Abstract
To investigate the effects of kitchen waste on the chemical properties of acidic red soil and the community structure of ammonia–oxidizing archaea (AOA) and ammonia–oxidizing bacteria (AOB), a study was conducted in the flue–cured tobacco farmland ecosystem of the Erlongtan small watershed in central Yunnan. Eight fertilization methods were applied: no fertilization control CK, single application of chemical fertilizer T1 (1 t·hm−2), kitchen waste combined with a chemical fertilizer (T2:12 t·hm−2 + 1 t·hm−2, T3:15 t·hm−2 + 1 t·hm−2, T4:18 t·hm−2 + 1 t·hm−2), and single application of kitchen waste (T5:12 t·hm−2, T6:15 t·hm−2, T7:18 t·hm−2). The numbers twelve, fifteen, and eighteen in brackets represent the amount of food waste applied, and one represents the amount of chemical fertilizer applied. The study evaluated the effects of kitchen waste on soil chemical properties, the community structure and composition of AOA and AOB, and the relationship between soil chemical properties and these microbial communities in acidic red soil. The results showed that: (1) single application of kitchen waste (T5, T6, T7) effectively improved soil nutrient status (SOC increased by 15.79–217.24%; TN increased by 1.53–92.99%; NH4+–N increased by 18.19–520.74%; NO3−–N) increased by 15.54–750.61%), and alleviated acidification. (2) Temporal variations had a more significant effect on the community structure of AOA and AOB than different treatments. The dominant phyla of AOA were Thaumarchaeota, Crenarchaeot. The dominant phylum of AOB was Proteobacteria, and the dominant genera were Nitrosospira and norank_Bacteri. (3) The number of AOA co–occurrence network nodes were equivalent to that of AOB, but AOB had more connection edges, indicating a more complex interaction network. In contrast, AOA exhibited higher modularity, reflecting tighter internal connections and greater stability. The AOA co–occurrence network showed stronger performance during the maturity and fallow stages, while AOB interactions were most active during the topping stage. (4) AOA demonstrated a strong correlation with soil chemical properties during the topping and maturity stages, whereas AOB showed a stronger correlation at the rosette and fallow stages. Among soil chemical factors, pH and SOC were identified as the primary drivers influencing AOA and AOB community abundance and structural differentiation. In conclusion, kitchen waste application enhances the nutrient content of acidic red soil and influences the niche differentiation of AOA and AOB, thereby affecting nitrogen recycling. This approach represents an environmentally friendly and sustainable fertilization method.
1. Introduction
Kitchen waste comprises approximately 36–76% of household waste, representing a significant proportion. Research shows that the world produces up to 1.3 billion tons of food waste every year, and this will increase to approximately 2.5 billion tons in 2025 [1]. Kitchen waste contains a large amount of organic matter, which can be decomposed after treatment into N and P nutrients needed by plants. As a typical form of biomass, it can be processed using various technologies to produce valuable products [2]. For example, aerobic composting, an efficient and straightforward method for treating kitchen waste, decomposes organic matter into nutrient–rich organic fertilizers, which also function as soil amendments [3,4,5]. Therefore, composting has emerged as a preferred technology for the resource reuse of kitchen waste [6]. Nitrification is a key process in the soil nitrogen cycle, which can affect the leaching of NO3− and the emission of N2O in the soil. It involves two primary steps: the oxidation of NH4+ to NO2− and the conversion of NO2− to NO3−. The ammonia oxidation process, often regarded as the initial and rate–limiting step of nitrification, is primarily driven by ammonia–oxidizing archaea (AOA) and ammonia–oxidizing bacteria (AOB) [7,8]. Previous studies have shown that combining organic and chemical fertilizers can reduce N2O emissions and enhance AOB gene abundance [9]. Kitchen waste, used as an organic fertilizer with chemical fertilizers, positively affects soil nutrients and health [10,11].
Significant progress has been made in the utilization of kitchen waste. For example, Zhang et al. [12] found that kitchen waste significantly improved soil chemical properties and enzyme activity, enhanced microbial activity, and bacterial functional network complexity. Kabato et al. [13] demonstrated that combining compost with traditional nitrogen and phosphorus fertilizers markedly increased soil organic carbon by 44.69–73.18%, total nitrogen by 264.29–518.18%, and available phosphorus by 302.00–785.72%. Extensive research has explored the roles of AOA and AOB in farmland soils. Factors such as fertilization practices [14], temperature [15], and pH influence the activity and community structure of ammonia–oxidizing microorganisms. Among them, pH is one of the key factors determining the niche differentiation of ammonia–oxidizing microorganisms. Wang et al. [16] and Li et al. [17] suggested that AOA dominates in acidic soils, while AOB, which has a lower affinity for ammonia, tends to dominate in alkaline soils. However, Huang et al. [18] found that AOB can play an important role in acidic soil, indicating unresolved controversies regarding the factors influencing AOB functional activity. Additionally, the concentration of nitrogen substrates affects the growth of both AOA and AOB [16]. However, the impact of kitchen waste on the distribution and functional activity of AOA and AOB in soil remains unclear, warranting further investigation.
China, as a major agricultural country, accounts for 30–35% of global chemical fertilizer and pesticide usage [19], yet the nitrogen use efficiency of these fertilizers is only 30–35% [20]. There are approximately 2 million square kilometers of red soil area in southern and central China [21]. These areas have high temperatures and are important agricultural production areas [22]. However, acidic red soil lacks key nutrients such as potassium, phosphorus, calcium, and magnesium due to poor soil structure, strong weathering, and improper management methods, resulting in low soil productivity [21,23,24]. Due to the concentration of precipitation, strong rainfall erosivity, and unreasonable human activities, red soil in southern China is easily impacted by soil erosion [25], which affects the health of the soil and becomes the main problem for agricultural production [26]. Studies have shown that the application of organic fertilizers such as kitchen waste can improve soil chemical properties and microbial activity [12,22].
The study investigated tobacco–planting red soil in the Erlongtan small watershed of central Yunnan, employing various fertilization treatments: no fertilization control (CK), chemical fertilizer alone (T1), kitchen waste combined with chemical fertilizer (T2, T3, T4), and kitchen waste alone (T5, T6, T7). Molecular biology techniques, including Illumina MiSeq sequencing, were applied along with the scientific sampling and analysis of relevant indicators at the rosette, topping, maturity, and abandonment stages of flue–cured tobacco. The research aimed to examine the effects of kitchen waste on the chemical properties of tobacco–planting red soil, the dynamic changes in AOA and AOB community composition and structure, and their inter–relationships. Based on the results of previous studies, this study hypothesized that: (1) kitchen waste alters the chemical properties of tobacco–planting red soil; (2) kitchen waste influences the community structure and composition of AOA and AOB; and (3) pH is the main factor affecting the community structure and composition of AOA and AOB. The purpose of this study is to systematically explore the response of AOA and AOB in tobacco–planting red soil to kitchen waste application and to provide a scientific foundation for optimizing fertilization strategies and enhancing crop production efficiency.
2. Materials and Methods
2.1. Overview of the Study Area
The experimental area of this study is located in Lijing Village, Gaocang Street, Hongta District, Yuxi City, Yunnan Province, China. The terrain slopes from high elevations in the northwest to lower elevations in the southeast, with an altitude of 1910 m at the experimental field, which is situated at 102°34′48.21″ E and 24°17′09.46″ N. The region experiences a subtropical semi–humid frozen plateau climate, with annual sunshine totaling 1947.5 h and a sunshine rate of 44%. The average annual precipitation is 909.1 mm, distributed over 130 to 150 days. The soil in the area is classified as mountain red soil, characterized by low levels of nitrogen, phosphorus, and potassium, which are essential for plant growth. The primary crops cultivated include flue–cured tobacco, corn, and pepper. The baseline soil properties in the experimental field are as follows: organic carbon 5.51 g·kg−1, total nitrogen 0.45 g·kg−1, total phosphorus 1.35 g·kg−1, total potassium 2.79 g·kg−1, and pH 5.30.
