Next Article in Journal
ThrRS-Mediated Translation Regulation of the RNA Polymerase III Subunit RPC10 Occurs through an Element with Similarity to Cognate tRNA ASL and Affects tRNA Levels
Previous Article in Journal
Complete Chloroplast Genome Sequence of the Long Blooming Cultivar Camellia ‘Xiari Qixin’: Genome Features, Comparative and Phylogenetic Analysis
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Association between Polymorphism of Genes IL-1A, NFKB1, PAR1, TP53, and UCP2 and Susceptibility to Non-Small Cell Lung Cancer in the Brazilian Amazon

by
Esdras E. B. Pereira
1,2,3,
Antônio A. C. Modesto
1,2,
Bruno M. Fernandes
2,
Rommel M. R. Burbano
1,2,
Paulo P. Assumpção
2,
Marianne R. Fernandes
2,*,
João F. Guerreiro
1,
Sidney E. B. dos Santos
1,2 and
Ney P. C. dos Santos
1,2
1
Laboratory of Human and Medical Genetics, Institute of Biological Science, Federal University of Pará, Belem 66077-830, PA, Brazil
2
Oncology Research Center, Federal University of Pará, Belem 66073-005, PA, Brazil
3
Instituto Tocantinense Presidente Antônio Carlos (ITPAC), Abaetetuba 68440-000, PA, Brazil
*
Author to whom correspondence should be addressed.
Genes 2023, 14(2), 461; https://doi.org/10.3390/genes14020461
Submission received: 12 September 2022 / Revised: 23 December 2022 / Accepted: 27 December 2022 / Published: 10 February 2023
(This article belongs to the Section Human Genomics and Genetic Diseases)

Abstract

Non-small cell lung cancer (NSCLC) accounts for the vast majority of cases of lung neoplasms. It is formed in multiple stages, with interactions between environmental risk factors and individual genetic susceptibility and with genes involved in the immune and inflammatory response paths, cell or genome stability, and metabolism, among others. Our objective was to evaluate the association between five genetic variants (IL-1A, NFKB1, PAR1, TP53, and UCP2) and the development of NSCLC in the Brazilian Amazon. The study included 263 individuals with and without lung cancer. The samples were analyzed for the genetic variants of NFKB1 (rs28362491), PAR1 (rs11267092), TP53 (rs17878362), IL-1A (rs3783553), and UCP2 (INDEL 45-bp), which were genotyped in PCR, followed by an analysis of the fragments, in which we applied a previously developed set of informative ancestral markers. We used a logistic regression model to identify differences in the allele and the genotypic frequencies among individuals and their association with NSCLC. The variables of gender, age, and smoking were controlled in the multivariate analysis to prevent confusion by association. The individuals that were homozygous for the Del/Del of polymorphism NFKB1 (rs28362491) (p = 0.018; OR = 0.332) demonstrate a significant association with NSCLC, which was similar to that observed in the variants of PAR1 (rs11267092) (p = 0.023; OR = 0.471) and TP53 (rs17878362) (p = 0.041; OR = 0.510). Moreover, the individuals with the Ins/Ins genotype of polymorphism IL-1A (rs3783553) demonstrated greater risk for NSCLC (p = 0.033; OR = 2.002), as did the volunteers with the Del/Del of UCP2 (INDEL 45-bp) (p = 0.031; OR = 2.031). The five polymorphisms investigated can contribute towards NSCLC susceptibility in the population of the Brazilian Amazon.

1. Introduction

Lung neoplasm is among the prevailing cancer types in the world, representing a little over 11% of all neoplasms and responsible for 18% of the deaths by the disease [1]. Non-small cell lung cancer (NSCLC) represents up to 85% of that neoplasm [2,3]. In Brazil, that prevalence may reach 90%, and most cases are detected in the advanced stages of the disease [4,5].
The formation of lung neoplasms may occur in several stages, with synergistic and complex interactions between the environmental risk factors, such as smoking and individual genetic susceptibility [6]. That susceptibility is associated with genetic polymorphisms, which include genes involved in the metabolism, the activation of carcinogens in tobacco smoke, DNA repair, the regulation of the cell cycle, homeostasis, and the immune response, among other paths [7,8]. The alterations present in those genes may generate imbalances in those paths and trigger the development of various neoplasms [7,8,9].
In this study, five important genetic variants for immune response pathways, cell cycle control, homeostasis, angiogenesis, and metabolism were investigated: IL-1A (rs3783553), NFKB1 (rs28362491), TP53 (rs17878362), PAR1 (rs11267092), and UCP2 (INDEL 45-bp). These genes and their variants have been associated with other cancers, including leukemias and breast, colorectal, gastric, prostate, and head and neck cancers, in different populations [7,9,10,11,12,13,14,15,16,17,18].
The choice for those markers was based on the fact that they are potential influencers in the development of neoplasms. Thus, identifying the associations of those polymorphisms with NSCLC may enable the tracking of individuals with greater disease susceptibility, before the first symptoms, enabling monitoring and early treatment, which may reduce the morbidity and mortality from the neoplasm.
The aim of this study was to evaluate the association between the IL-1A (rs3783553), NFKB1 (rs28362491), TP53 (rs17878362), PAR1 (rs11267092), and UCP2 (INDEL 45-bp) susceptibilities to NSCLC in the Brazilian Amazon.

2. Materials and Methods

2.1. Ethical Compliance

It is an observational, case-control study, authorized by the research Ethics Committees of the Oncology Research Center, under the CAAE protocol number: 37386214.3.0000.5634, and by the João de Barros Barreto University Hospital, under CAAE protocol number: 37386214.3.3001.0017, both in the city of Belém-Pará, within the Amazon region of Brazil. All the individuals signed an informed consent form.

