JAK-STAT3 signaling: A mechanism of mesenchymal stem cell-mediated cardiac repair. Am. J. Physiol-Heart C 2010, 299, H1428–H1438. [Google Scholar] [CrossRef] [PubMed]
- Saharinen, P.; Takaluoma, K.; Silvennoinen, O. Regulation of the Jak2 tyrosine kinase by its pseudokinase domain. Mol. Cell. Biol. 2000, 20, 3387–3395. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Janecka, M.J.; Rovenolt, F.; Stephenson, J.F. How does host social behavior drive parasite non-selective evolution from the within-host to the landscape-scale? Behav. Ecol. Sociobiol. 2021, 75, 150. [Google Scholar] [CrossRef]
- Wu, X.F.; Liu, Y.; Gao, C.F.; Chen, X.Z.; Zhang, X.P.; Li, W.Y. Novel alternative splicing variants of ACOX1 and their differential expression patterns in goats. Arch. Anim. Breed 2018, 61, 59–70. [Google Scholar] [CrossRef]
- Hu, J.T.; Zhong, T.; Wang, L.J.; Li, L.; Fan, J.S.; Xiong, C.R.; Wang, Y.; Zhang, H.P. Complete sequence and characterization of mitochondrial genome of Jianyang Daer goat (Capra hircus). Mitochondrial DNA A 2016, 27, 2104–2105. [Google Scholar] [CrossRef]
- Khan, M.Z.; Khan, A.; Xiao, J.X.; Ma, Y.L.; Ma, J.Y.; Gao, J.; Cao, Z.J. Role of the JAK-STAT pathway in bovine mastitis and milk production. Animals 2020, 10, 2107. [Google Scholar] [CrossRef]
- Szewczuk, M. Association of a genetic marker at the bovine Janus kinase 2 locus (JAK2/RsaI) with milk production traits of four cattle breeds. J. Dairy Res. 2015, 82, 287–292. [Google Scholar] [CrossRef]
- Ali, N.; Niaz, S.; Khan, N.U.; Gohar, A.; Khattak, I.; Dong, Y.X.; Khattak, T.; Ahmad, I.; Wang, Y.C.; Usman, T. Polymorphisms in JAK2 gene are associated with production traits and mastitis resistance in dairy cattle. Ann. Anim. Sci. 2020, 20, 409–423. [Google Scholar] [CrossRef]
- Sherrill-Mix, S.; Ocwieja, K.E.; Bushman, F.D. Gene activity in primary T cells infected with HIV89.6: Intron retention and induction of genomic repeats. Retrovirology 2015, 12, 79. [Google Scholar] [CrossRef] [PubMed]
- Shaul, O. How introns enhance gene expression. Int. J. Biochem. Cell Boil. 2017, 91, 145–155. [Google Scholar] [CrossRef] [PubMed]
- Fingerhut, J.M.; Yamashita, Y.M. The regulation and potential functions of intronic satellite DNA. Semin. Cell Dev. Biol. 2022, 128, 69–77. [Google Scholar] [CrossRef]
- Neininger, K.; Marschall, T.; Helms, V. SNP and indel frequencies at transcription start sites and at canonical and alternative translation initiation sites in the human genome. PLoS ONE 2019, 14, e0214816. [Google Scholar] [CrossRef] [PubMed]
- Pan, Y.Y.; Chen, R.; Zhu, L.; Wang, H.; Huang, D.F.; Lang, Z.H. Utilizing modified ubi1 introns to enhance exogenous gene expression in maize (Zea mays L.) and rice (Oryza sativa L.). J. Integr. Agric. 2016, 15, 1716–1726. [Google Scholar] [CrossRef]
- Torre, C.M.D.L.; Finer, J.J. The intron and 50 distal region of the soybean Gmubi promoter contribute to very high levels of gene expression in transiently and stably transformed tissues. Plant. Cell Rep. 2015, 34, 111–120. [Google Scholar] [CrossRef]