2.2. Experimental Design
In this study, flue–cured tobacco (Yuxi Cigarette Factory of China Tobacco Hongta Group, variety K326) was used as the test material. The experimental field had a slope of 15°, and 24 quadrats (1 m × 1 m) were established with a spacing of over 2 m between quadrats. Each fertilization treatment was replicated three times, and the plots were arranged randomly. Machine tillage to a depth of 30–40 cm was performed concurrently with local farming practices before the flue–cured tobacco planting period. Sample plots were prepared, and plastic films were applied, as illustrated in Figure 1. In this study, the compost was composed of 70% kitchen waste, primarily vegetables and fruits, combined with 20% rice bran, 5% calcium superphosphate, and 5% urea. Composting reached basic maturity within 10–15 days [12]. Kitchen waste was collected from school restaurants, markets, and fruit shops to collect vegetable and fruit residues, as well as some leftovers; during the collection process, we removed the residual plastic bags and other contaminated garbage, such as discarded tableware, hard nut shells, and nuts. The initial properties of the kitchen waste compost are as follows: organic matter 464.42 g·kg−1, total nitrogen 17.90 g·kg−1, total phosphorus 1.82 g·kg−1, total potassium 1.53 g·kg−1, and pH 7.2~7.5.
Figure 1.
Overview of the study area and plot diagram.
The chemical fertilizer application followed local farming practices. Base fertilizer was applied on the day of transplanting, while seedling fertilizer, a specialized compound fertilizer for flue–cured tobacco, was applied 7 days later. Topdressing fertilizer, formulated specifically for tobacco, was applied 20 days after transplanting. Base fertilizer refers to the fertilizer that is applied to the soil during tobacco field preparation during the flue–cured tobacco planting process. The main function of basal fertilizer is to provide the nutrients needed for the early growth of tobacco leaves to ensure the smooth growth and development of tobacco seedlings; tillering fertilizer is a fertilizer applied to increase the growth rate of the flue–cured tobacco seedlings, and the topdressing is a fertilizer applied again during the growth stage of the flue–cured tobacco to ensure normal growth of the flue–cured tobacco. The application rates were as follows: seedling fertilizer at 0.3 t·hm−2 and top dressing at 0.45 t·hm−2. The nutrient compositions were N–P2O5–K2O: 12:6:24 for both seedling and base fertilizers, and N–P2O5–K2O: 18:5:22 for the topdressing fertilizer. A total of eight different base fertilization treatments were used in the study; CK: no fertilization; T1: pure compound fertilizer (1 t·hm−2); T2: low amount of kitchen waste + pure compound fertilizer (12 t·hm−2 + 1 t·hm−2); T3: medium amount of kitchen waste + pure compound fertilizer (15 t·hm−2 + 1 t·hm−2); T4: high amount of kitchen waste + pure compound fertilizer (18 t·hm−2 + 1 t·hm−2); T5: low amount of kitchen waste (12 t·hm−2); T6: medium amount of kitchen waste (15 t·hm−2); T7: high amount of kitchen waste (18 t·hm−2). The numbers 2, 15, and 18 in brackets represent the amount of food waste applied, and 1 represents the amount of chemical fertilizer applied. The chemical fertilizers mentioned above are all compound fertilizers, the main component of which is potassium sulfate. The fertilization details for each treatment are summarized in Table 1.
Table 1.
Application amount and conversion amount of each treatment (t·hm−2).
2.3. Sample Collection
Soil samples (0–20 cm depth) were collected within 10 cm of the plant root zone at four growth stages, rosette, topping, maturity, and abandonment, following the application of base fertilizer. Sampling was carried out according to the 5–point sampling method (that is, sampling at 5 different points in the quadrant), and 3 replicates were collected for each treatment. Coarse roots and other extraneous materials were removed, and the soil was collected into self–sealing bags. Samples were stored in ice bags and promptly transported to the laboratory. Fresh soil samples were passed through a 2 mm sieve. A portion was stored at 4 °C for the measurement of ammonium nitrogen and nitrate nitrogen, while another portion was stored at −80 °C for DNA extraction and microbial analysis. The remaining soil was air–dried, sieved sequentially through 2 mm, 1 mm, and 0.25 mm meshes, and then stored at room temperature for the determination of pH, total nitrogen, total phosphorus, and organic carbon.
2.4. Chemical Property Analysis
The total nitrogen of soil samples was measured using the automatic nitrogen analyzer method (ISO 11261:1995), the nitrate nitrogen was measured using the ultraviolet spectrophotometric method (ISO 11261:1995) [27], the ammonium nitrogen was measured using the indophenol blue colorimetric method, and the soil pH was measured. The value was measured using a pH meter (msoil:Vwater = 1:5), and the soil organic carbon (SOC) content was measured using the potassium dichromate–externally heated sulfuric acid oxidation method. Soil ammonium nitrogen, pH, and organic carbon were measured with reference to the method of Bao [28]. Regarding the specific chemical properties of food waste: total nitrogen, total phosphorus, and pH were determined according to Bao’s plant and fertilizer chemical property determination method, and other indicators were consistent with the soil determination method. The main measuring instruments included an automatic nitrogen determination instrument (FOSS, kjeltec8400, Hilloeroed, Denmark), UV–visible spectrophotometer (Beijing Puanalysis General Co., Ltd., T6 New Century, Beijing, China), and a pH meter (Shanghai YIEH Scientific Instrument Co., Ltd., PHS–3C, Shanghai, China).
2.5. DNA Extraction and Analysis
DNA was extracted from the samples using the E.Z.N.A™ Mag–Bind Soil DNA Kit (OMEGA, MA, USA). The extracted genomic DNA was quantified using the Qubit® 4.0 DNA Assay Kit to determine the appropriate DNA input for PCR reactions. The primers used for PCR were AOA (Arch–amoAF: STAATGGTCTGGCTTAGACG and Arch–amoAR: GCGGCCATCCATCTGTATGT) and AOB (amoA–1F: GGGGTTTCTACTGGTGGT and amoA–2R: CCCCTCKGSAAAGCCTTCTTC). AOA and AOB were amplified in two rounds of PCR. The first round used a reaction system of 30 µL, consisting of 15 µL 2× Hieff® Robust PCR Master Mix, 1 µL Bar–PCR primer F, 1 µL Primer R, 10–20 ng DNA template, and 9–12 µL H2O. The reaction conditions were pre–denaturation at 94 °C for 3 min, followed by 5 cycles of denaturation at 94 °C for 30 s, annealing at 45 °C for 20 s, extension at 65 °C for 30 s, then 20 cycles of denaturation at 94 °C for 20 s, annealing at 55 °C for 20 s, extension at 72 °C for 30 s, with a final extension at 72 °C for 5 min, and then preservation at 10 °C. The second round of PCR introduced Illumina bridge–compatible primers. The reaction system consisted of 30 µL, including 15 µL 2× Hieff® Robust PCR Master Mix, 1 µL Primer F, 1 µL Index–PCR Primer R, 20–30 ng product from the first round, and 9–12 µL H2O. The reaction conditions included pre–denaturation at 95 °C for 3 min, followed by 5 cycles of denaturation at 94 °C for 20 s, annealing at 55 °C for 20 s, extension at 72 °C for 30 s, with a final extension at 72 °C for 5 min, and then preservation at 10 °C. Library size was verified using 2% agarose gel electrophoresis, and library concentration was measured with a Qubit 3.0 fluorescence analyzer. Libraries were pooled in equal ratios and sequenced on the Illumina MiSeq platform by Shanghai Sangon Biotechnology Engineering Co., Ltd.