2.2. Case and Control

The volunteers were recruited in public health centers, from both genders, with no family ties to each other, and from the same socio-economic level. The data and samples from 263 individuals were collected, whereas 67 patients had NSCLC (case group), as defined and classified in the histopathological exam, and 196 patients had no type of cancer (control group). The groups had demographic and clinical data collected, which included age, gender, and smoking history.

2.3. DNA Extraction and Quantification

The extraction of the leukocytes’ genomic DNA from the peripheral blood was executed using a Mini Spin Plus Kit (P. 250, Biopur, Biometrix, Gronsveld, the Netherlands) according to the manufacturer’s recommendations. The DNA’s concentration and purity were measured with a NanoDrop 1000 spectrophotometer (Thermo Scientific NanoDrop 1000; NanoDrop Technologies, Wilmington, DE, USA).

2.4. Genotyping

The five genetic variants were genotyped by a multiplex PCR reaction followed by a capillary electrophoresis. The primers detailed in Table 1 were used for the amplifications. The analysis of the PCR amplicons was carried out based on an electrophoresis using the ABI Prism 3130 sequencer and the GeneMapper ID v.3.2 software [19]. The electrospherogram of the markers (NFKB1, TP53, PAR1, UCP2, and IL-1A) investigated and interpreted by GeneMapper ID v. 3.2 software, is exposed and detailed in Figure S1.

2.5. Analysis of the Hardy–Weinberg Equilibrium (HWE)

The allele and genotype frequency of the genetic variants was determined by a direct count of the alleles, followed by the calculation of the Hardy–Weinberg equilibrium (HWE) using the standard parameters of the Arlequin 3.5.1.2 software (Swiss Institute of Bioinformatics, Bern, Switzerland). All the genetic variants were shown to be present in the HWE (Table 2).

2.6. Genetic Ancestry Analysis

The genotyping was performed to analyze the ancestry of the samples; it was performed according to Ramos et al. [20], using 61 informative markers of autosomal ancestry in three PCR multiplex reactions. The amplicons were analyzed by electrophoresis using the ABI Prism 3130 sequencer and the GeneMapper ID v. 3.2 software (Applied Biosystems, Life Technologies, Carlsbad, CA, USA). The electrospherogram of the 61 markers of genomic ancestry, interpreted by GeneMapper ID v. 3.2 software, is exposed and detailed in Figure S2. The individual proportions of European, African, and Amerindian genetic ascendancy were estimated using the Structure v. 2.3.3 software (Stanford University, Stanford, CA, USA), assuming three parental populations [21].

2.7. Statistic Analysis

The statistical analyses were made using the SPSS 20.0 statistics package (IBM, Armonk, NY, USA). For the comparative analysis between the study groups with regard to the demographic and clinical variables, Pearson’s chi-square and the Mann–Whitney test were both applied. To analyze the association of the polymorphisms with a lung cancer risk, a logistics regression was made, estimating the odds ratio (OR) and the reliability intervals of 95% (IC). The variables of gender, age, and smoking were controlled in that multivariate analysis to prevent confusion by association. A significance level of p < 0.05 was considered for all statistical analyses. In addition, a multifactorial dimensionality reduction (MDR) analysis was performed using MDR 3.0.2 (Vanderbilt University Medical School, Nashville, TN, USA) to assess the SNP-SNP viability associated with NSCLC risk, as described in Supplementary Table S1 and Supplementary Figure S3.

3. Results

In the results related to the demographic and clinical aspects, we may observe that the groups differed as to gender, age, and smoking history. Most of the NSCLC patients were male with an average age of 60 years and had a smoking history (Table 3). The ancestry analysis performed revealed that the case and control groups had a similar ancestry genome profile, with a larger European contribution for both populations (Table 3).
The analysis of the genotype and allele distribution revealed that the polymorphisms NFKB1 (rs28362491), PAR1 (rs11267092), and TP53 (rs17878362) presented variations associated with those at the lowest risk for the development of NSCLC, whereas the variations of the polymorphisms of gene IL-1A (rs3783553) and UCP2 (INDEL 45-bp) were associated with the risk of developing the disease (Table 4).
For NFKB1 (rs28362491), the genotype Del/Del also demonstrated an association with the NSCLC in comparison with the different genotypes (p = 0.018; OR = 0.332; 95% CI = 0.133–0.825). That is similar to what was observed for the polymorphisms PAR1 (rs11267092) and TP53 (rs17878362), where their Del/Del genotypes also demonstrated an association with the lowest risk for the development of NSCLC (Table 4).
In contrast, the polymorphism of the IL-1A (rs3783553) gene presented its Ins/Ins genotype as being associated with a higher risk of developing NSCLC (p = 0.033; OR = 2.002; 95% CI: 1.059–3.546), which was similar to the allele Ins. Similar results were identified for the polymorphism of gene UCP2 (INDEL 45-bp), where individuals with the Del/Del genotype had about twice the risk of developing the disease compared to the different genotypes (p = 0.031; OR = 2.031; 95% CI = 1.067–3.868) (Table 4).