- Zhang, Y.H.; Wang, K.; Liu, J.W.; Zhu, H.J.; Qu, L.; Chen, H.; Lan, X.Y.; Pan, C.Y. An 11-bp indel polymorphism within the CSN1S1 gene is associated with milk performance and body measurement traits in Chinese goats. Animals 2019, 9, 1114. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Yan, H.L.; Xu, H.; Yang, Q.; Zhang, S.H.; Pan, C.Y.; Chen, H.; Zhu, H.J.; Liu, J.W.; Qu, L.; et al. A novel indel within goat casein alpha S1 gene is significantly associated with litter size. Gene 2018, 671, 161–169. [Google Scholar] [CrossRef] [PubMed]



| Loci | Primer Sequences (5′→3′) (Nucleotide Position) | Sizes (bp) | Rs Number | Polymorphism |
|---|---|---|---|---|
| P1 | F: ACAGGCAGGGCTCATTGTTG | 426 | rs670502347 | No polymorphism |
| R: ACTCAGCTGCCCCTATCCTT | ||||
| P2 | F: CTGGGCTTGTAGTTTGGATTTGT | 639 | rs656761347 | No polymorphism |
| R: GCAGTCGTTAATTATGCATGGGA | ||||
| P3 | F: AAGATCATTATGGCCTGGAT | 414 | rs652471794 | No polymorphism |
| R: CTGGCATTTGAGCATTTGTT | ||||
| P4 | F: AGTTTTGAAGACATGGTTGT | 431/436 | Del19008 rs664724553 | Polymorphism |
| R: ACCTCCAGACAGTATTGCTA | ||||
| P5 | F: TCCTATCATCGTCTATCACCA | 452 | rs646322931 | No polymorphism |
| R: ATATGATCCAGCAGTTCCACT | ||||
| P6 | F: TTATGTATCTTTAGGTTTCC | 441 | rs688366678 | No polymorphism |
| R: ACAAGAAATACTAAAAGGAG | ||||
| P7 | F: ACACTGGCAATGTGACTTATTT | 415 | rs658809227 | No polymorphism |
| R: GTCTTCGTTACCAGGATGAG | ||||
| P8 | F: AGTTGTGCTAGTTTACGTTTCT | 444 | rs658982284 | No polymorphism |
| R: GGTTACAGTTTATGGGGTCA | ||||
| P9 | F: AGAAAATGAGGAAACCAAAAGTT | 470 | rs649684777 | No polymorphism |
| R: GGAAATAGAGGAGGGCAGAG | ||||
| P10 | F: TTTGCGAAACTTTTCCTAGT | 327 | rs660232567 | No polymorphism |
| R: CAGCCTATTTCACTGATTCTAC | ||||
| P11 | F: CACTGCCAGTCCATCCATTTT | 399 | rs656433773 | No polymorphism |
| R: ATGTCACTTTGCACCCACCA | ||||
| P12 | F: TTCTGGTGGGTGCAAAGT | 459 | rs652577437 | No polymorphism |
| R: AGACAACCTACTGAATGGGATA | ||||
| P13 | F: CAGGATTGATGGAAGAACCG | 395/405 | Del72416 rs670284366 | Polymorphism |
| R: GAGCAGATGAAGAATGAAACAGAA | ||||
| P14 | F: GATTGAATAATGGGGTTGGT | 402 | rs660426344 | No polymorphism |
| R: CATTTCTTTGGCTACTTTGC | ||||
| P15 | F: TACCATGTGCAGGCAACTAT | 336 | rs684000928 | No polymorphism |
| R: TAGGGATTACCTGGGATTGG | ||||
| P16 | F: TCTCGTCAAGGCTATGGTTTT | 461 | rs671844323 | No polymorphism |
| R: CTGGGTTCAGTTCAGTTCAGTT | ||||
| P17 | F: CATTGTATTATACTTTAGCCTTATT | 587 | rs661217484 | No polymorphism |
| R: AATCTGATTACTGGCTGAC |
| Locus | Breeds (Size) | Genotypic Frequencies (Individual Quantity) | Allelic Frequencies | Ho | He | PIC | HWE | ||
|---|---|---|---|---|---|---|---|---|---|
| DD | ID | D | I | p-Value | |||||
| Del19008 | FQ (n = 129) | 0.186 (24) | 0.814 (105) | 0.593 | 0.407 | 0.517 | 0.483 | 0.366 | p < 0.05 |
| NB (n = 288) | 0.490 (141) | 0.510 (147) | 0.745 | 0.255 | 0.620 | 0.380 | 0.308 | p < 0.05 | |
| JZ (n = 120) | 0.333 (40) | 0.667 (80) | 0.667 | 0.333 | 0.556 | 0.444 | 0.346 | p < 0.05 | |
| Del72416 | FQ (n = 125) | 0.128 (16) | 0.872 (109) | 0.564 | 0.436 | 0.508 | 0.492 | 0.371 | p < 0.05 |