The two–terminal sequence data were obtained by sequencing, and the sequencing sequence contained the barcode sequence, as well as the primers and adaptor sequences added during sequencing. First, the primer adapter sequence needs to be removed, and then the paired reads are spliced (merged) into a sequence according to the overlap relationship between PE reads. Then, the samples are identified and distinguished according to the barcode tag sequence to obtain each sample data. Finally, the quality of each sample data is subjected to quality control filtering to obtain valid data for each sample.
Data optimization methods and parameters:
- (1)
- Cutadapt (Version 1.18.) was used to remove Read1 3′ sequencing primer adaptor AGATCGGAAGAGCACACGTCTGAACTCCAGTCA and Read2 3′ sequencing primer adaptor AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT;
- (2)
- According to the overlap relationship between PE reads, PEAR (Version 0.9.8.) is used to splice paired reads into a sequence;
- (3)
- According to the barcode sequence and primer sequence of each sample, the sample data are segmented from the spliced data, and the sequence direction is corrected;
- (4)
- PRINSEQ (Version 0.20.4) was used to remove the bases with a mass value below 20 in the tail of reads, and a 10 bp window was set. If the average mass value in the window was less than 20, the back–end bases were cut off from the window, and the N–containing sequences and short sequences after quality control were filtered, and finally the low–complexity sequences were filtered out.
OTU (Operational Taxonomic Units) is a unified symbol artificially set for a certain classification unit (strain, genus, species, grouping, etc.) in order to facilitate analysis in phylogenetic or population genetics research. In order to understand the number of species, genera, and other information in the sequencing results of a sample, it is necessary to cluster the sequences. Through clustering operation, the sequences are divided into many groups according to their similarity, and one group is an OTU. OTUs of all sequences can be divided according to different similarity levels, and bioinformatics statistical analysis of OTUs at 97% similarity level is usually performed.
The OTU clustering steps are as follows:
- (1)
- The non–repetitive sequence is extracted from the optimized sequence of each sample, which is convenient to reduce the redundant calculation amount of the analysis intermediate process (http://drive5.com/usearch/manual/cmd_fastx_uniques.html, accessed on 2 April 2024);
- (2)
- All samples to remove redundant sequences after the merger to remove the single sequence without duplication (http://drive5.com/usearch/manual/singletons.html, accessed on 8 April 2024);
- (3)
- OTU clustering is performed on non–repeat sequences (excluding single sequences) according to 97% similarity. Chimeras are removed during the clustering process to obtain the representative sequence of OTU (http://drive5.com/usearch/manual/cmd_cluster_otus.html, accessed on 14 April 2024);
- (4)
- All the optimized sequences are aligned to the OTU representative sequences, and the sequences with more than 97% similarity to the representative sequences are selected to generate the OTU table (https://drive5.com/usearch/manual/, accessed on 19 April 2024).
In order to obtain the species classification information corresponding to each OTU, it is necessary to use the corresponding database for taxonomic analysis of OTU representative sequences according to different amplification types. The following software and algorithms are mainly used:
RDP classifier (Version 2.12.): RDP classifier is based on Bergey’s taxonomy. The Naïve Bayesian assignment algorithm is used to calculate the probability value of each sequence assigned to this level at different levels.
SINTAX: (Version 1.0.) Simple non–Bayesian taxonomy, based on the non–naive Bayesian classification algorithm, uses Kmer (default k = 8, put back sampling 32 km) to calculate and share Kmer with the reference library to determine the best hits, iterate 100 times, and determine the classification (the classification with the most occurrences) and credibility (the frequency of occurrences) of each level.
Blast: (Version 2.10.0.) Blastn was used to compare the sequence with the corresponding database to screen out the best alignment results of the sequence, and the results were filtered. By default, the sequences with similarity > 90% and coverage > 90% were used for subsequent classification, and the sequences that did not meet the conditions were classified as unclassified.
By default: RDP classifier is used to compare 16S amplified fragments with the RDP database; the full–length 16S was aligned to the GTDB database using Blast. Functional genes were blasted against the NCBI NT database. 18S used Blast to compare Silva data; it uses Blast to compare with the UNITE database. The software version is the same as above.
Finally, they were classified at each level: domain, phylum, class, order, family, genus, and species.
Chao index: The Chao1 algorithm is used to estimate the number of OTUs contained in the sample. Chao1 is commonly used in ecology to estimate the total number of species. The larger the Chao1 value, the higher the species richness in the sample. The calculation formula is as follows:
where SChao1 is the estimated OTU number; Sobs is the number of actually observed OTUs; n1 is the number of OTUs containing a sequence; n2 is the number of OTUs containing two sequences.
Shannon index: one of the indexes used to estimate the microbial diversity in the sample. The larger the Shannon value, the higher the community diversity. The calculation formula is as follows:
where in the formula: Sobs is the number of OTUs actually observed; ni is the number of sequences contained in the OTU; N is the number of all individuals, which here is the total number of sequences. The above microbiological determination and data analysis methods are all from the analysis reports provided by Sangon Bioengineering (Shanghai) Co., Ltd. (Shanghai, China). Detailed information on microbiological assays is provided in the Supplementary Materials Table S1.
2.6. Data Processing and Analysis
Soil chemical properties were processed using Microsoft Excel 2021 software, and SPSS (version 26.0) was used for one–way analysis of variance (one–way ANOVA) and multiple comparisons of least significant difference (LSD). GraphPad Prism (version 10.2.3) was utilized to create histograms of soil chemical properties and microbial α–diversity. Histograms depicting the relative abundance of microorganisms were generated in Origin (version 2021). The correlation analysis between environmental factors and soil microorganisms was conducted utilizing R (version 4.3.3). RDA analysis and β–diversity were performed using the Lianchuan Biocloud platform (version 3.6, https://www.omicstudio.cn/tool, accessed on 25 September 2024) for NMDS visual statistical analysis. When constructing a network of OTUs with relative abundance higher than 0.1%, the relative abundance of bacterial and fungal communities was considered. OTUs with a relative abundance of zero in two–thirds of the samples were excluded. The random matrix theory (RMT) is used to determine the optimal similarity threshold, and the pairwise similarity matrix is calculated based on a Spearman correlation. All analyses were performed using the molecular ecological network (MENs) analysis platform (iNAP, https://inap.denglab.org.cn/, accessed on 25 June 2024). Gephi (version 0.10.1) software was used to export and process nodes and edges, and the co–occurrence network diagram of bacterial and fungal communities was drawn.
3. Results
3.1. Soil Chemical Properties
The results presented in Figure 2 demonstrate that the application of kitchen waste significantly influenced soil chemical properties (p < 0.05). Among them, pH, TN, and NH4+–N showed significant changes during the rosette and topping stages of flue–cured tobacco, while soil organic carbon (SOC) and nitrate nitrogen (NO3−–N) exhibited more pronounced effects during the maturity and fallow stages. The single application of kitchen waste (T5, T6, T7) notably improved soil nutrient status compared to CK, with increases in SOC (15.79–217.24%), TN (1.53–92.99%), NH4+–N (18.19–520.74%), and NO3−–N (15.54–750.61%). Additionally, the low–dose kitchen waste treatment (T5) effectively alleviated soil acidification, reducing acidity by 2.33–3.33% compared to T1. Kitchen waste combined with chemical fertilizer (T3, T4, T5) also improved soil chemical properties compared to CK. However, the combined treatments led to a pH decrease of 1.30–6.50%.
Figure 2.
Soil chemical properties. (a) Soil pH in different periods; (b) soil organic carbon (SOC), g·kg−1; (c) soil total nitrogen (TN), g·kg−1; (d,f) soil ammonium nitrogen (NH4+–N), mg·kg−1; (e,g) soil nitrate nitrogen (NO3−–N), mg·kg−1. * Represents p < 0.05, ** represents p = 0.05–0.001, *** represents p < 0.001, **** represents p < 0.0001. The treatments (CK, T1–T7) are as described in Section 2.2 and apply consistently throughout the analysis.