4. Discussion

Lung neoplasm is the second class of cancer with the highest volume of detection in both genders globally, prevailing more among male individuals aged over 65 and frequently associated with smoking [1,22,23]. In the Brazilian population specifically, that neoplasm is the third most common among males and the fourth among females, whereas more than 8% of the cases are related to smoking [4,24]. That is also maintained for NSCLC, where a larger prevalence was observed among men over 60 [5,25,26]. In addition, that is similar to what was observed in this research, where the individuals with NSCLC were shown to be mostly men above 60 with a history of smoking.
The frequency of lung neoplasm among males is typically connected to tobacco consumption since the ratio of male smokers is larger than that of female smokers. Male individuals are also exposed to carcinogenic agents in some work activities, which favors a higher prevalence of the disease in that group [27,28,29]. However, those differences vary among countries according to their level of socio-economic and cultural development and are associated with tobacco consumption and exposure to both intrinsic and extrinsic risk factors [1,30].
In terms of age, we observe that at least one third of lung neoplasm cases are diagnosed between 65 and 74 years of age, whereas the elderly encompass nearly two thirds of all cases [1]. The aging process is associated with genomic modifications, favoring the accumulation of cells with the most varied molecular alterations, which compromise internal homeostasis, increasing individual susceptibility to carcinogens and, as a result, lung carcinogenesis [31,32].
In this study, upon assessing the individual susceptibility to the development of NSCLC, we may observe relevant results with respect to the polymorphisms of NFKB1 (rs28362491), PAR1 (rs11267092), and TP53 (rs17878362), all three of which are associated with the reduction in the risk of developing NSCLC, whereas the polymorphisms of IL-1A (rs3783553) and UCP2 (INDEL 45-bp) are associated with a higher risk of developing that neoplasm.
The NFKB1 gene expresses the NFkB1 (p50/p105) transcription factor, activated by several intracellular and extracellular stimuli, favoring the repression of gene transcription [18,33]. In the polymorphism of NFKB1 (rs28362491), it occurs from the NFKB1 gene-promoting region and is related to a susceptibility to multiple diseases associated with inflammation, immunity, and tumorigenesis [34,35]. In our study, individuals homozygous for Del/Del of this genetic variant demonstrated an association effect against the development of NSCLC. Other studies have also identified associations of this polymorphism with lung cancer [36,37]. That is because the genotype is associated with lower transcriptional activity and a reduction in p50/p105 expression, acting as a counterpart to the tumorigenesis events [18,38].
The same was observed with the polymorphism of PAR1 (rs11267092), where individuals with genotype Del/Del had less chances of developing NSCLC. The gene PAR1 expresses the PAR1 receptor, which regulates the physiological processes of the cardiovascular, respiratory, and neurological systems and inflammation, embryogenesis, and carcinogenesis [20,39]. The PAR1 (rs11267092) polymorphism occurs in the gene promoting region and modulates PAR1 production and activity, influencing many physiological events [40]. The reduction in mRNA expression by PAR1 correlates to the reduction in the invasive properties of some types of cancers [41,42]. In addition, it has been observed that the Del allele is associated with a better prognosis in some kinds of solid cancers [38,43], which corroborates the results of this study.
A similar outcome was observed in the polymorphism of TP53 (rs17878362), where the individuals with the genotype Del/Del presented a lower risk for NSCLC. The gene TP53 encodes the p53 protein, which is regulated by multiple mechanisms in response to a broad range of antiproliferative responses [9]. The polymorphism of TP53 (rs17878362) is associated with many types of cancers, owing to the alterations in gene expression and protein function [9,16]. Corroborating our results, the studies show that the Del/Del genotype of the genetic variants is associated with higher levels of TP53 mRNA and a greater DNA repair capability than the alleles Ins/Del and Ins/Ins, granting more protection against carcinogenesis events [9,44,45].
In turn, the polymorphism of IL-1A (rs3783553) presented an association with the risk of NSCLC development. The individuals with the genotype Ins/Ins presented twice the susceptibility to neoplasm compared to the other genotypes. The gene IL-1A expresses interleukin IL-1A, a pro-inflammatory cytokine produced by monocytes and macrophages, released in response to cell injury, which may influence proliferation, angiogenesis, and tumor invasion, among other carcinogenic events [46]. Polymorphism rs3783553 is associated with the regulation of the IL-1A expression levels, for interrupting a linking site to miRNA-122 and miRNA-378, and is thus associated with several kinds of malignant neoplasms [10,47]. The studies indicate that the Ins/Ins genotype and the Ins allele of that polymorphism were also associated with a greater risk of developing cancer in general [10], corroborating our findings.
In this study, the polymorphism in UCP2 (INDEL 45-bp) also revealed an association with NSCLC susceptibility. The individuals with genotype Del/Del presented twice the risks for developing the disease. The gene UCP2 expresses uncoupling protein 2 (UCP2), which acts as a proton transporter in mitochondria and is involved in energy homeostasis and thermogenesis, among other metabolic phenomena [48]. That gene and its variants have been associated with chronic diseases and some types of cancer [49,50]. Polymorphism UCP2 (INDEL 45-bp) may alter the mRNA stability of UCP2 [51]. According to Esterbauer et al. [52], the half-life of mRNA from individuals with the deletion allele is greater than that from those with the insertion allele, which may indicate greater expression. That greater expression may influence carcinogenesis since the latter mitigates the production of reactive species of oxygen (ROS), protecting the neoplastic cell of the apoptotic path [53,54], which clarifies the results obtained in this study.
The MDR was used to analyze the interaction of these five SNPs. The results of the MDR model analysis of SNP-SNP showed no significant influence between the investigated polymorphisms. However the dendrogram and the Fruchterman–Reingold graph describe these interactions. The strongest interaction effect was found between PAR1 (rs11267092) and IL-1A (rs3783553), with information gain values of 2.11%, which were SNPs associated with risk reduction for NSCLC. Furthermore, the second strongest effect was found between TP53 (rs17878362) and NFKB1 (rs28362491), with information gain values of 0.70%, and between TP53 (rs17878362) and UCP2 (INDEL 45-bp), with information gain values of 0.50%, which were SNPs associated with an increased risk for NSCLC.
Our findings reinforce the results of other studies with other populations, which had a more expressive sample number but also observed a relationship between these genes and carcinogenesis. It is one of the few that investigated the association of these five variants with NSCLC, which is extremely important for the Amazon because it has an extremely mixed population; it is unique and little studied, and there is a lack of epidemiological and genetic information about the disease in the region. In the future, the use of this information as a screening tool will be able to identify individuals with greater susceptibility to NSCLC, favoring the establishment of preventive measures and early diagnosis and reducing the cost to health services and the morbidity and mortality rates of this neoplasm.
Importantly, this study is one of the few that has investigated the association of these five polymorphisms with NSCLC. Additional epidemiological investigations involving larger groups of individuals should be performed to confirm the results and determine whether these variants are isolated risk factors or associated with environmental factors, including smoking.