| NB (n = 288) | 0.479 (138) | 0.521 (150) | 0.740 | 0.260 | 0.615 | 0.385 | 0.311 | p < 0.05 | |
| JZ (n = 120) | 0.208 (25) | 0.792 (95) | 0.604 | 0.396 | 0.522 | 0.478 | 0.364 | p < 0.05 | |
| Locus | Breeds | Growth Traits | Mean ± SE | p-Value | |
|---|---|---|---|---|---|
| DD | ID | ||||
| del19008 | FQ | HuW (cm) | 14.36 ± 0.34 b | 15.17 ± 0.13 a | 0.013 |
| NB | BH (cm) | 68.05 ± 0.48 b | 69.70 ± 0.46 a | 0.014 | |
| TI | 131.51 ± 0.76 B | 134.46 ± 0.83 A | 0.009 | ||
| BLI | 96.88 ± 0.61 A | 93.03 ± 0.61 B | 0.00001 | ||
| ChCI | 127.09 ± 0.78 a | 124.73 ± 0.81 b | 0.036 | ||
| JZ | CWI | 57.3 ± 0.74 b | 59.74 ± 0.70 a | 0.019 | |
| del72416 | FQ | BL (cm) | 34.80 ± 1.65 a | 30.43 ± 0.66 b | 0.019 |
| HuW (cm) | 57.66 ± 1.37 a | 54.60 ± 0.40 b | 0.011 | ||
| ChC (cm) | 77.74 ± 1.53 a | 73.39 ± 0.64 b | 0.016 | ||
| ChW (cm) | 17.61 ± 0.46 A | 16.48 ± 0.17 B | 0.002 | ||
| NB | BH (cm) | 67.90 ± 0.45 B | 69.8 ± 0.49 A | 0.004 | |
| BLI | 96.80 ± 0.62 A | 93.19 ± 0.61 B | 0.00004 | ||
| ChCI | 127.93 ± 0.77 A | 124.00 ± 0.79 B | 0.0004 | ||
| CWI | 59.82 ± 0.52 b | 61.49 ± 0.65 a | 0.046 | ||
| HuWI | 110.32 ± 1.14 B | 115.89 ± 1.51 A | 0.004 | ||
| Breed | Growth Traits | Combined Genotypes (Mean ± SE) | p-Values | |||
|---|---|---|---|---|---|---|
| DD-DD | DD-ID | ID-DD | ID-ID | |||
| FQ | ChW (cm) | 15.95 ± 0.92 AB (n = 4) | 15.71 ± 0.55 B (n = 20) | 18.16 ± 0.45 Aa (n = 12) | 16.60 ± 0.17 ABb (n = 87) | 0.003 |
| CaC (cm) | 14.80 ± 0.55 AB (n = 4) | 14.27 ± 0.40 Bc (n = 20) | 15.99 ± 0.37 Aa (n = 12) | 15.09 ± 0.15 ABb (n = 87) | 0.011 | |
| NB | BH (cm) | 66.84 ± 0.51 B (n = 80) | 70.35 ± 0.85 A (n = 60) | 69.55 ± 0.74 A (n = 57) | 69.46 ± 0.59 A (n = 90) | 0.001 |
| BLI | 98.71 ± 0.73 A (n = 80) | 93.12 ± 0.80 B (n = 60) | 93.65 ± 0.91 B (n = 57) | 93.44 ± 0.90 B (n = 90) | 0.000001 | |
| ChCI | 130.87 ± 1.02 A (n = 80) | 123.48 ± 1.10 B (n = 60) | 124.05 ± 1.11 B (n = 57) | 124.24 ± 1.03 B (n = 90) | 0.0000006 | |
| HuWI | 108.03 ± 1.59 B (n = 80) | 120.96 ± 2.50 Aa (n = 60) | 111.54 ± 1.75 Ab (n = 57) | 113.82 ± 1.77 Aab (n = 90) | 0.0000006 | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, X.-F.; Xu, Q.; Wang, A.; Wang, B.-Z.; Lan, X.-Y.; Li, W.-Y.; Liu, Y. Relationship between Indel Variants within the JAK2 Gene and Growth Traits in Goats. Animals 2024, 14, 1994. https://doi.org/10.3390/ani14131994
Wu X-F, Xu Q, Wang A, Wang B-Z, Lan X-Y, Li W-Y, Liu Y. Relationship between Indel Variants within the JAK2 Gene and Growth Traits in Goats. Animals. 2024; 14(13):1994. https://doi.org/10.3390/ani14131994
Chicago/Turabian StyleWu, Xian-Feng, Qian Xu, Ao Wang, Ben-Zhi Wang, Xian-Yong Lan, Wen-Yang Li, and Yuan Liu. 2024. "Relationship between Indel Variants within the JAK2 Gene and Growth Traits in Goats" Animals 14, no. 13: 1994. https://doi.org/10.3390/ani14131994
APA StyleWu, X.-F., Xu, Q., Wang, A., Wang, B.-Z., Lan, X.-Y., Li, W.-Y., & Liu, Y. (2024). Relationship between Indel Variants within the JAK2 Gene and Growth Traits in Goats. Animals, 14(13), 1994. https://doi.org/10.3390/ani14131994