3.2. Soil AOA and AOB Community Structure
3.2.1. α–Diversity
From the perspective of different periods, the Shannon index and Chao index of AOA and AOB showed a trend of decreasing first and then increasing (Figure 3). The AOA Shannon index and Chao index performed well in the abandonment period, while the AOB performed well in the rosette stage. It is superior to other treatments, and T3, T6, and T7 treatments are superior to other treatments in the rosette stage. Under different treatments, the Shannon and Chao indices of AOA were highest in T1 across all four periods, while AOB indices were highest in CK. The combined application of kitchen waste and chemical fertilizer (T2, T3, T4) resulted in lower AOA Shannon and Chao indices compared to CK, indicating reduced richness and diversity in the AOA community. In contrast, the single application of kitchen waste (T5, T6, T7) showed higher AOB Shannon and Chao indices compared to chemical fertilizer alone (T2), suggesting that kitchen waste increases the richness and diversity of the AOB community compared to traditional chemical fertilizer.
Figure 3.
Shannon index and Chao index.
3.2.2. β–Diversity
NMDS was used to analyze the diversity of AOA and AOBβ (Figure 4). The stress during the analysis was less than 0.05, indicating that the configuration after reducing the dimension could well represent the distance relationship of the original data. There was no significant change in the community structure of AOA and AOB (p > 0.05). In different periods, the community structure of AOA and AOB changed significantly (p < 0.05). The AOA samples in the rosette stage and the dome stage were close, indicating that the AOA species compositions of the two periods were similar, while the AOB samples in the mature stage were far away from the samples of other periods, indicating that the species composition of the mature stage was quite different from that of other periods. In general, the community structure of AOA and AOB changed more significantly in different periods.
Figure 4.
NMDS non–metric multidimensional scale analysis diagram. (a) NMDS analysis of ammonia–oxidizing archaea in different periods; (b) NMDS analysis of different treatments of ammonia–oxidizing archaea; (c) NMDS analysis of ammonia–oxidizing bacteria in different periods; (d) NMDS analysis of different treatments of ammonia–oxidizing bacteria. Points of different colors or shapes represent samples of different groups. The closer the two sample points are the more similar the species composition of the two samples is. The horizontal and vertical axes represent the relative distance, which is of no practical significance. Stress test of the results of NMDS analysis. It is generally believed that when stress < 0.2, it can be expressed by the two–dimensional point diagram of NMDS, and the diagram has certain explanatory significance. When stress < 0.1, it can be considered as a good sort; when stress < 0.05, it has a good representation.
3.3. Soil AOA and AOB Community Composition
The results in Figure 5 indicate that, based on taxonomic information, the dominant phyla of AOA at the phylum level across different periods are Thaumarchaeota and Crenarchaeota (relative abundance >5%). The relative abundance of these phyla initially decreases over time and then increases during the fallow stage. Among the treatments, kitchen waste combined with chemical fertilizer (T2, T3, T4) showed a higher relative abundance of Crenarchaeota compared to CK during the rosette stage, but the relative abundance decreased during subsequent periods. The single kitchen waste treatment (T6) increased the relative abundance of Crenarchaeota. The relative abundance of Thaumarchaeota varied across treatments and periods, with T6 achieving higher values than other treatments (7.11–25.23%). Overall, the total relative abundance of Thaumarchaeota and Crenarchaeota across all four periods was highest under T6, demonstrating the best performance.
Figure 5.
Relative abundance of AOA at the phylum level. (a) AOA relative abundance during the rosette stage; (b) AOA relative abundance during the topping stage; (c) AOA relative abundance during the maturity stage; (d) AOA relative abundance during the fallow stage.
The results of Figure 6 show that the dominant phylum of AOB at different stages is Proteobacteria, with relative abundance ranging from 2.81% to 26.13%. The lowest relative abundance was observed during the maturity stage. Among the treatments, T3 exhibited a lower relative abundance of Proteobacteria than CK during the rosette stage but showed higher values in the other periods (6.81–14.12%). Single kitchen waste treatments (T5, T6, T7) achieved a higher relative abundance of Proteobacteria (2.81–19.35%) compared to T2. Considering the total relative abundance of Proteobacteria across the four periods, all treatments were higher than CK, with T4 and T5 significantly outperforming the other treatments.
Figure 6.
Relative abundance of AOB at the phylum level. (a) AOB relative abundance during the rosette stage; (b) AOB relative abundance during the topping stage; (c) AOB relative abundance during the maturity stage; (d) AOB relative abundance during the fallow stage.
The dominant genera of AOA and AOB across the four periods are presented in Figure 7. For AOA, the primary genera included norank_Thaumarchaeota, norank_Crenarchaeota and norank_Archaea, which accounted for the majority of the dominant genera. The relative abundance during the rosette and topping stages was higher compared to other periods, with single kitchen waste treatments (T5, T6, T7) performing better than other treatments. Nitrogen–related dominant genera, such as Frateuria, Bradyrhizobium, Legionella, Pseudomonas, Candidatus_Nitrosocosmicus, were distributed across different growth periods of flue–cured tobacco. For AOB, Nitrosospira and norank_Bacteria were the most prominent genera. The relative abundance of Nitrosospira reached its lowest during the maturity stage but increased again in the fallow stage. Treatments T4 and T5 exhibited superior performance in supporting the relative abundance of Nitrosospira compared to other treatments. Genus level relative abundance (%) details are provided in Table S2 in the Supplementary Materials.
Figure 7.
Relative abundance of AOA and AOB at the genus level. Only genera with relative abundance >1% are shown, with the remaining genera categorized as “other”.
3.4. Soil AOA and AOB Co–Occurrence Network
The co–occurrence network analysis across different periods (Figure 8) revealed that the number of nodes in the AOA network was comparable to those in the AOB network. However, AOB exhibited a higher number of connection edges, while AOA showed greater modularity, indicating tighter internal connections and higher stability for AOA across the four periods. AOB demonstrated greater network complexity and stronger cross–species interactions. The number of nodes and connection edges in the AOA network peaked during the fallow stage, with positive connections reaching 97.70% during the maturity stage, reflecting significant community synergy at this stage. For AOB, the highest number of connection edges, average degree, and graph density was observed during the topping stage, although modularity was the lowest, suggesting that the AOB community exhibited high complexity and stability during the topping stage, with limited differentiation. Overall, AOA displayed better performance during the maturity and fallow stages, while AOB showed superior performance during the topping stage compared to other periods.
Figure 8.
Soil AOA and AOB co–occurrence network. (a) Co–occurrence network properties of AOA and AOB across different periods; (b) modularity, average degree, graph density, and average path length across different periods. Node size represents module connection size. Red lines indicate cooperative relationships between species, while green lines represent competitive relationships.
3.5. Relationship Between the Soil AOA and AOB Community Structure and Soil Chemical Properties
A Mantel test and RDA were conducted to examine the relationship between AOA and AOB community structure and soil chemical properties (Figure 9). AOA showed a strong correlation with soil chemical properties during the topping and maturity stages, while AOB exhibited stronger correlations during the rosette and fallow stages. The main controlling factors varied by period, with pH and SOC significantly associated with other chemical properties across all stages. RDA revealed that all soil chemical properties had significant effects on the distribution of AOA and AOB. Proteobacteria_AOB, Crenarchaeota, Bacteroidetes, and pH were negatively correlated with pH and positively correlated with other chemical properties. During the topping stage, all chemical properties except NH4+–N and pH were significantly correlated. Proteobacteria_AOB was negatively correlated with TN and NO3−–N, while Crenarchaeota and Thaumarchaeota showed positive correlations with these factors and negative correlations with SOC. At the maturity stage, only TN had no significant effect, and Crenarchaeota and Thaumarchaeota were negatively correlated with chemical properties. During the fallow stage, NO3−–N was the only factor significantly correlated with SOC. Overall, soil chemical properties influenced the distribution of AOA and AOB communities, with pH and SOC identified as the primary controlling factors. For details on RDA, see Supplementary Materials Table S3.