5. Conclusions

The five polymorphisms investigated show a significant association with NSCLC in the population of the Brazilian Amazon region. The genotypes of the polymorphisms of NFKB1 (rs28362491), PAR1 (rs11267092), and TP53 (rs17878362) were associated with a lower risk for disease development, and the genotypes of the polymorphisms of IL-1A (rs3783553) and UCP2 (INDEL 45-bp) were associated with a growth in the susceptibility to that malignant neoplasm.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/genes14020461/s1, Table S1: SNP–SNP interaction models analyzed by the multifactorial dimensionality reduction (MDR) method, Figure S1: electropherogram of the five polymorphisms, Figure S2: electropherogram of the 61 markers of genomic ancestry, Figure S3: dendrogram (left) and the Fruchterman–Reingold graph (right) of the interactions between these SNPs.

Author Contributions

E.E.B.P. designed the study, processed the data, and wrote the article; B.M.F. contributed to the writing of the article; A.A.C.M. contributed to the genotyping and data analysis; R.M.R.B., P.P.A., S.E.B.d.S., M.R.F., J.F.G. and N.P.C.d.S. were the project coordinators. All authors have read and agreed to the published version of the manuscript.

Funding

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES); Fundação Amazônia de Amparo a Estudos e Pesquisas (FAPESPA); and Universidade Federal do Pará (UFPA).

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Research Ethics Committees of the Oncology Research Center, under the CAAE protocol number: 37386214.3.0000.5634, and by the João de Barros Barreto University Hospital, under CAAE protocol number: 37386214.3.3001.0017. All participants signed an informed consent form.

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

Not applicable.

Acknowledgments

We acknowledge the Universidade Federal do Pará (UFPA); the Faculty of Medicine (FAMED/UFPA); the Oncology Research Center (NPO/UFPA); the Graduate Program in Genetics and Molecular Biology (PPGBM/UFPA); the Human and Medical Genetics Laboratory (LGHM/UFPA); João de Barros Barreto University Hospital (HUJBB/UFPA); and the Faculty of Medicine of the Instituto Tocantinense Presidente Antônio Carlos-Abaetetuba (ITPAC Abaetetuba/AFYA).

Conflicts of Interest

The authors declare no conflict of interests.

References

  1. Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [Scilit]
  2. Duma, N.; Santana-Davila, R.; Molina, J.R. Non-Small Cell Lung Cancer: Epidemiology, Screening, Diagnosis, and Treatment. Mayo Clin. Proc. 2019, 94, 1623–1640. [Google Scholar] [CrossRef] [Scilit]
  3. Saltos, A.; Shafique, M.; Chiappori, A. Update on the Biology, Management, and Treatment of Small Cell Lung Cancer (SCLC). Front. Oncol. 2020, 10, 1074. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Araujo, L.H.; Baldotto, C.; Castro, G.; Katz, A.; Ferreira, C.G.; Mathias, C.; Mascarenhas, E.; Lopes, G.D.L.; Carvalho, H.; Tabacof, J.; et al. Lung cancer in Brazil. J. Bras. Pneumol. 2018, 44, 55–64. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Gil Ferreira, C.; Abadi, M.D.; de Mendonça Batista, P.; Serra, F.B.; Peixoto, R.B.; Okumura, L.M.; Cerqueira, E.R. Demographic and Clinical Outcomes of Brazilian Patients with Stage III or IV Non–Small-Cell Lung Cancer: Real-World Evidence Study on the Basis of Deterministic Linkage Approach. JCO Glob. Oncol. 2021, 7, 1454–1461. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Tsao, A.S.; Scagliotti, G.V.; Bunn, P.A.; Carbone, D.P.; Warren, G.W.; Bai, C.; de Koning, H.J.; Yousaf-Khan, A.U.; McWilliams, A.; Tsao, M.S.; et al. Scientific Advances in Lung Cancer 2015. J. Thorac. Oncol. 2016, 11, 613–638. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Cavalcante, G.C.; Amador, M.A.; Ribeiro-Dos-Santos, A.M.; Carvalho, D.C.; Andrade, R.B.; Pereira, E.E.; Fernandes, M.R.; Costa, D.F.; Santos, N.P.C.; Assumpção, P.P.; et al. Analysis of 12 variants in the development of gastric and colorectal cancers. World J. Gastroenterol. 2017, 23, 8533–8543. [Google Scholar] [CrossRef] [Scilit]
  8. Eaton, K.D.; Romine, P.E.; Goodman, G.E.; Thornquist, M.D.; Barnett, M.J.; Petersdorf, E.W. Inflammatory Gene Polymorphisms in Lung Cancer Susceptibility. J. Thorac. Oncol. 2018, 13, 649–659. [Google Scholar] [CrossRef] [Scilit]
  9. Sagne, C.; Marcel, V.; Amadou, A.; Hainaut, P.; Olivier, M.; Hall, J. A meta-analysis of cancer risk associated with the TP53 intron 3 duplication polymorphism (rs17878362): Geographic and tumor-specific effects. Cell Death Dis. 2013, 4, e492. [Google Scholar] [CrossRef] [Scilit]
  10. Xia, H.; Chen, Y.; Meng, J.; Liang, C. Effect of polymorphism on IL1A to cancer susceptibility: Evidence based on 34,016 subjects. Artif. Cells Nanomed. Biotechnol. 2019, 47, 3138–3152. [Google Scholar] [CrossRef] [Scilit]
  11. Kulmann-Leal, B.; Ellwanger, J.H.; Chies, J.A.B. CCR5Δ32 in Brazil: Impacts of a European Genetic Variant on a Highly Admixed Population. Front. Immunol. 2021, 12, 758358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Karami, S.; Sarabandi, S.; Pourzand, P.; Tabasi, F.; Hashemi, M.; Bahari, G. Lack of association between 4-base pair insertion/deletion (rs3783553) polymorphism within the 3′UTR of IL1A and breast cancer: A preliminary report. Gene Rep. 2021, 23, 101067. [Google Scholar] [CrossRef] [Scilit]
  13. Tajbakhsh, A.; Farjami, Z.; Nesaei-Bajestani, A.; Afzaljavan, F.; Rivandi, M.; Moezzi, A.; Abedini, S.; Asghari, M.; Kooshyar, M.M.; Shandiz, F.H.; et al. Evaluating the Association between CCR5delta32 Polymorphism (rs333) and the Risk of Breast Cancer in a Cohort of Iranian Population. Iran. J. Public Health 2021, 50, 583–591. [Google Scholar] [CrossRef] [Scilit]
  14. Aguilar, E.; Esteves, P.; Sancerni, T.; Lenoir, V.; Aparicio, T.; Bouillaud, F.; Dentin, R.; Prip-Buus, C.; Ricquier, D.; Pecqueur, C.; et al. UCP2 Deficiency Increases Colon Tumorigenesis by Promoting Lipid Synthesis and Depleting NADPH for Antioxidant Defenses. Cell Rep. 2019, 28, 2306–2316. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Zhao, L.; Yin, X.-X.; Qin, J.; Wang, W.; He, X.-F. Association Between the TP53 Polymorphisms and Breast Cancer Risk: An Updated Meta-Analysis. Front. Genet. 2022, 13, 807466. [Google Scholar] [CrossRef] [Scilit]
  16. Hashemi, M.; Bahari, G.; Sarhadi, S.; Eskandari, E.; Narouie, B.; Taheri, M.; Ghavami, S. 4-bp insertion/deletion (rs3783553) polymorphism within the 3′UTR of IL1A contributes to the risk of prostate cancer in a sample of Iranian population. J. Cell. Biochem. 2018, 119, 2627–2635. [Google Scholar] [CrossRef] [Scilit]
  17. Li, L.; Zhang, Z.-T. Genetic Association between NFKBIA and NFKB1 Gene Polymorphisms and the Susceptibility to Head and Neck Cancer: A Meta-Analysis. Dis. Markers 2019, 2019, 6523837. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Yazdani, Z.; Mousavi, Z.; Ghasemimehr, N.; Khandany, B.K.; Nikbakht, R.; Jafari, E.; Fatemi, A.; Hassanshahi, G. Differential regulatory effects of chemotherapeutic protocol on CCL3_CCL4_CCL5/CCR5 axes in acute myeloid leukemia patients with monocytic lineage. Life Sci. 2020, 240, 117071. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Pinto, P.; Salgado, C.; Santos, N.P.C.; Santos, S.; Ribeiro-Dos-Santos, Â. Influence of Genetic Ancestry on INDEL Markers of NFKβ1, CASP8, PAR1, IL4 and CYP19A1 Genes in Leprosy Patients. PLoS Negl. Trop. Dis. 2015, 9, e0004050. [Google Scholar] [CrossRef] [Scilit]
  20. Ramos, B.R.D.A.; D’Elia, M.P.B.; Amador, M.A.T.; Santos, N.P.C.; Santos, S.E.B.; da Cruz Castelli, E.; Witkin, S.S.; Miot, H.A.; Miot, L.D.B.; da Silva, M.G. Neither self-reported ethnicity nor declared family origin are reliable indicators of genomic ancestry. Genetica 2016, 144, 259–265. [Google Scholar] [CrossRef] [Scilit]
  21. Carvalho, D.C.; Wanderley, A.V.; Amador, M.A.T.; Fernandes, M.R.; Cavalcante, G.C.; Pantoja, K.B.C.C.; Mello, F.A.R.; de Assumpção, P.P.; Khayat, A.S.; Ribeiro-Dos-Santos, Â.; et al. Amerindian genetic ancestry and INDEL polymorphisms associated with susceptibility of childhood B-cell Leukemia in an admixed population from the Brazilian Amazon. Leuk. Res. 2015, 39, 1239–1245. [Google Scholar] [CrossRef] [Scilit]
  22. Thandra, K.C.; Barsouk, A.; Saginala, K.; Aluru, J.S.; Barsouk, A. Epidemiology of lung cancer. Contemp. Oncol. (Pozn) 2021, 25, 45–52. [Google Scholar] [CrossRef] [Scilit]