Figure 9.
Mantel test and redundancy analysis (RDA). (a–d) Mantel analysis of the rosette, topping, maturity, and fallow stages. The Pearson correlation coefficient between soil chemical properties and microbial community traits is shown in the right–angle triangle diagram, while Mantel test results are displayed along the middle line. (e–h) RDA of the rosette, topping, maturity, and fallow stages, respectively. * Represents p < 0.05, ** represents p = 0.05–0.001, *** represents p < 0.001.
4. Discussion
4.1. Effect of Kitchen Waste on Soil Chemical Properties
This study demonstrated that the application of kitchen waste significantly alters soil chemical properties, supporting hypothesis 1 (kitchen waste alters the chemical properties of tobacco–planting red soil). A low amount of kitchen waste alleviated soil acidification, likely due to alkaline substances in the compost and the release of ions that neutralized soil pH, consistent with the findings of Zhang et al. [12]. As the amount of kitchen waste increased, the decomposition of organic matter released small molecular organic acids. At higher proportions of kitchen waste, acid accumulation intensified, leading to a decrease in soil pH, consistent with the results of Han et al. [2] in studies on purple soil. The contents of TN, NH4+–N, NO3−–N, and SOC increased with the application of kitchen waste alone or in combination with chemical fertilizer, likely due to the addition of organic matter, which decomposes to produce stable SOC and nitrogen sources. SOC content increased over time, while TN content rose significantly in the early stages [29,30]. The increase in SOC was more pronounced than that of TN, leading to a higher soil C/N ratio. This environment promoted microbial development, enhanced microbial activity, and improved soil nitrogen supply capacity. As a result, TN, NH4+–N, and NO3−–N contents increased [31], aligning with the results of Gao et al. [32]. The improvement in soil nutrient content from kitchen waste application may also be explained by increased nutrient utilization efficiency in plants [33], which boosts plant biomass and litter content in the soil. The decomposition of litter further enriches soil nutrients, while plant and microbial residues from flue–cured tobacco growth contribute additional SOC [34]. Under different treatments, the combined application of kitchen waste and chemical fertilizer significantly increased the content of NH4+–N and NO3−–N in the soil. This effect can be attributed to the provision of inorganic nitrogen from chemical fertilizers, supplemented by the nitrogen released during kitchen waste decomposition. The combined contributions of these sources led to a substantial increase in soil NH4+–N and NO3−–N content. Although this study did not explore whether there is nutrient overflow, resulting in nutrient loss or eutrophication, but previous studies have shown that the application of kitchen waste (8 t/hm2,16 t/hm2,24 t/hm2) can improve soil chemical properties and microbial activity [12], and that the application of kitchen waste (12 t/hm2,15 t hm2,18 t/hm2) can reduce the loss of N and P in runoff and sediment, but also that the application of kitchen waste combined with chemical fertilizer (12 t·hm−2 + 1 t·hm−2, 15 t·hm−2 + 1 t·hm−2, 18 t·hm−2 + 1 t·hm−2) increased the loss of N and P in runoff and sediment [35].
4.2. Effects of Kitchen Waste on the Community Structure and Composition of AOA and AOB
NMDS analysis revealed significant changes in the community structure of AOA and AOB across different periods. The most pronounced changes in AOA occurred during the maturity stage of flue–cured tobacco, while AOB showed the most significant changes during the rosette stage. These changes may be closely linked to seasonal fluctuations in environmental factors, such as nitrogen availability, soil moisture, and root activity [36]. These findings align with Wu et al. [37], who reported that AOA and AOB community structures vary significantly over time. The Shannon index and Chao index of AOB were higher during the rosette stage than in other periods, likely due to AOBs preference for nitrogen–rich environments, increased root exudates, and the accelerated decomposition of organic matter during this period [38]. However, no significant differences in community structure were observed between treatments for either AOA or AOB. AOA may be more sensitive to low–nitrogen environments and does not consistently respond strongly to high nitrogen levels [39,40]. Although all treatments increased soil nitrogen content, the insensitivity of AOA to high nitrogen levels may explain the lack of significant changes in its community structure. The higher Shannon and Chao indices of AOA in the T1 treatment compared to other treatments may be attributed to its sensitivity to nitrogen levels. Liu et al. [41] also found that the fertilization system (reduced nitrogen fertilizer treatment, conventional fertilizer treatment, and manure instead of fertilizer treatment) did not significantly change the community composition of AOA. However, the community structure of AOB showed no significant changes across treatments, which may be due to the acidic soil pH inhibiting AOB activity [42]. Additionally, long–term stable fertilization conditions may result in a resilient biological community that remains unaffected by short–term external stimuli [36]. Single kitchen waste treatments (T5, T6, T7) exhibited higher AOB diversity compared to the chemical fertilizer treatment (T2), suggesting that kitchen waste application promotes AOB activity and increases community diversity. These findings are consistent with the results of Chen et al. [36].
This study showed that kitchen waste application significantly affected the community composition of AOA and AOB (Figure 5 and Figure 6), supporting hypothesis 2 (kitchen waste influences the community structure and composition of AOA and AOB). Across different periods, the dominant phyla of AOA were Thaumarchaeota and Crenarchaeota, among which Thaumarchaeota played a key role in the soil nitrogen cycle, especially in low nitrogen concentration environment [43]. Under different treatments, Thaumarchaeota exhibited the best performance in the T7 treatment, potentially due to the moderate nitrogen availability in this treatment, which allowed Thaumarchaeota to fully utilize its adaptive capabilities [44]. Crenarchaeota, as part of the soil microbial community, primarily contributes to the decomposition and mineralization of organic matter. Through metabolic activities, it promotes both nitrogen and carbon cycling. Treatments combining kitchen waste with chemical fertilizer (T2, T3, T4) significantly increased the relative abundance of Crenarchaeota during the rosette stage, likely due to the decomposition of kitchen waste. This process produces organic nitrogen and other nutrients, fostering the growth of these microorganisms. This process produces organic nitrogen and other nutrients, fostering the growth of these microorganisms. From the genus level of AOA, Candidatus Nitrosocosmicus is mainly involved in the nitrogen cycle, especially the oxidation process of ammonia. Bradyrhizobium is a well–known nitrogen–fixing bacterium that allows plants to obtain necessary nitrogen from nitrogen gas. Frateuria promotes plant growth by improving nutrient cycling in the soil. As the main dominant genus of AOA, they play an important role in the nitrogen cycle. The dominant phylum of AOB across different periods was Proteobacteria, with Nitrosospira identified as the dominant genus. Previous studies have also reported Nitrosospira as the primary AOB in agricultural soils [45]. Its relative abundance was higher during the rosette and abandonment stages than during the topping and maturity stages, likely due to reduced nitrogen availability caused by plant uptake during the maturity stage. Nitrosospira is more active under high nitrogen conditions, benefiting from its strong adaptability to fluctuations in ammonia concentration during ammonia oxidation [46]. Among treatments, the relative abundance of Proteobacteria was higher in single kitchen waste applications compared to chemical fertilizer treatments, indicating that organic fertilizers have a more pronounced effect on AOB activity. Organic fertilizers, such as kitchen waste, provide a continuous nutrient supply for AOB. During the gradual decomposition of organic matter, AOB generates energy through ammonia oxidation, leading to increased community abundance [47].
The stability of the soil environment depends not only on the community composition and structure of AOA and AOB but also on their interactions and co–occurrence networks [48,49]. The equal number of nodes for AOA and AOB indicates a balanced community composition across the four periods, with consistent species richness at different growth stages. Both AOA and AOB play critical roles in the ammonia oxidation process. However, the higher number of connected edges in the AOB network suggests a more complex interaction network and greater involvement in cross–species interactions. The nitrogen–rich environment created by the application of kitchen waste in this study likely facilitated these interactions among AOB. Modularity serves as a key indicator of community differentiation, with higher modularity typically reflecting stronger collaboration or division of labor within a community [50]. The AOA community exhibited higher modularity than AOB, indicating closer internal connections and greater stability. Over time, the number of connected edges in the AOA network increased, peaking during the fallow stage, marking it as the period of highest AOA activity. During the maturity stage, 97.70% of AOA connections were positive, signifying enhanced synergy within the community. Positive connectivity often indicates mutualistic or synergistic interactions, such as shared resource utilization or a functional division of labor in nitrogen cycling [51]. These findings suggest that AOA not only demonstrated high community stability at maturity but also achieved closer functional collaboration, thereby enhancing the efficiency of the ammonia oxidation process. Average degree and graph density are key indicators to measure the network structure. A high average degree indicates that each node (species) interacts with a greater number of other species within the community. The co–occurrence network of AOB reached its highest number of connected edges, average degree, and graph density during the topping stage, reflecting the highest complexity of interactions and active species dynamics during this period.
4.3. The Relationship Between AOA, AOB, and Soil Chemical Properties
The Mantel test and RDA analysis in this study identified pH and SOC as the primary factors influencing the community structure and composition of AOA and AOB, consistent with findings by Lehtovirta–Morley et al. [52], who reported that substrate concentration, pH, and C/N ratio are key drivers of AOA and AOB abundance and activity. These results support hypothesis 3 (pH is the main factor affecting the community structure and composition of AOA and AOB) of this study. SOC showed a negative correlation with the abundance of the dominant phyla of AOA and AOB, aligning with the findings of Sun et al. [53]. This negative relationship may be attributed to the limitation of ammonia–oxidizing microorganisms by increased heterotrophic activity. Therefore, the quantity and quality of soil organic matter is crucial for determining the abundance of heterotrophic microorganisms and their competition with nitrifying bacteria [54]. RDA revealed that pH was positively correlated with the abundance of the most dominant AOA phyla and negatively correlated with the abundance of the most dominant AOB phyla. This pattern may result from the acidic soil conditions in the study area, where AOA thrives and shows positive correlations, while AOB, which favors neutral or alkaline environments, is inhibited, leading to negative correlations. These findings align with those of Lehtovirta–Morley et al. [43] and Di et al. [55]. Although soil pH and substrate concentration are recognized as key factors influencing the differentiation of ammonia–oxidizing microorganisms [56], neither factor alone fully explains the complex interactions between environmental variables and these microorganisms [57]. The results of this study also showed that soil chemical properties had complex effects on the community structure and abundance of AOA and AOB. The primary controlling factors and their impact levels varied across periods. For instance, AOA favors low NH4+–N concentrations, while AOB thrives in high NH4+–N environments. NO3−–N significantly influenced AOA during the rosette stage but had a more pronounced effect on AOB during the maturity and fallow stages. SOC showed a consistent and significant impact on ammonia–oxidizing bacteria across all periods. Overall, soil chemical properties, especially pH and SOC, have a significant effect on the distribution and community structure of AOA and AOB. This study further confirmed the important role of soil chemical properties in regulating microbial community structure and nitrogen cycle function.
5. Conclusions
The application of kitchen waste significantly improved soil chemical properties and increased nutrient content. Temporal variations had a greater influence on the community structure of AOA and AOB than different treatments. Among the treatments, the single application of kitchen waste had the most pronounced effect on soil chemical properties and microbial activity. The dominant phylum of AOA in different periods was Thaumarchaeota and Crenarchaeota, while Proteobacteria was the dominant phylum of AOB. Co–occurrence network analysis revealed that AOA exhibited tight and stable internal connections, with stronger co–operation during the maturity stage, enhancing the efficiency of the ammonia oxidation process. In contrast, AOB showed higher community complexity and stronger cross–species interactions, with the most active interactions observed during the topping stage. Among soil chemical factors, pH and SOC were identified as the primary drivers influencing the structure and composition of AOA and AOB communities. On the basis of this study, further research on the functions of microorganisms at different taxonomic levels and the response of other microorganisms involved in the nitrogen cycle to the application of food waste is still needed in the future.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy14123053/s1, Table S1: Microbial sequencing sequences and raw data statistics of final results; Table S2: Generic level relative abundance statistics table; Table S3: RDA chemical properties p value statistical table.
Author Contributions
Investigation, methodology, formal analysis, visualization, writing—original draft, and writing—reviewing and editing, D.Z.; conceptualization, visualization, methodology, data curation, and writing—original draft, W.C.; investigation, methodology, and data curation, C.W.; investigation, validation, and software, Z.H.; resources, supervision, and project administration K.W.; project administration, supervision, funding acquisition, and writing—review and editing, Y.S. All authors have read and agreed to the published version of the manuscript.
Funding
This research was supported by the Science and Technology Project of Yunnan Province (202203AC100001–03) and the First–Class Discipline in Soil and Water Conservation and Desertification Prevention in Yunnan Province (SBK20240044).
Data Availability Statement
The data presented in this study are available on request from the corresponding author (The data are not publicly available due to privacy or ethical restrictions).
Acknowledgments
The authors thank the following people for their help with this research: Meiting LI, Na Jin, Jinze Yang, and Dongyiting Peng provided field assistance.
Conflicts of Interest
The authors declare no conflicts of interest.
References
- Jianghao, H.; Yuhong, P.; Li, L.; Jinsong, L.; Linyu, W.; Hongtao, Z.; Panyue, Z. High salinity slowed organic acid production from acidogenic fermentation of kitchen wastewater by shaping functional bacterial community. J. Environ. Manag. 2022, 310, 114765. [Google Scholar] [CrossRef]
- Han, L.; Li, L.; Xu, X.; Ye, W.; Zhang, F.; Xu, Y.; Peng, X.; Zhen, F. Utilization of short–term high temperature pretreatment for food waste composting: Effects of end–products on soil properties and plant growth. J. Clean. Prod. 2024, 438, 140790. [Google Scholar] [CrossRef]
- Manu, M.; Li, D.; Liwen, L.; Jun, Z.; Varjani, S.; Wong, J.W. A review on nitrogen dynamics and mitigation strategies of food waste digestate composting. Bioresour. Technol. 2021, 334, 125032. [Google Scholar] [CrossRef] [PubMed]
- Mi, H.; Shen, C.; Ding, T.; Zheng, X.; Tang, J.; Lin, H.; Zhou, S. Identifying the role of array electrodes in improving the compost quality of food waste during electric field–assisted aerobic composting. Bioresour. Technol. 2023, 388, 129763. [Google Scholar] [CrossRef] [PubMed]
- Verma, S.; Awasthi, M.K.; Liu, T.; Awasthi, S.K.; Syed, A.; Bahkali, A.H.; Verma, M.; Zhang, Z. Influence of biochar on succession of fungal communities during food waste composting. Bioresour. Technol. 2023, 385, 129437. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Zhang, S.; Li, Y.; Wang, Y. Characteristics of denitrification activity, functional genes, and denitrifying community composition in the composting process of kitchen and garden waste. Bioresour. Technol. 2023, 381, 129137. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Bello, M.O.; Meng, Y.; Prosser, J.I.; Gubry-Rangin, C. Selective inhibition of ammonia oxidising archaea by simvastatin stimulates growth of ammonia oxidising bacteria. Soil Biol. Biochem. 2020, 141, 107673. [Google Scholar] [CrossRef]
- Kaur-Bhambra, J.; Wardak, D.L.; Prosser, J.I.; Gubry-Rangin, C. Revisiting plant biological nitrification inhibition efficiency using multiple archaeal and bacterial ammonia–oxidising cultures. Biol. Fertil. Soils 2022, 58, 241–249. [Google Scholar] [CrossRef]
- Kong, D.; Zhang, X.; Yu, Q.; Jin, Y.; Jiang, P.; Wu, S.; Liu, S.; Zou, J. Mitigation of N2O emissions in water–saving paddy fields: Evaluating organic fertilizer substitution and microbial mechanisms. J. Integr. Agric. 2024, 23, 3159–3173. [Google Scholar] [CrossRef]
- Jain, M.S.; Kalamdhad, A.S. Soil revitalization via waste utilization: Compost effects on soil organic properties, nutritional, sorption and physical properties. Environ. Technol. Innov. 2020, 18, 100668. [Google Scholar] [CrossRef]
- Willekens, K.; Vandecasteele, B.; Buchan, D.; De Neve, S. Soil quality is positively affected by reduced tillage and compost in an intensive vegetable cropping system. Appl. Soil Ecol. 2014, 82, 61–71. [Google Scholar] [CrossRef]
- Zhang, X.; Song, Y.; Yang, X.; Hu, C.; Wang, K. Regulation of soil enzyme activity and bacterial communities by food waste compost application during field tobacco cultivation cycle. Appl. Soil Ecol. 2023, 192, 105016. [Google Scholar] [CrossRef]
- Kabato, W.; Ergudo, T.; Mutum, L.; Janda, T.; Molnár, Z. Correction to: Response of wheat to combined application of nitrogen and phosphorus along with compost. J. Crop Sci. Biotechnol. 2022, 25, 621. [Google Scholar] [CrossRef]
- Sun, R.; Myrold, D.D.; Wang, D.; Guo, X.; Chu, H. AOA and AOB communities respond differently to changes of soil pH under long–term fertilization. Soil Ecol. Lett. 2019, 1, 126–135. [Google Scholar] [CrossRef]
- Zeng, J.; Zhao, D.; Yu, Z.; Huang, R.; Wu, Q.L. Temperature responses of ammonia–oxidizing prokaryotes in freshwater sediment microcosms. PLoS ONE 2014, 9, e100653. [Google Scholar] [CrossRef] [PubMed]
- Wang, F.; Liang, X.; Ma, S.; Liu, L.; Wang, J. Ammonia–oxidizing archaea are dominant over comammox in soil nitrification under long–term nitrogen fertilization. J. Soils Sediments 2021, 21, 1800–1814. [Google Scholar] [CrossRef]
- Li, Y.; Chapman, S.J.; Nicol, G.W.; Yao, H. Nitrification and nitrifiers in acidic soils. Soil Biol. Biochem. 2018, 116, 290–301. [Google Scholar] [CrossRef]
- Huang, X.; Zhao, J.; Su, J.; Jia, Z.; Shi, X.; Wright, A.L.; Zhu-Barker, X.; Jiang, X. Neutrophilic bacteria are responsible for autotrophic ammonia oxidation in an acidic forest soil. Soil Biol. Biochem. 2018, 119, 83–89. [Google Scholar] [CrossRef]
- Yu, C.; Huang, X.; Chen, H.; Godfray, H.C.J.; Wright, J.S.; Hall, J.W.; Gong, P.; Ni, S.; Qiao, S.; Huang, G. Managing nitrogen to restore water quality in China. Nature 2019, 567, 516–520. [Google Scholar] [CrossRef]
- Ali, S.; Kailou, L.; Ahmed, W.; Hayatu, N.; Daba, N.; Maitlo, A.A.; Zhe, S.; Jiwen, L.; Jing, H.; Huimin, Z. Gross nitrogen mineralization and nitrification at an optimal phosphorus input level in southern Chinese red soil with long–term fertilization. Soil Tillage Res. 2023, 230, 105710. [Google Scholar] [CrossRef]
- Runsheng, X.; Aiwu, Z.; Qingman, L.; Kong, X.-l.; Guoliang, J. Acidity regime of the Red Soils in a subtropical region of southern China under field conditions. Geoderma 2003, 115, 75–84. [Google Scholar] [CrossRef]
- Li, P.; Wu, M.; Kang, G.; Zhu, B.; Li, H.; Hu, F.; Jiao, J. Soil quality response to organic amendments on dryland red soil in subtropical China. Geoderma 2020, 373, 114416. [Google Scholar] [CrossRef]
- Da-Jiong, L.; Jiaen, Z.; Ying, O.; Huang, Q.-C. Role of Simulated Acid Rain on Cations, Phosphorus, and Organic Matter Dynamics in Latosol. Arch. Environ. Contam. Toxicol. 2006, 52, 16–21. [Google Scholar] [CrossRef]
- Wenju, Z.; Minggang, X.; Boren, W.; Xiujun, W. Soil organic carbon, total nitrogen and grain yields under long–term fertilizations in the upland red soil of southern China. Nutr. Cycl. Agroecosyst. 2008, 84, 59–69. [Google Scholar] [CrossRef]
- Zhang, X.; Li, Z.; Zeng, G.; Xia, X.; Yang, L.; Wu, J. Erosion effects on soil properties of the unique red soil hilly region of the economic development zone in southern China. Environ. Earth Sci. 2012, 67, 1725–1734. [Google Scholar] [CrossRef]
- Liu, Y.-J.; Hu, J.-M.; Wang, T.-W.; Cai, C.-F.; Li, Z.-X.; Zhang, Y. Effects of vegetation cover and road–concentrated flow on hillslope erosion in rainfall and scouring simulation tests in the Three Gorges Reservoir Area, China. Catena 2016, 136, 108–117. [Google Scholar] [CrossRef]
- ISO 11261:1995; Soil Quality–Determination of Total Nitrogen–Modified Kjeldahl Method. International Organization for Standardization (ISO): Geneva, Switzerland, 1995.
- Bao, S.D. Soil and Agricultural Chemistry Analysis, 3rd ed.; China Agricultural Press: Beijing, China, 2000; (Source from China). [Google Scholar]
- Sun, X.; Wang, G.; Ma, Q.; Liao, J.; Wang, D.; Guan, Q.; Jones, D.L. Organic mulching promotes soil organic carbon accumulation to deep soil layer in an urban plantation forest. For. Ecosyst. 2021, 8, 1–11. [Google Scholar] [CrossRef]
- Azis, F.A.; Choo, M.; Suhaimi, H.; Abas, P.E. The Effect of initial carbon to nitrogen ratio on kitchen waste composting maturity. Sustainability 2023, 15, 6191. [Google Scholar] [CrossRef]
- Pinggera, J.; Geisseler, D.; Piepho, H.-P.; Joergensen, R.G.; Ludwig, B. Effect of substrate quality on the N uptake routes of soil microorganisms in different soil depths. Pedobiologia 2015, 58, 211–218. [Google Scholar] [CrossRef]
- Gao, Y.; Wang, J.; Ge, Y.; Lei, Y.; Wei, X.; Xu, Y.; Zheng, X. Partial substitution of nitrogen fertilizers by organic products of rural waste co–composting impacts on farmland soil quality. Environ. Technol. Innov. 2024, 33, 103470. [Google Scholar] [CrossRef]
- Aguilar-Paredes, A.; Valdés, G.; Araneda, N.; Valdebenito, E.; Hansen, F.; Nuti, M. Microbial community in the composting process and its positive impact on the soil biota in sustainable agriculture. Agronomy 2023, 13, 542. [Google Scholar] [CrossRef]
- Hao, H.; Wang, R.; Li, S.; Pian, D.; Peng, N.; Sailike, A.; Yu, Z.; Shi, J.; Wang, X.; Wang, Z. Different contributions of microbial and plant residues to soil organic carbon accumulation during planted forest and abandoned farmland restoration, Loess Plateau, China. Plant Soil 2024, 1–18. [Google Scholar] [CrossRef]
- Zhang, D.; Wen, C.; Wang, K.; Song, Y.; Chen, W.; Chen, B. Effects of kitchen waste application on nitrogen and phosphorus balance characteristics of flue–cured tobacco farmland ecosystem in central Yunnan under erosive rainfall. Res. Soil Water Conserv. 2025, 32, 1–11, (Source: China National Knowledge Infrastructure CNKI). [Google Scholar] [CrossRef]
- Chen, Q.-L.; Ding, J.; Li, C.-Y.; Yan, Z.-Z.; He, J.-Z.; Hu, H.-W. Microbial functional attributes, rather than taxonomic attributes, drive top soil respiration, nitrification and denitrification processes. Sci. Total Environ. 2020, 734, 139479. [Google Scholar] [CrossRef]
- Wu, X.; Zhang, W.; Liu, G.; Chen, T.; Li, Z. Changes in Diversity and Abundance of Ammonia-Oxidizing Archaea and Bacteria along a Glacier Retreating Chronosequence in the Tianshan Mountains, China. Microorganisms 2023, 11, 2871. [Google Scholar] [CrossRef] [PubMed]
- Tang, H.; Yan, K.; Zhang, L.; Chi, F.; Li, Q.; Lian, S.; Wei, D. Diversity analysis of nitrite reductase genes (nirS) in black soil under different long–term fertilization conditions. Ann. Microbiol. 2010, 60, 97–104. [Google Scholar] [CrossRef]
- Yang, K.; Luo, S.; Hu, L.; Chen, B.; Xie, Z.; Ma, B.; Ma, W.; Du, G.; Ma, X.; Le Roux, X. Responses of soil ammonia–oxidizing bacteria and archaea diversity to N, P and NP fertilization: Relationships with soil environmental variables and plant community diversity. Soil Biol. Biochem. 2020, 145, 107795. [Google Scholar] [CrossRef]
- Assémien, F.L.; Pommier, T.; Gonnety, J.T.; Gervaix, J.; Le Roux, X. Adaptation of soil nitrifiers to very low nitrogen level jeopardizes the efficiency of chemical fertilization in west african moist savannas. Sci. Rep. 2017, 7, 10275. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Qin, S.; Li, Y.; Zhao, P.; Nie, Z.; Liu, H. Comammox Nitrospira and AOB communities are more sensitive than AOA community to different fertilization strategies in a fluvo–aquic soil. Agric. Ecosyst. Environ. 2023, 342, 108224. [Google Scholar] [CrossRef]
- Delgado-Baquerizo, M.; Maestre, F.T.; Reich, P.B.; Jeffries, T.C.; Gaitan, J.J.; Encinar, D.; Berdugo, M.; Campbell, C.D.; Singh, B.K. Microbial diversity drives multifunctionality in terrestrial ecosystems. Nat. Commun. 2016, 7, 10541. [Google Scholar] [CrossRef]
- Lehtovirta-Morley, L.E.; Stoecker, K.; Vilcinskas, A.; Prosser, J.I.; Nicol, G.W. Cultivation of an obligate acidophilic ammonia oxidizer from a nitrifying acid soil. Proc. Natl. Acad. Sci. USA 2011, 108, 15892–15897. [Google Scholar] [CrossRef] [PubMed]
- Lu, J.; Hong, Y.; Wei, Y.; Gu, J.-D.; Wu, J.; Wang, Y.; Ye, F.; Lin, J.-G. Nitrification mainly driven by ammonia–oxidizing bacteria and nitrite–oxidizing bacteria in an anammox–inoculated wastewater treatment system. AMB Express 2021, 11, 158. [Google Scholar] [CrossRef]
- Clark, I.M.; Hughes, D.J.; Fu, Q.; Abadie, M.; Hirsch, P.R. Metagenomic approaches reveal differences in genetic diversity and relative abundance of nitrifying bacteria and archaea in contrasting soils. Sci. Rep. 2021, 11, 15905. [Google Scholar] [CrossRef] [PubMed]
- Prosser, J.I.; Nicol, G.W. Archaeal and bacterial ammonia–oxidisers in soil: The quest for niche specialisation and differentiation. Trends Microbiol. 2012, 20, 523–531. [Google Scholar] [CrossRef]
- Yang, X.; Wu, Y.; Shu, L.; Gu, H.; Liu, F.; Ding, J.; Zeng, J.; Wang, C.; He, Z.; Xu, M. Unraveling the important role of comammox Nitrospira to nitrification in the coastal aquaculture system. Front. Microbiol. 2024, 15, 1355859. [Google Scholar] [CrossRef] [PubMed]
- De Vries, F.T.; Griffiths, R.I.; Bailey, M.; Craig, H.; Girlanda, M.; Gweon, H.S.; Hallin, S.; Kaisermann, A.; Keith, A.M.; Kretzschmar, M. Soil bacterial networks are less stable under drought than fungal networks. Nat. Commun. 2018, 9, 3033. [Google Scholar] [CrossRef] [PubMed]
- Gao, C.; Xu, L.; Montoya, L.; Madera, M.; Hollingsworth, J.; Chen, L.; Purdom, E.; Singan, V.; Vogel, J.; Hutmacher, R. Co–occurrence networks reveal more complexity than community composition in resistance and resilience of microbial communities. Nat. Commun. 2022, 13, 3867. [Google Scholar] [CrossRef]
- Newman, M.E. Modularity and community structure in networks. Proc. Natl. Acad. Sci. USA 2006, 103, 8577–8582. [Google Scholar] [CrossRef]
- Berry, D.; Widder, S. Deciphering microbial interactions and detecting keystone species with co–occurrence networks. Front. Microbiol. 2014, 5, 219. [Google Scholar] [CrossRef]
- Lehtovirta-Morley, L.E. Ammonia oxidation: Ecology, physiology, biochemistry and why they must all come together. FEMS Microbiol. Lett. 2018, 365, fny058. [Google Scholar] [CrossRef] [PubMed]
- Sun, J.; Rengel, Z.; Zhou, Y.; Li, H.; Zhang, A. Ammonia–oxidizing archaea bacteria (AOB) and comammox drive the nitrification in alkaline soil under long–term biochar and N fertilizer applications. Appl. Soil Ecol. 2024, 193, 105124. [Google Scholar] [CrossRef]
- Xiao, R.; Ran, W.; Hu, S.; Guo, H. The response of ammonia oxidizing archaea and bacteria in relation to heterotrophs under different carbon and nitrogen amendments in two agricultural soils. Appl. Soil Ecol. 2021, 158, 103812. [Google Scholar] [CrossRef]
- Di, H.J.; Cameron, K.C.; Shen, J.-P.; Winefield, C.S.; O’Callaghan, M.; Bowatte, S.; He, J.-Z. Ammonia–oxidizing bacteria and archaea grow under contrasting soil nitrogen conditions. FEMS Microbiol. Ecol. 2010, 72, 386–394. [Google Scholar] [CrossRef] [PubMed]
- Martens-Habbena, W.; Berube, P.M.; Urakawa, H.; de La Torre, J.R.; Stahl, D.A. Ammonia oxidation kinetics determine niche separation of nitrifying Archaea and Bacteria. Nature 2009, 461, 976–979. [Google Scholar] [CrossRef]
- Yao, H.; Campbell, C.D.; Chapman, S.J.; Freitag, T.E.; Nicol, G.W.; Singh, B.K. Multi–factorial drivers of ammonia oxidizer communities: Evidence from a national soil survey. Environ. Microbiol. 2013, 15, 2545–2556. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).