  23. Rodak, O.; Peris-Díaz, M.D.; Olbromski, M.; Podhorska-Okołów, M.; Dzięgiel, P. Current Landscape of Non-Small Cell Lung Cancer: Epidemiology, Histological Classification, Targeted Therapies, and Immunotherapy. Cancers 2021, 13, 4705. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Brasil. Ministério da Saúde. Instituto Nacional de Câncer José Alencar Gomes da Silva. Estimativa 2020: Incidência de Câncer no Brasil. Rio de Janeiro: INCA; 2019. Available online: https://www.inca.gov.br/sites/ufu.sti.inca.local/files//media/document//estimativa-2020-incidencia-de-cancer-no-brasil.pdf (accessed on 15 November 2021).
  25. De Sá, V.K.; Coelho, J.C.; Capelozzi, V.L.; Azevedo, S.J. Lung cancer in Brazil: Epidemiology and treatment challenges. Lung Cancer Targets Ther. 2016, 7, 141–148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Nicolau, J.S.; Lopez, R.V.M.; de Moraes Luizaga, C.T.; Ribeiro, K.B.; Roela, R.A.; Maistro, S.; Katayama, M.L.H.; Natalino, R.J.M.; de Castro, G.; Neto, J.E.; et al. Survival analysis of young adults from a Brazilian cohort of non-small cell lung cancer patients. ecancermedicalscience 2021, 15, 1279. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Delva, F.; Margery, J.; Laurent, F.; Petitprez, K.; Pairon, J.-C.; RecoCancerProf Working Group. Medical follow-up of workers exposed to lung carcinogens: French evidence-based and pragmatic recommendations. BMC Public Health 2017, 17, 191. [Google Scholar] [CrossRef] [Scilit]
  28. Stapelfeld, C.; Dammann, C.; Maser, E. Sex-specificity in lung cancer risk. Int. J. Cancer 2020, 146, 2376–2382. [Google Scholar] [CrossRef] [Scilit]
  29. Ragavan, M.; Patel, M.I. The evolving landscape of sex-based differences in lung cancer: A distinct disease in women. Eur. Respir. Rev. 2022, 31, 210100. [Google Scholar] [CrossRef] [Scilit]
  30. Barta, J.A.; Powell, C.A.; Wisnivesky, J.P. Global Epidemiology of Lung Cancer. Ann. Glob. Health 2019, 85, 8. [Google Scholar] [CrossRef] [Scilit]
  31. Meiners, S.; Eickelberg, O.; Königshoff, M. Hallmarks of the ageing lung. Eur. Respir. J. 2015, 45, 807–827. [Google Scholar] [CrossRef] [Scilit]
  32. Schneider, J.L.; Rowe, J.H.; Garcia-De-Alba, C.; Kim, C.F.; Sharpe, A.H.; Haigis, M.C. The aging lung: Physiology, disease, and immunity. Cell 2021, 184, 1990–2019. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Concetti, J.; Wilson, C.L. NFKB1 and Cancer: Friend or Foe? Cells 2018, 7, 133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Luo, J.-Y.; Liu, F.; Zhang, T.; Tian, T.; Luo, F.; Li, X.-M.; Yang, Y.-N. Association of NFKB1 gene rs28362491 mutation with the occurrence of major adverse cardiovascular events. BMC Cardiovasc. Disord. 2022, 22, 313. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Dimitrakopoulos, F.-I.D.; Kottorou, A.E.; Kalofonou, M.; Kalofonos, H.P. The Fire Within: NF-κB Involvement in Non–Small Cell Lung Cancer. Cancer Res 2020, 80, 4025–4036. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Oltulu, Y.M.; Coskunpinar, E.; Ozkan, G.; Aynaci, E.; Yildiz, P.; Isbir, T.; Yaylim, I. Investigation of NF-κB1 and NF-κBIA Gene Polymorphism in Non-Small Cell Lung Cancer. BioMed Res. Int. 2014, 2014, 530381. [Google Scholar] [CrossRef] [Scilit]
  37. Yin, J.; Yin, M.; Vogel, U.; Wu, Y.; Yao, T.; Cheng, Y.; Sun, Z.; Hou, W.; Wang, C. NFKB1 common variants and PPP1R13L and CD3EAP in relation to lung cancer risk in a Chinese population. Gene 2015, 567, 31–35. [Google Scholar] [CrossRef] [Scilit]
  38. Wang, Y.; Chen, L.; Pan, L.; Xue, J.; Yu, H. The association between NFKB1-94ins/del ATTG polymorphism and non-small cell lung cancer risk in a Chinese Han population. Int. J. Clin. Exp. Med. 2015, 8, 8153–8157. [Google Scholar]
  39. Amador, M.A.T.; Cavalcante, G.C.; Santos, N.P.C.; Gusmão, L.; Guerreiro, J.F.; Ribeiro-Dos-Santos, Â.; Santos, S. Distribution of allelic and genotypic frequencies of IL1A, IL4, NFKB1 and PAR1 variants in Native American, African, European and Brazilian populations. BMC Res. Notes 2016, 9, 101. [Google Scholar] [CrossRef] [Scilit]
  40. Castaño-Rodríguez, N.; Kaakoush, N.O.; Goh, K.L.; Fock, K.M.; Chionh, Y.T.; Sutton, P.; Mitchell, H.M. PAR-1 polymorphisms and risk of Helicobacter pylori-related gastric cancer in a Chinese population. Anticancer Res. 2012, 32, 3715–3721. [Google Scholar]
  41. Darmoul, D.; Gratio, V.; Devaud, H.; Lehy, T.; Laburthe, M. Aberrant Expression and Activation of the Thrombin Receptor Protease-Activated Receptor-1 Induces Cell Proliferation and Motility in Human Colon Cancer Cells. Am. J. Pathol. 2003, 162, 1503–1513. [Google Scholar] [CrossRef] [Scilit]
  42. Lurje, G.; Husain, H.; Power, D.; Yang, D.; Groshen, S.; Pohl, A.; Zhang, W.; Ning, Y.; Manegold, P.; El-Khoueiry, A.; et al. Genetic variations in angiogenesis pathway genes associated with clinical outcome in localized gastric adenocarcinoma. Ann. Oncol. 2010, 21, 78–86. [Google Scholar] [CrossRef] [Scilit]
  43. Eroğlu, A.; Karabıyık, A.; Akar, N. The Association of Protease Activated Receptor 1 gene −506 I/D Polymorphism with Disease-Free Survival in Breast Cancer Patients. Ann. Surg. Oncol. 2012, 19, 1365–1369. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Ajaz, S.; Muneer, R.; Siddiqa, A.; Memon, M.A. Frequencies of TP53 Germline Variations and Identification of Two Novel 3′UTR Variants in a Series of Head and Neck Cancer Cases. medRxiv 2021. [Google Scholar] [CrossRef] [Scilit]
  45. Denisov, E.V.; Cherdyntseva, N.V.; Litviakov, N.V.; Malinovskaya, E.A.; Babyshkina, N.N.; Belyavskaya, V.A.; Voevoda, M.I. TP53 Gene Polymorphisms in Cancer Risk: The Modulating Effect of Ageing, Ethnicity and TP53 Somatic Abnormalities. In Tumor Suppressor Genes; IntechOpen: London, UK, 2012. [Google Scholar] [CrossRef] [Scilit]
  46. Ma, L.; Zhou, N. Association between an insertion/deletion polymorphism in IL-1A gene and cancer risk: A meta-analysis. OncoTargets Ther. 2016, 9, 1–6. [Google Scholar] [CrossRef] [Scilit]
  47. Ma, Q.; Mao, Z.; Du, J.; Liao, S.; Zheng, Y.; Zhi, M.; Zhang, J.; Wang, Y. Association between an insertion/deletion polymorphism in the interleukin-1α gene and the risk of colorectal cancer in a Chinese population. Int. J. Biol. Markers 2018, 33, 401–406. [Google Scholar] [CrossRef] [Scilit]
  48. Kaabi, Y.A.; Mansor, A.S.; Alfagih, A.S.; Hakami, A.M.; Summ, M.A.; Mjery, Y.A.; Alzughbi, M.N.; Habibullah, M.M. Frequency of UCP2 45-bp Ins/Del polymorphism in Saudi population from Jazan area and its association with autoimmune hypothyroidism UCP2 45-bp Ins/Del frequency in hypothyroidism. Int. J. Health Sci. (Qassim) 2020, 14, 11–16. [Google Scholar] [PubMed]
  49. Rezapour, S.; Khosroshahi, S.A.; Farajnia, H.; Mohseni, F.; Khoshbaten, M.; Farajnia, S. Association of 45-bp ins/del polymorphism of uncoupling protein 2 (UCP2) and susceptibility to nonalcoholic fatty liver and type 2 diabetes mellitus in North-west of Iran. BMC Res. Notes 2021, 14, 169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  50. Say, Y.-H. The association of insertions/deletions (INDELs) and variable number tandem repeats (VNTRs) with obesity and its related traits and complications. J. Physiol. Anthr. 2017, 36, 25. [Google Scholar] [CrossRef] [Scilit]
  51. Yu, J.; Shi, L.; Lin, W.; Lu, B.; Zhao, Y. UCP2 promotes proliferation and chemoresistance through regulating the NF-κB/β-catenin axis and mitochondrial ROS in gallbladder cancer. Biochem. Pharmacol. 2020, 172, 113745. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Esterbauer, H.; Schneitler, C.; Oberkofler, H.; Ebenbichler, C.; Paulweber, B.; Sandhofer, F.; Ladurner, G.; Hell, E.; Strosberg, A.D.; Patsch, J.R.; et al. A common polymorphism in the promoter of UCP2 is associated with decreased risk of obesity in middle-aged humans. Nat. Genet. 2001, 28, 178–183. [Google Scholar] [CrossRef] [Scilit]
  53. Lee, J.H.; Cho, Y.S.; Jung, K.-H.; Park, J.W.; Lee, K.-H. Genipin enhances the antitumor effect of elesclomol in A549 lung cancer cells by blocking uncoupling protein-2 and stimulating reactive oxygen species production. Oncol. Lett. 2020, 20, 374. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Su, W.-P.; Lo, Y.-C.; Yan, J.-J.; Liao, I.-C.; Tsai, P.-J.; Wang, H.-C.; Yeh, H.-H.; Lin, C.-C.; Chen, H.H.; Lai, W.-W.; et al. Mitochondrial uncoupling protein 2 regulates the effects of paclitaxel on Stat3 activation and cellular survival in lung cancer cells. Carcinogenesis 2012, 33, 2065–2075. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Table 1. Technical characteristics of the markers studied.
Table 1. Technical characteristics of the markers studied.
GeneIDTypeLengthPrimersAmplicon
IL-1Ars3783553INDEL4 bpF-5′TGGTCCAAGTTGTGCTTATCC3′230–234 bp
R-5′ACAGTGGTCTCATGGTTGTCA3′
NFKB1rs28362491INDEL4 bpF-5′TATGGACCGCATGACTCTATCA3′366–370 bp
R-5′GGCTCTGGCATCCTAGCAG3′
PAR1rs11267092INDEL13 bpF-5′AAAACTGAACTTTGCCGGTGT3′265–277 bp
R-5′GGGCCTAGAAGTCCAAATGAG3′
TP53rs17878362INDEL16 bpF-5′GGGACTGACTTTCTGCTCTTGT3′148–164 bp
R-5′GGGACTGTAGATGGGTGAAAAG3′
UCP2INDEL 45-bpINDEL45 bpF-5′CCCACACTGTCAAATGTCAACT3′119–164 bp
R-5′CCATGCTTTCCTTTTCTTCCT3′
F: Forward; R: Reverse; INDEL: Insertion/Deletion.
Table 2. Hardy–Weinberg equilibrium of the investigated genetic variants.
Table 2. Hardy–Weinberg equilibrium of the investigated genetic variants.
GeneIDGenotypeFrequencyHardy-Weinberg Equilibrium
(p-Value)
IL-1Ars3783553Del/Del37 (14.1%)0.095
Ins/Del140 (53.2%)
Ins/Ins86 (32.7%)
NFKB1rs28362491Del/Del59 (22.4%)0.919
Ins/Del132 (50.2%)
Ins/Ins72 (27.4%)
PAR1rs11267092Del/Del131 (49.8%)0.644
Ins/Del107 (40.7%)
Ins/Ins25 (9.5%)
TP53rs17878362Del/Del163 (62.0%)0.575
Ins/Del90 (34.2%)
Ins/Ins10 (3.8%)
UCP2INDEL 45-bpDel/Del127 (48.3%)0.922
Ins/Del112 (42.6%)
Ins/Ins24 (9.1%)
Ins: Insertion; Del: Deletion.
Table 3. Demographic and clinical characteristics of the investigated groups.
Table 3. Demographic and clinical characteristics of the investigated groups.
CharacteristicsCase (n = 67)Control (n = 196)p-Value
Gender
 Male47 (70.1%)62 (31.6%)<0.001 a*
 Female20 (29.9%)134 (68.4%)
Ages (years)
 Mean (±sd)60.4 (±12.3)70.5 (±8.2)<0.001 b*
Smoking
 Never smoked13 (19.4%)93 (47.4%)<0.001 a*
 Smoker54 (80.6%)97 (49.5%)
Ancestry
 European47.1 (±16.9)45.2 (±17.0)0.521 b
 Amerindian30.3 (±13.6)30.6 (±14.8)0.912 b
 African22.6 (±12.1)24.2 (±13.8)0.498 b
sd: standard deviation; a. chi-square test; b. Mann–Whitney test. *. p-value < 0.05.
Table 4. Genotypic and allelic distributions of investigated polymorphisms for non-small cell lung cancer patients compared to the control group.
Table 4. Genotypic and allelic distributions of investigated polymorphisms for non-small cell lung cancer patients compared to the control group.
PolymorphismsCase (n = 67)Control (n = 196)p-Value aOR (95% CI)
IL-1A (rs3783553)
 Del/Del5 (7.5%)32 (16.3%)0.033 *Ins/Ins vs. Others
 Ins/Del33 (49.3%)107 (54.6%)
 Ins/Ins29 (43.2%)57 (29.1%)2.002 (1.059–3.546)
 Allele Del43 (32.1%)171 (43.6%)0.033 *0.499 (0.264–0.944)
 Allele Ins91 (67.9%)221 (56.4%)2.002 (1.059–3.546)
NFKB1 (rs28362491)
 Del/Del13 (19.4%)46 (23.5%)0.018 *Del/Del vs. Others
 Ins/Del35 (52.2%)97 (49.5%)
 Ins/Ins19 (28.4%)53 (27.0%)0.332 (0.133–0.825)
 Allele Del61 (45.5%)189 (48.2%)0.9811.009 (0.500–2.033)
 Allele Ins73 (54.5%)203 (51.8%)0.992 (0.492–1.999)
PAR1 (rs11267092)
 Del/Del23 (34.3%)108 (55.1%)0.023 *Del/Del vs. Others
 Ins/Del32 (47.8%)75 (38.3%)0.471 (0.247–0.971)
 Ins/Ins12 (17.9%)13 (6.6%)
 Allele Del78 (58.2%)291 (74.2%)0.1300.477 (0.183–1.244)
 Allele Ins56 (41.8%)101 (25.8%)
TP53 (rs17878362)
 Del/Del34 (50.7%)129 (65.8%)0.041 *Del/Del vs. Others
 Ins/Del29 (43.3%)61 (31.1%)0.510 (0.267–0.974)
 Ins/Ins4 (6.0%)6 (3.1%)
 Allele Del97 (72.4%)319 (81.4%)0.5680.655 (0.153–2.789)
 Allele Ins37 (27.6%)73 (18.6%)
UCP2(INDEL 45-bp)
 Del/Del39 (58.2%)88 (44.9%)0.031 *Del/Del vs. Others
 Ins/Del22 (32.8%)90 (45.9%)
 Ins/Ins6 (9.0%)18 (9.2%)2.031 (1.067–3.868)
 Allele Del100 (74.6%)266 (67.9%)0.6171.367 (0.401–4.663)
 Allele Ins34 (25.4%)126 (32.1%)0.731 (0.214–2.495)
Ins: Insertion; Del: Deletion; OR: odds ratio; CI: confidence interval; a. logistic regression adjusted for gender, age, and smoking. * p-value < 0.05.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Pereira, E.E.B.; Modesto, A.A.C.; Fernandes, B.M.; Burbano, R.M.R.; Assumpção, P.P.; Fernandes, M.R.; Guerreiro, J.F.; Santos, S.E.B.d.; Santos, N.P.C.d. Association between Polymorphism of Genes IL-1A, NFKB1, PAR1, TP53, and UCP2 and Susceptibility to Non-Small Cell Lung Cancer in the Brazilian Amazon. Genes 2023, 14, 461. https://doi.org/10.3390/genes14020461

AMA Style

Pereira EEB, Modesto AAC, Fernandes BM, Burbano RMR, Assumpção PP, Fernandes MR, Guerreiro JF, Santos SEBd, Santos NPCd. Association between Polymorphism of Genes IL-1A, NFKB1, PAR1, TP53, and UCP2 and Susceptibility to Non-Small Cell Lung Cancer in the Brazilian Amazon. Genes. 2023; 14(2):461. https://doi.org/10.3390/genes14020461

Chicago/Turabian Style

Pereira, Esdras E. B., Antônio A. C. Modesto, Bruno M. Fernandes, Rommel M. R. Burbano, Paulo P. Assumpção, Marianne R. Fernandes, João F. Guerreiro, Sidney E. B. dos Santos, and Ney P. C. dos Santos. 2023. "Association between Polymorphism of Genes IL-1A, NFKB1, PAR1, TP53, and UCP2 and Susceptibility to Non-Small Cell Lung Cancer in the Brazilian Amazon" Genes 14, no. 2: 461. https://doi.org/10.3390/genes14020461

APA Style

Pereira, E. E. B., Modesto, A. A. C., Fernandes, B. M., Burbano, R. M. R., Assumpção, P. P., Fernandes, M. R., Guerreiro, J. F., Santos, S. E. B. d., & Santos, N. P. C. d. (2023). Association between Polymorphism of Genes IL-1A, NFKB1, PAR1, TP53, and UCP2 and Susceptibility to Non-Small Cell Lung Cancer in the Brazilian Amazon. Genes, 14(2), 461. https://doi.org/10.3390/genes14020461

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop